Synthetic Biology and Rational Design Keith Shearwin University of Adelaide
|
|
- Janice Chandler
- 5 years ago
- Views:
Transcription
1 Synthetic Biology and Rational Design Keith Shearwin University of Adelaide Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits 1
2 (1) (2) 2
3 (1) Understand natural circuits The complex genetic circuits found in cells are ordinarily studied by analysis of genetic and biochemical perturbations. The inherent modularity of biological components like genes and proteins enables a complementary approach: one can construct and analyse synthetic genetic circuits based on their natural counterparts. Such synthetic circuits can be used as simple in vivo models to explore the relation between the structure and function of a genetic circuit. 3
4 (2) Build useful stuff rational design Examples of applications of synthetic biology 4
5 Malaria ~ one million deaths annually, mostly children Artemisinin: Anti-malarial compound found in plant 5
6 Produce artemisinin in microorganisms 6
7 Produce artemisinin in microorganisms Enzymes from 3 species, plus extensive modification of individual steps Initial attempts yielded ~0.1 g/l 2012: yield ~40g/L. Over express all enzymes, in yeast Some metabolic engineering, some high throughput screening. 7
8 Early Sugar cane litre fermentors ~ tens of tonnes Sell at cost price Profit from other pathway intermediates - Farnesene (long chain hydrocarbon) 8
9 Building new circuits analogy with engineering 9
10 Synthetic Biology: analogy with engineering - modularity - standardisation - mathematical description 10
11 Modularity 11
12 Standardisation - engineering Consistent building blocks 12
13 Standardisation - biology Standard plasmids Interchangeable parts Standard method of assembly (Biobricks website) 13
14 Standardisation - biology 14
15 Standardisation - biology 15
16 Mathematical model Design Build Refine Test Allows the ability to make and test predictions about - Circuit behaviour (toggle switch, repressilator) - Stability - Robustness against perturbations - Effect of biological noise arising from low numbers of molecules (stochastic simulations) 16
17 Synthetic Biology Challenges of Synthetic Biology Technological advances Risk and Safety 17
18 Challenges for Synthetic Biology 18
19 Technological Advances 1. Fluorescent proteins/single cell microscopy Time lapse movies single cells -follow dynamics of multiple components of a given circuit -correlations between outputs 19
20 Technological Advances 1. Fluorescent proteins/single cell microscopy Time lapse movies single cells -follow dynamics of multiple components of a given circuit -correlations between outputs 20
21 Technological Advances 2. DNA synthesis 21
22 Technological Advances 2. DNA synthesis 22
23 Technological Advances 2. DNA synthesis Services/Applications/Cloning/gene-synthesis/gene-strings-dnafragments.html#7 23
24 Synthetic Biology Risk and safety Reputable companies check requested sequences 24
25 Risk and Safety 25
26 Polio virus 26
27 Technological Advances 2. DNA synthesis 1970 chemical synthesis of one gene 207bp long (took > 1 year) (2002) 7440 bp, 2 years, ~$10/bp (2010) bp Next? 27
28 Technological Advances 2. DNA synthesis
29 Example of use of DNA synthesis Biofuels 29
30 Production of methyl halides (CH 3 I) by microorganisms from biomass -precursors for petroleum 1. BLAST search for methyl halide transferases (MHT), including metagenomic data (eg seawater) 2. Chemical synthesis of each DNA encoding the gene sequences. No need to culture or even identify the organism. No cloning! 3. Express proteins and assay enzyme activity 30
31
32 Learning by building: natural and synthetic gene circuits Study DNA looping energy in vivo
33
34
35
36
37
38
39
40 Learning by building: natural and synthetic gene circuits 300bp spacing
41 Monte Carlo Fitting
42 Learning by building: natural and synthetic gene circuits j Separation (bp)
43 Learning by building: phage lambda 43
44 Learning by building: phage lambda More complex system - 6 operators - 3 promoters - enhancer like element (UP) RNAP 44
45 Learning by building: phage lambda 45
46 Perturb the system mutants 46
47 Learning by building: phage lambda Small improvements to binding - Change in gene expression levels - Mimic eukaryotic enhancer elements Development of new tools for synthetic biology - Incorporation of distant binding sites 47
48 Learning by building: synthetic gene circuits Bistability mutually exclusive states 48
49 Learning by building: synthetic gene circuits Mixed feedback loop - bistability 49
50 Learning by building: synthetic gene circuits Mixed feedback loop - bistability Design Build Refine Test 50
51 Learning by building: synthetic gene circuits Design - Components from phage 51
52 Learning by building: synthetic gene circuits Mixed feedback loop - bistability Stable states where production = degradation 52
53 Learning by building: synthetic gene circuits Design 53
54 Learning by building: synthetic gene circuits Design Hysteresis - Characteristic of bistability 54
55 Learning by building: synthetic gene circuits Design 55
56 Learning by building: synthetic gene circuits Build 56
57 Learning by building: synthetic gene circuits Test Hysteresis x Sharp transitions 57
58 Learning by building: synthetic gene circuits Refine Stochastic simulations - Noise in transcription - Flipping from one state to the other 58
59 Learning by building: synthetic gene circuits Refine 59
60 Learning by building: synthetic gene circuits Refine Redesign system to reduce noise: - plasmid copy number - growth rates But intrinsic noise in biological processes unavoidable! 60
61 Synthetic Biology and Rational Design Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits Funding 61
Design Principles in Synthetic Biology
Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University
More informationA Simple Approach to Study Designs in Complex Biochemical Pathways
Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad
More informationSynthetic Biology of Genetic Circuit
Synthetic Biology of Genetic Circuit 1 Mallar, K. N. and 2 Prasenjit, D. 1 M.Sc. (Agri.), Dept. of Biotechnology, AAU, Jorhat, Assam 2 M.Sc. (Agri.), Dept. of Biotechnology, UAS, Dharwad, Karnataka Correspondence
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationOptimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University
Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi
More informationImperial College London. Synthetic Biology. Engineering Biologically-based Devices and Systems. Professor Richard I Kitney
Imperial College London Synthetic Biology Engineering Biologically-based Devices and Systems Professor Richard I Kitney Developments in Biology The Molecular Biology Revolution 1953-2003 April 25 th 1953
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationSynthetic Biology Module Lecture #1
20.109 Synthetic Biology Module Lecture #1 Ron Weiss Department of Biological Engineering MIT Department of Biological Engineering March 8, 2011 Synthetic biology analogy: bio bots Synthetic biology analogy:
More informationGenetic Engineering for Biofuels Production
Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationSynthetic Biology. IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, Fan-Li Chou. Foreign Agricultural Service
Synthetic Biology IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, 2016 Fan-Li Chou U.S. Department of Agriculture Outline What is synthetic biology? Who cares? Why do we care?
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationBiochemistry 111. Carl Parker x A Braun
Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside
More informationDNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
More informationUnit 7. Genetic Regulation, Development, and Biotechnology. AP Biology
Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationIntroduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationBi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
More informationFuture Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System
Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System June 2016 Synthetic Biology at Modular Genetics The Future of Chemical Manufacturing and
More informationChapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
More informationBiochemistry study of the molecular basis of life
Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationMicrobial Biotechnology agustin krisna wardani
Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with
More informationChapter 18. Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 2007-2008 Control of Prokaryotic (Bacterial) Genes 2007- Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationBi 8 Lecture 10. Ellen Rothenberg 4 February 2016
Bi 8 Lecture 10 Bacterial regulation, II Ellen Rothenberg 4 February 2016 Not all bacterial promoters use the same σ factors, and this provides added regulation capability Most sigma factors are related
More informationDigitally Programmed Cells
Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationControl of Eukaryotic Genes
Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationNCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence
NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding
More informationAP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?
The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationChapter 13 - Regulation of Gene Expression
Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene
More informationSynthetic Biological Systems
Synthetic Biological Systems 2. Synthetic Life and Genome Engineering 27/05/2010 Dr Tom Ellis 1 The construction of synthetic organisms Synthesising biological life will be a 21 st Century Grand Challenge
More informationRoutes to Higher Hydrocarbons BIO, Pacific Rim Summit
Routes to Higher Hydrocarbons BIO, Pacific Rim Summit Thomas D. Foust, Ph.D., P.E. Director, National Advanced Fuels Consortium NREL Bioenergy Center December 9, 2013 NREL is a national laboratory of the
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationLecture Series 10 The Genetics of Viruses and Prokaryotes
Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.
More informationBACTERIAL GENETICS. How does the DNA in the bacterial cell replicate
BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.
More informationOverview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions
Overview Introduction Biological model Physical and Chemical properties of our glue Mathematical modeling Conclusions Introduction Model : Caulobacter crescentus GRAM Motile or sessile cell Sessile stage
More informationSaccharomyces cerevisiae. haploid =
In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used
More informationA synthetic recombinase-based feedback loop results in robust expression Supporting Information
A synthetic recombinase-based feedback loop results in robust expression Supporting Information 1 Fig. S1: Control experiments performed to demonstrate the expected function of our closed-loop feedback
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationTrends in Biotechnology Investment
Trends in Biotechnology Investment National Academies Workshop Future Biotechnology Products and Opportunities to Enhance Capabilities of Biotechnology Regulatory System June 1, 2016 Theresa Good, Deputy
More informationWhat can you remember about enzymes? Mr W
What can you remember about enzymes? Mr W Human Cells (f) Enzymes and Metabolism Learning Intentions Describe metabolism, synthetic (energy requiring) and breakdown (energy releasing) pathways Cell Metabolism
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationRESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS SUMMER
Project Code: MGY 1S RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS 2018 2019 SUMMER Name and Title: Department: Amy A. Caudy, Associate Professor Molecular Genetics TITLE OF RESEARCH PROJECT:
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationBasic Concepts and History of Genetic Engineering. Mitesh Shrestha
Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationUse of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
More informationBCH4415B: Applications of Synthetic Biology and Chemical Genetics in Medicine
1. Course Information BCH4415B: Applications of Synthetic Biology and Chemical Genetics in Medicine Winter Term 2017 This course provides an introduction to the emerging fields of Synthetic Biology and
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationEnergy Biosciences Institute Linking Biotechnology and Energy. March 25, 2010 Paul Willems, TVP Energy Biosciences EBI Associate Director
Energy Biosciences Institute Linking Biotechnology and Energy March 25, 2010 Paul Willems, TVP Energy Biosciences EBI Associate Director EBI Partners This Extraordinary partnership builds upon and extends
More informationSynthetic Biology. Molecular Mechanisms. Concepts. Applications
Synthetic Biology Molecular Mechanisms Concepts Applications 09.05.07 The central dogma - genetic machinery http://old.mb.au.dk/graphics/dogma.jpg Transcription (in E. Coli) DNA RNA Translation RNA Protein
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationPractice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationBiotechnology. Cloning. Transformation 2/4/ glue DNA
Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationUnit 8: Genomics Guided Reading Questions (150 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationMolecular Cell Biology - Problem Drill 06: Genes and Chromosomes
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein
More informationBio5488 Practice Final (2018) 1. Metagenomics (10 pts total)
1. Metagenomics (10 pts total) 1. (2 pts) In 2004 Venter and colleagues reported on shotgun sequencing of environmental metagenomic DNA from the Sargasso Sea. They generated over 1 gigabase of data and
More informationGenetics - Problem Drill 13: The Control of Gene Expression in Prokaryotes
Genetics - Problem Drill 13: The Control of Gene Expression in Prokaryotes No. 1 of 10 1. You have a cell where the lac repressor has a mutation that doesn t bind lactose. The cells are cultured in a low-glucose,
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationCOURSE COMPACT GUIDE
COURSE COMPACT GUIDE Course Course code: BCH 224 Course title & credit unit. Introductory Molecular Biology (3 UNITS) Course status if it s either - (compulsory) Course Duration Three hours per week for
More informationBy two mechanisms: Mutation Genetic Recombination
Genetics (see text pages 257-259, 267-298) Remember what it is we want to address: How is it that prokaryotes gain new genetic ability? The cells are haploid and reproduce by fission...so how does an genetic
More informationMolecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes
Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,
More informationViral Genomes. Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA
Chapter 19 Viral Genomes Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA Genome is usually organized as a single linear or circular molecule
More informationGreen Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography
Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered
More informationTranscription: Synthesis of RNA
Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationBIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off
BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When
More informationName Biol Group Number. ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology
Name Biol 211 - Group Number ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology Chapter 19: The Genetics of Viruses (pp. 381-395, Biology by Campbell/Reece, 8 th
More informationDepartment of Biology and Biotechnology. Student name:, Student No.
Faculty of Science Industrial Biotechnology Date: 2/12/2012 Department of Biology and Biotechnology Midterm Exam Time: 90 minutes Student name:, Student No. Q.1) Give True (T) or false (F) for the following
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationTranslation Mechanisms
Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence
More information