Phylogenetic relationship and organization of organisms within berrybacterial

Transcription

1 Phylogenetic relationship and organization of organisms within berrybacterial consortia Jarrod Jude Scott Microbial Diversity Course 2007 Summary The goal of this project was to determine the organismal composition and spatial organization of bacteria within pink and purple berries from Sippewissett salt marsh in Cape Cod, MA. Using phylogenetic and CARD- FISH analysis our results indicate that there is no observable difference between these two types of berries. Further, we found the majority of clones obtained from library construction fall within three broad groups of eubacteria; α-proteobacteria, γ- proteobacteria, and the Cytophaga- Flavobacterium-Bacteroides group (CFB). Using CARD-FISH we were also able to show that different groups within the berry matrix exhibited noticeable spatial arrangement.

2 Methods and Results Sample Collection: Samples were collected at two times during the summer of Samples used in clone library construction were collected from Sippewissett salt mash on 17 July. Samples used in fish analysis were collected on 10 July from the same location. Clone library construction: A. DNA extraction DNA from stored (-20 C) samples was extracted using an UltraClean soil DNA kit (MO BIO # ). Protocol was followed exactly except for the time of beadbeating. We decided to test the efficacy of different beadbeating times on extracted DNA quality. For each of the pink and purple samples, samples were homogenized for 30s, 60s and 120s. Based on the results of gel electrophoresis and NanoDrop Spectrophotometer quantification, the 30s treatment was chosen for further analysis (see table 1 and figure 1). B. PCR analysis PCR was performed using the general eubacterial primers 8F/1492R and general archaeal primers 4F/1392R with the following reaction conditions: initial denaturation of 95 C for 5:00, then 29 cycles of 95 C for 0:30, 46 C for 0:30, 72 C for 1:30, and Figure 1: Gel of extracted DNA on both pink and purple samples using different beadbeating times. a final extension of 72 C for 5:00. Lanes A = 1:1 DNA template; B = 1:10; C = negative control, D = positive control; E = poison control (Note that at the time there was no positive control for the archaeal primer sets). Amplification of the eubacterial primers was successful for both dilutions used. The archaeal primers however failed to produce strong product (a faint band can be seen in pink lane A)(figure 2). Based on the initial gel a temperature gradient PCR was run on the 30s and 120s samples using general archaeal primers 4F/1392R and 21F/958R. The same conditions were used as above except the annealing temperature was changed to a gradient from 46 C to 62 C. 21F/958R failed to amplify at any temperature but 4F/1392R produced product at all temperatures tested (figure 3).

3 quantity 260/ /230 (ng/µl) pink-30s pink-60s pink-120s purple-30s purple-60s purple-120s Table 1: Spectrophotometer results of three different beadbeating treatments on each type of berry. Figure 3: Temperature gradient PCR of the general archaeal primers 21F/958R & 4F/1392R. Figure 2: Initial PCR of 30s extraction using 8F/1492 and 4F/1392R. C. Clone library construction Based on the abovementioned results clone libraries were constructed using 8F/1492R and 4F/1392R on both pink and purple berries using the TOPO TA

4 cloning kit. The suggested protocol was followed exactly. Positive clones were sequenced and aligned in the ARB software package. The 4F/1392R clone libraries yielded no archaeal sequences but rather amplified several different species of eukaryotes. At this point it was decided to abandon attempts at identifying archaeal species from the berries. The results from eubacterial clone libraries are shown below in figures 4-6. The clone libraries indicate that the berries contain representatives from the gamma II subdivision of proteobacteria (figure 4), delta-proteobacteria (figure 5), and the Cytophaga- Flavobacterium-Bacteroides group (CFB) (figure 6). Black boxes within each tree represent clades containing very similar clones. The numbers in parentheses indicate the number of clones in each group. The data did not indicate that the pink and purple berries are comprised of different communities. Figure 4: Maximum parsimony tree showing the phylogenetic relationship of clones that fell into the gamma II subdivision of proteobacteria.

5 Figure 5: Tree showing clones from the delta subdivision of proteobacteria. Almost all clones fell within two distinct clades.

6 Figure 6: MP tree of the clones that were in the CFB group of bacteria. The majority of clones were within one of three clades identified by solid black boxes.

7 FISH analysis A. Berry Fixation and cutting Sample berries were fixed in 1% by volume formaldehyde solution in 1XPBS. Berries were then washed 3X in 1XPBS. Samples were put into 1mL of OCT (Optical Cutting Solution, Tissue-Tek, Sakura ), and stored at 4 C until cutting. Sections were obtained by first freezing the OCT embedded berries at -20 C for ~4hrs. Thin (~10µm) sections were cut using a cryotome. In order to process the cut samples slides were prepped by dipping into a solution of 0.1% gelatin and 0.01% Cr(III)KSO 4 solution and allowing them to dry. For each probe listed below (table 2) we used two ~10µm cross-sections attached to an individual slide. Therefore a total of 20 cross-sections on 10 slides were processed through the FISH protocol; 1 slide/probe and 5 slides/berry. Slides were then washed for 1 minute in increasingly concentrated solutions of EtOH to remove residual OCT compound. Samples were allowed to dry and then stored at -20 C until further processing. B. CARD-FISH: Because of auto-fluorescent signals present in the berries we decided to use CARD-FISH. This technique provides a much stronger signal than standard mono-labeled FISH. The protocol provided in the lab manual was followed with notable exceptions listed below. 1) Samples were not embedded in agrose 2) After the inactivation of endogenous peroxidases each cross-section was circled with a special pen. This prevents liquid from spilling off of the sample during later steps. 3) For permeabilization treatment, 200µL of the lysozyme solution was placed directly on the sections and then the whole slide was placed into a 50mL flacon tube containing moist paper. 4) In the hybridization step we used a 1:100 rather than 1:300 solution of probe and hybridization buffer. 5) We inadvertently omitted 10% SDS from the washing buffer but this did not seem to have any ill affect.

8 Based on the results from the 16S rrna trees we chose the probes listed in table 2 for our analysis. Unfortunately we did not have delta-proteobacterial probes at the time of this investigation. Probe Sequence (5 3 ) Label FA in HB[%] Target NON 35 nothing Arch915 GTGCTCCCCCGCCAATTCCT HRP FITC 35 archaea CF319a TGGTCCGTGTCTCAGTAC HRP FITC 35 CFB Gam42a GCCTTCCCACATCGTT HRP FITC 35 γ-proteo EubI-III GCWGCCWCCCGTAGGWGT HRP FITC 35 eubacteria Alf986 GGTAAGGTTCTGCGCGTT HRP FITC 35 α-proteo Table 2: Probes used in CARD-FISH analysis Discussion The goal of this project was three-fold: 1) to determine the broad community composition of the pink and purple berries of Sippewissett Salt Marsh; 2) Ascertain whether there is organismal organization within the berries and; 3) qualify the differences, if any, between the pink and purple berries. Phylogenetic analysis of cloned sequences revealed that there are three main groups within the berries. Our work indicates that organisms related to Halochromatium (γ-proteobacteria), Desulfobacterium (δ-proteobacteria), and Flavobacterium/Cytophaga (CFB) are the main organisms within the berries. Only clones that grouped within the gamma subdivision had close relatives in the ARB database. The majority of representative from both the delta-proteobacteria and the CFB were considerably different from any close relative. CARD-FISH analysis proved very successful. Figure 7 shows the results of this analysis from the EUBI-III, Alf986, Gam42a and CF319a on the pink berry samples. On the left is the DAPI stain only and on the right the FITC labeled image. Image D reveals the presence of α-proteobacteria throughout the matrix however they appear to be in relatively low abundance when compared with the general eubacterial probe from image B. Image F indicates that γ-proteobacteria comprise the vast majority of organisms within the matrix. Perhaps the most interesting result is shown in image H. This image shows the presence of representative from the CFB-group but more importantly indicates distinct spatial patterns of distribution. These organisms seem to be located along the periphery of the berry structures.

9 Figure 2: DAPI stained cross-sections on the left and FITC labeled cells on the right. B = EUBI-III; D = Alf986; F= Gam42a; H=CF319a. (Note: The DAPI stain in panel A was much brighter than is shown here)

10 Our results indicate that there are no noticeable differences between the pink and purple berries, either phylogentically or organizationally. Though only CARD- FISH images were shown for pink berries, the patterns were similar in the purple berries. In the future it would be nice to design more specific probes in order to better understand spatial organization at a finer scale. Acknowledements: I am honored that I was admitted to the Microbial Diversity course and very delighted that I accepted the offer. I would like to thank the directors, faculty, staff, classmates and the MBL for a wonderful learning experience. I would also like to thank Kristen DeAngelis and Tracy Teal for help with molecular work. Most importantly I would like to acknowledge Dagmar Woebken for her extremely high levels of patience and enthusiasm. This work would have been impossible without the input and support of all parties