Synthetic Biology and Rational Design Keith Shearwin University of Adelaide

Size: px
Start display at page:

Download "Synthetic Biology and Rational Design Keith Shearwin University of Adelaide"

Transcription

1 Synthetic Biology and Rational Design Keith Shearwin University of Adelaide Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits 1

2 (1) (2) 2

3 (1) Understand natural circuits The complex genetic circuits found in cells are ordinarily studied by analysis of genetic and biochemical perturbations. The inherent modularity of biological components like genes and proteins enables a complementary approach: one can construct and analyse synthetic genetic circuits based on their natural counterparts. Such synthetic circuits can be used as simple in vivo models to explore the relation between the structure and function of a genetic circuit. 3

4 (2) Build useful stuff rational design Examples of applications of synthetic biology 4

5 Malaria ~ one million deaths annually, mostly children Artemisinin: Anti-malarial compound found in plant 5

6 Produce artemisinin in microorganisms 6

7 Produce artemisinin in microorganisms Enzymes from 3 species, plus extensive modification of individual steps Initial attempts yielded ~0.1 g/l 2012: yield ~40g/L. Over express all enzymes, in yeast Some metabolic engineering, some high throughput screening. 7

8 Early Sugar cane litre fermentors ~ tens of tonnes Sell at cost price Profit from other pathway intermediates - Farnesene (long chain hydrocarbon) 8

9 Building new circuits analogy with engineering 9

10 Synthetic Biology: analogy with engineering - modularity - standardisation - mathematical description 10

11 Modularity 11

12 Standardisation - engineering Consistent building blocks 12

13 Standardisation - biology Standard plasmids Interchangeable parts Standard method of assembly (Biobricks website) 13

14 Standardisation - biology 14

15 Standardisation - biology 15

16 Mathematical model Design Build Refine Test Allows the ability to make and test predictions about - Circuit behaviour (toggle switch, repressilator) - Stability - Robustness against perturbations - Effect of biological noise arising from low numbers of molecules (stochastic simulations) 16

17 Synthetic Biology Challenges of Synthetic Biology Technological advances Risk and Safety 17

18 Challenges for Synthetic Biology 18

19 Technological Advances 1. Fluorescent proteins/single cell microscopy Time lapse movies single cells -follow dynamics of multiple components of a given circuit -correlations between outputs 19

20 Technological Advances 1. Fluorescent proteins/single cell microscopy Time lapse movies single cells -follow dynamics of multiple components of a given circuit -correlations between outputs 20

21 Technological Advances 2. DNA synthesis 21

22 Technological Advances 2. DNA synthesis 22

23 Technological Advances 2. DNA synthesis Services/Applications/Cloning/gene-synthesis/gene-strings-dnafragments.html#7 23

24 Synthetic Biology Risk and safety Reputable companies check requested sequences 24

25 Risk and Safety 25

26 Polio virus 26

27 Technological Advances 2. DNA synthesis 1970 chemical synthesis of one gene 207bp long (took > 1 year) (2002) 7440 bp, 2 years, ~$10/bp (2010) bp Next? 27

28 Technological Advances 2. DNA synthesis

29 Example of use of DNA synthesis Biofuels 29

30 Production of methyl halides (CH 3 I) by microorganisms from biomass -precursors for petroleum 1. BLAST search for methyl halide transferases (MHT), including metagenomic data (eg seawater) 2. Chemical synthesis of each DNA encoding the gene sequences. No need to culture or even identify the organism. No cloning! 3. Express proteins and assay enzyme activity 30

31

32 Learning by building: natural and synthetic gene circuits Study DNA looping energy in vivo

33

34

35

36

37

38

39

40 Learning by building: natural and synthetic gene circuits 300bp spacing

41 Monte Carlo Fitting

42 Learning by building: natural and synthetic gene circuits j Separation (bp)

43 Learning by building: phage lambda 43

44 Learning by building: phage lambda More complex system - 6 operators - 3 promoters - enhancer like element (UP) RNAP 44

45 Learning by building: phage lambda 45

46 Perturb the system mutants 46

47 Learning by building: phage lambda Small improvements to binding - Change in gene expression levels - Mimic eukaryotic enhancer elements Development of new tools for synthetic biology - Incorporation of distant binding sites 47

48 Learning by building: synthetic gene circuits Bistability mutually exclusive states 48

49 Learning by building: synthetic gene circuits Mixed feedback loop - bistability 49

50 Learning by building: synthetic gene circuits Mixed feedback loop - bistability Design Build Refine Test 50

51 Learning by building: synthetic gene circuits Design - Components from phage 51

52 Learning by building: synthetic gene circuits Mixed feedback loop - bistability Stable states where production = degradation 52

53 Learning by building: synthetic gene circuits Design 53

54 Learning by building: synthetic gene circuits Design Hysteresis - Characteristic of bistability 54

55 Learning by building: synthetic gene circuits Design 55

56 Learning by building: synthetic gene circuits Build 56

57 Learning by building: synthetic gene circuits Test Hysteresis x Sharp transitions 57

58 Learning by building: synthetic gene circuits Refine Stochastic simulations - Noise in transcription - Flipping from one state to the other 58

59 Learning by building: synthetic gene circuits Refine 59

60 Learning by building: synthetic gene circuits Refine Redesign system to reduce noise: - plasmid copy number - growth rates But intrinsic noise in biological processes unavoidable! 60

61 Synthetic Biology and Rational Design Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits Funding 61

Design Principles in Synthetic Biology

Design Principles in Synthetic Biology Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University

More information

A Simple Approach to Study Designs in Complex Biochemical Pathways

A Simple Approach to Study Designs in Complex Biochemical Pathways Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad

More information

Synthetic Biology of Genetic Circuit

Synthetic Biology of Genetic Circuit Synthetic Biology of Genetic Circuit 1 Mallar, K. N. and 2 Prasenjit, D. 1 M.Sc. (Agri.), Dept. of Biotechnology, AAU, Jorhat, Assam 2 M.Sc. (Agri.), Dept. of Biotechnology, UAS, Dharwad, Karnataka Correspondence

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Optimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University

Optimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi

More information

Imperial College London. Synthetic Biology. Engineering Biologically-based Devices and Systems. Professor Richard I Kitney

Imperial College London. Synthetic Biology. Engineering Biologically-based Devices and Systems. Professor Richard I Kitney Imperial College London Synthetic Biology Engineering Biologically-based Devices and Systems Professor Richard I Kitney Developments in Biology The Molecular Biology Revolution 1953-2003 April 25 th 1953

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Synthetic Biology Module Lecture #1

Synthetic Biology Module Lecture #1 20.109 Synthetic Biology Module Lecture #1 Ron Weiss Department of Biological Engineering MIT Department of Biological Engineering March 8, 2011 Synthetic biology analogy: bio bots Synthetic biology analogy:

More information

Genetic Engineering for Biofuels Production

Genetic Engineering for Biofuels Production Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Synthetic Biology. IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, Fan-Li Chou. Foreign Agricultural Service

Synthetic Biology. IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, Fan-Li Chou. Foreign Agricultural Service Synthetic Biology IICA First Seminar on SynBio for Biotechnology Decision Makers March 16-17, 2016 Fan-Li Chou U.S. Department of Agriculture Outline What is synthetic biology? Who cares? Why do we care?

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Biochemistry 111. Carl Parker x A Braun

Biochemistry 111. Carl Parker x A Braun Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

Bi8 Lecture 19. Review and Practice Questions March 8th 2016

Bi8 Lecture 19. Review and Practice Questions March 8th 2016 Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs

More information

Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System

Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System June 2016 Synthetic Biology at Modular Genetics The Future of Chemical Manufacturing and

More information

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs

Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO

More information

Biochemistry study of the molecular basis of life

Biochemistry study of the molecular basis of life Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Microbial Biotechnology agustin krisna wardani

Microbial Biotechnology agustin krisna wardani Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with

More information

Chapter 18. Regulation of Gene Expression

Chapter 18. Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 2007-2008 Control of Prokaryotic (Bacterial) Genes 2007- Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Bi 8 Lecture 10. Ellen Rothenberg 4 February 2016

Bi 8 Lecture 10. Ellen Rothenberg 4 February 2016 Bi 8 Lecture 10 Bacterial regulation, II Ellen Rothenberg 4 February 2016 Not all bacterial promoters use the same σ factors, and this provides added regulation capability Most sigma factors are related

More information

Digitally Programmed Cells

Digitally Programmed Cells Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Control of Eukaryotic Genes

Control of Eukaryotic Genes Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Chapter 13 - Regulation of Gene Expression

Chapter 13 - Regulation of Gene Expression Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene

More information

Synthetic Biological Systems

Synthetic Biological Systems Synthetic Biological Systems 2. Synthetic Life and Genome Engineering 27/05/2010 Dr Tom Ellis 1 The construction of synthetic organisms Synthesising biological life will be a 21 st Century Grand Challenge

More information

Routes to Higher Hydrocarbons BIO, Pacific Rim Summit

Routes to Higher Hydrocarbons BIO, Pacific Rim Summit Routes to Higher Hydrocarbons BIO, Pacific Rim Summit Thomas D. Foust, Ph.D., P.E. Director, National Advanced Fuels Consortium NREL Bioenergy Center December 9, 2013 NREL is a national laboratory of the

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Lecture Series 10 The Genetics of Viruses and Prokaryotes

Lecture Series 10 The Genetics of Viruses and Prokaryotes Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.

More information

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.

More information

Overview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions

Overview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions Overview Introduction Biological model Physical and Chemical properties of our glue Mathematical modeling Conclusions Introduction Model : Caulobacter crescentus GRAM Motile or sessile cell Sessile stage

More information

Saccharomyces cerevisiae. haploid =

Saccharomyces cerevisiae. haploid = In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used

More information

A synthetic recombinase-based feedback loop results in robust expression Supporting Information

A synthetic recombinase-based feedback loop results in robust expression Supporting Information A synthetic recombinase-based feedback loop results in robust expression Supporting Information 1 Fig. S1: Control experiments performed to demonstrate the expected function of our closed-loop feedback

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Trends in Biotechnology Investment

Trends in Biotechnology Investment Trends in Biotechnology Investment National Academies Workshop Future Biotechnology Products and Opportunities to Enhance Capabilities of Biotechnology Regulatory System June 1, 2016 Theresa Good, Deputy

More information

What can you remember about enzymes? Mr W

What can you remember about enzymes? Mr W What can you remember about enzymes? Mr W Human Cells (f) Enzymes and Metabolism Learning Intentions Describe metabolism, synthetic (energy requiring) and breakdown (energy releasing) pathways Cell Metabolism

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS SUMMER

RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS SUMMER Project Code: MGY 1S RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS 2018 2019 SUMMER Name and Title: Department: Amy A. Caudy, Associate Professor Molecular Genetics TITLE OF RESEARCH PROJECT:

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha

Basic Concepts and History of Genetic Engineering. Mitesh Shrestha Basic Concepts and History of Genetic Engineering Mitesh Shrestha Genetic Engineering AKA gene manipulation, gene cloning, recombinant DNA technology, genetic modification, and the new genetics. A technique

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological

More information

BCH4415B: Applications of Synthetic Biology and Chemical Genetics in Medicine

BCH4415B: Applications of Synthetic Biology and Chemical Genetics in Medicine 1. Course Information BCH4415B: Applications of Synthetic Biology and Chemical Genetics in Medicine Winter Term 2017 This course provides an introduction to the emerging fields of Synthetic Biology and

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Energy Biosciences Institute Linking Biotechnology and Energy. March 25, 2010 Paul Willems, TVP Energy Biosciences EBI Associate Director

Energy Biosciences Institute Linking Biotechnology and Energy. March 25, 2010 Paul Willems, TVP Energy Biosciences EBI Associate Director Energy Biosciences Institute Linking Biotechnology and Energy March 25, 2010 Paul Willems, TVP Energy Biosciences EBI Associate Director EBI Partners This Extraordinary partnership builds upon and extends

More information

Synthetic Biology. Molecular Mechanisms. Concepts. Applications

Synthetic Biology. Molecular Mechanisms. Concepts. Applications Synthetic Biology Molecular Mechanisms Concepts Applications 09.05.07 The central dogma - genetic machinery http://old.mb.au.dk/graphics/dogma.jpg Transcription (in E. Coli) DNA RNA Translation RNA Protein

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Practice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.

Practice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients. Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Biotechnology. Cloning. Transformation 2/4/ glue DNA

Biotechnology. Cloning. Transformation 2/4/ glue DNA Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Unit 8: Genomics Guided Reading Questions (150 pts total)

Unit 8: Genomics Guided Reading Questions (150 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes

Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein

More information

Bio5488 Practice Final (2018) 1. Metagenomics (10 pts total)

Bio5488 Practice Final (2018) 1. Metagenomics (10 pts total) 1. Metagenomics (10 pts total) 1. (2 pts) In 2004 Venter and colleagues reported on shotgun sequencing of environmental metagenomic DNA from the Sargasso Sea. They generated over 1 gigabase of data and

More information

Genetics - Problem Drill 13: The Control of Gene Expression in Prokaryotes

Genetics - Problem Drill 13: The Control of Gene Expression in Prokaryotes Genetics - Problem Drill 13: The Control of Gene Expression in Prokaryotes No. 1 of 10 1. You have a cell where the lac repressor has a mutation that doesn t bind lactose. The cells are cultured in a low-glucose,

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

COURSE COMPACT GUIDE

COURSE COMPACT GUIDE COURSE COMPACT GUIDE Course Course code: BCH 224 Course title & credit unit. Introductory Molecular Biology (3 UNITS) Course status if it s either - (compulsory) Course Duration Three hours per week for

More information

By two mechanisms: Mutation Genetic Recombination

By two mechanisms: Mutation Genetic Recombination Genetics (see text pages 257-259, 267-298) Remember what it is we want to address: How is it that prokaryotes gain new genetic ability? The cells are haploid and reproduce by fission...so how does an genetic

More information

Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes

Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,

More information

Viral Genomes. Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA

Viral Genomes. Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA Chapter 19 Viral Genomes Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA Genome is usually organized as a single linear or circular molecule

More information

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered

More information

Transcription: Synthesis of RNA

Transcription: Synthesis of RNA Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When

More information

Name Biol Group Number. ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology

Name Biol Group Number. ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology Name Biol 211 - Group Number ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology Chapter 19: The Genetics of Viruses (pp. 381-395, Biology by Campbell/Reece, 8 th

More information

Department of Biology and Biotechnology. Student name:, Student No.

Department of Biology and Biotechnology. Student name:, Student No. Faculty of Science Industrial Biotechnology Date: 2/12/2012 Department of Biology and Biotechnology Midterm Exam Time: 90 minutes Student name:, Student No. Q.1) Give True (T) or false (F) for the following

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Translation Mechanisms

Translation Mechanisms Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence

More information