VCGDB: A Virtual and Dynamic Genome Database of the Chinese Population
|
|
- Ashley Sims
- 6 years ago
- Views:
Transcription
1 VCGDB: A Virtual and Dynamic Genome Database of the Chinese Population Jiayan Wu Associate Professor Director of Science and Technology Department Director of Core Facility Beijing Institute of Genomics, Chinese Academy of Sciences
2 Outline Background Data source Analyze workflow Result interpretation Database construction Genome visualization tool Summary Perspective
3 Size Background (Big data) 4 V definition of Big data: Volume,Variety,Veracity,Velocity. Meyer M A, Laney D. Gartner, 2012,1. Knowledge Information Data Information Data Knowledge Computer Science/Domain Science Domain Science/Computer Science Year
4 Background (references) Current reference genome: linear, static sequence from limited samples. NCBI Human Genome UCSC Human Genome Feb (hg19) Mar (hg18) May (hg17) Jul (hg16) Apr (hg15) Reference Year Platform Method Caucasian individual(ceu) 2007 ABI 3730XL De novo assembly Yoruba individual(yri) 2008 Illumina GA1s MAQ mapping Chinese individual(yh) 2008 Illumina GA SOAP mapping+assembly Korean individual(ak1) 2009 Illumina GA GMAP mapping Irish individual 2010 Illumina GAII SNP calling
5 Background (projects) Human Genome Draft 2001 The human genome holds an extraordinary trove of information about human development, physiology, medicine and evolution. International Human Genome Mapping Consortium. Nature, 2001, 409(6822): Genomes Project 2008 The first project to sequence the genomes of a large number of people, to provide a comprehensive resource on human genetic variation Genomes Project Consortium. Nature, 2010, 467(7319):
6 Data source Code Population Record Sample Read Count Base Count CHB Chinese Han in Beijing ,855,116, E+12 CHS Chinese Han South ,619,855, E+12 Total ,474,972, E+12 CHN: CHB: CHS: Dynamic genome: Chinese population North Chinese sub-population South Chinese sub-population Data Capacity (After Compression) CHS RAW CHB RAW CHS BAM CHB BAM complex, dynamic, widely related personal human genomes contain 1.3 TB 2.0 TB 2.0 TB 2.8 TB genome variations, insertions/deletions, structure variations, etc. to reveal Concentrate potential population on big differentiation. data: Quantity, Handling, Usage
7 Data analyze workflow Data preprocessing Data size reduction Sample level analysis Population level analysis Genomic annotation Result interpretation
8 Data size reduction 194 pileup files, 70+GB/file, 15TB in total Chrom Position Ref Sample 1 Sample 3 Sample 4 Sample 5 Sample 6 Chr A AAAA AAAAA AAAAAA Chr A AAAA AAAAT AA AAAAAA Chr G GGGG GGGGGG GGGGG GGGGG GGGGGG Chr C CCCC CC Chr A AAAT AAAAAG TTTAAA TTTTTA Chr G GG GGGG GGGGGT GGG Chr G CCC CCC CCCCCC C Chr G GGG TTT GGGGT G ChrX A AAAAAA AAAAAA AAAAAA AAAAAA AAAAAA
9 Candidate dynamic information Candidate dynamic information of 55,549,120 CDPs. Data volume reduced by 98% without losing any detail information CDP Average(max-min) Coverage Status CHS_RANGE CHB_RANGE CHS_AVG CHB_AVG
10 Data analyze workflow Data preprocessing Data size reduction Sample level analysis Population level analysis Genomic annotation Result interpretation
11 Genetic variation analysis Single high-coverage sample: AAAAAAATTAAAAAAAAGAACAAAATTTTTAAAAAAAAAATTTTCAA Multiple low-coverage samples: AAAAT AAAT AAT TTT AAAAG AAAAC AAAC AAAAG AAAAC AAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTGGCCC Sample level: Population level: AAAAT AAAT AAT TTT AAAAG AAAAC AAAC AAAAG A A A T A A A A AAAAAAT
12 Dynamic position types Major allele against GRCh37 reference genome. High probability ( 50%) indel position. MAIR Minor allele (>5%) against GRCh37 reference genome. Rare variation ( 5%) against GRCh37 reference genome.
13 Dynamic information statistics
14 Genomic annotation(annovar) Enrichment analysis of MAIR in GWAS trait locations in the Chinese and GRCh37 genomes Top Matches CHN CHS CHB 1 Height (110/324) Height (108/324) Height (110/324) 2 Multiple sclerosis (41/187) Multiple sclerosis (41/187) Multiple sclerosis (41/187) 3 Crohn's disease (36/181) Crohn's disease (40/181) Crohn's disease (38/181) 4 Body mass index (34/109) Body mass index (34/109) Coronary heart disease (37/151) 5 Coronary heart disease (34/151) Coronary heart disease (33/151) Body mass index (36/109) 6 Type 2 diabetes (33/164) Type 2 diabetes (32/164) Bipolar disorder (32/109) 7 Rheumatoid arthritis (31/170) LDL cholesterol (32/114) Type 2 diabetes (31/164) 8 LDL cholesterol (31/114) HDL cholesterol (31/118) Rheumatoid arthritis (30/170) 9 Bipolar disorder (30/109) Type 1 diabetes (29/107) Bone mineral density (30/87) 10 Bone mineral density (30/87) Bone mineral density (29/87) LDL cholesterol (30/114)
15 Chinese population comparison
16 Consensus Chinese genomes Use anti-conflict algorithm to generate the consensus reference genome. Population-specific against ref positions HG19 reference Analyze conflicts CHS reference CHB reference Major indels CHN reference Mapping of 15 Asian genomes onto the VCG, YH and GRCh37 reference genomes.
17 Database Construction Database: MySQL Engine: MyISAM Tables: 128 Data size: 50GB Index size: 4.9GB Records: 183,919,098 Database Optimizing Data level optimizing Separate data by chromosome BTree indexes support <>= query Reasonable split sequences ---- ref table MySQL level optimizing
18 Database Capacity Dynamic Pos CHN Dynamic Pos CHS Dynamic Pos CHB Autosome 33,780,152 19,591,609 24,109,529 Heterosome 1,747, ,088 1,222,844 Chondriosome 1, Total 35,528,298 20,529,370 25,333,027 Indel CHN Indel CHS Indel CHB Autosome 392, , ,647 Heterosome 14,360 17,323 12,346 Chondriosome Total 406, , ,052 Rare Variant CHN Rare Variant CHS Rare Variant CHB Autosome 27,258,690 12,505,097 17,688,051 Heterosome 1,477, , ,627 Chondriosome VCGDB contains 35 millions of single nucleotide variations, 0.5 millions of indels and 29 millions of rare variations, associate with position based genomic annotation information and consensus reference genomes of defined populations in China, instead of the former static linear sequence. Total 28,737,418 13,137,919 18,628,214
19 Search Page Browser Page
20 Web search page features 1. Fuzzy search 2. Dynamic level sorting All columns containing dynamic level of the positions can be sorted by clicking the title. 3. VCGBrowser linkage Help users to locate the region they want to browse easily. Web searching is implemented with HGNC that realize fuzzy searching of genes.
21 VCGBrowser development Features: Searching optimization Cross platform Large region browse Genome comparison Seemless zooming Drag zooming Real-time searching
22 Cross platform Usage Users have three ways to use VCGBrowser. It is both a web-based applet and a client-based cross platform application, which can be used either in an internet browser or downloaded as a local software. Also users can use our java web start jnlp to run a local application online. Local Application Web Applet Java Web Start JNLP
23 Feature: seamless zooming VCGBrowser has a zoom bar on the left that support a smooth real-time seamless zooming to any resolution from the genomic level that shows the dynamic distribution of interested region, to the nucleotide level that all residues and detail information can be recognized clearly.
24 Feature: drag zooming Drag Zooming: Drag the mouse on any region you are interested in, and the browser would instantly zoom to the region you select.
25 Large region browse and comparison VCGBrowser: Up to chromosome level browsing. Down to nucleoside level comparison.
26 Feature: real-time querying Reference area GRCh37 ref refgene duplication gwas CHN area CHN dynamic bar CHN ref CHN indel CHN rare variant CHS area CHS dynamic bar CHS ref CHS indel CHS rare variant CHB area CHB dynamic bar CHB ref CHB indel CHB rare variant
27 Summary VCGDB is a virtual database VCGDB is virtual because the reference genome provided in the database is the statistical result of terabases of sequencing data from hundreds of Chinese individuals that describe the genetic variation features specific to the Chinese population. chr pos nuc support A * T * G * AA * G *190 X T *93
28 Summary VCGDB is a dynamic database VCGDB is dynamic because we use methods as comentropy to analyze and evaluate the dynamic variation rate and probability of all genetic variation information in several levels like sample or population and integrate them with individual characters and genomic annotation information. T C A A C G T T A C G Gene: PALB2 GWAS: Biopolar disorder
29 Summary VCGDB is a big data solution VCGDB offers a feasible strategy for processing big data to keep pace with the growing volume of biological data and provides a robust resource based on the massive amounts of genomics data for genomics studies and investigations into genetic diseases. VCGBrowser is a flexible genome visualization tool VCGDB also provides a highly interactive user-friendly virtual Chinese genome browser (VCGBrowser) with functions like fuzzy searching, seamless zooming and real-time searching. Users can use mature databases and analysis tools process their researches.
30 Perspectives Bigger data and higher coverage Sequencing projects such as Precision Medicine Initiative, UK10K, The Cancer Genome Atlas (TCGA), and decode Genetics in Iceland are and/or will generate ultra-large volumes of human genome data with higher coverage. How about Chinese population? More accurate algorithm and cloud based platform Genome alignment software support dynamic genome Data analyze platform based on cloud or supercomputing
31 Acknowledgement Thanks for Dr. Yunchao Ling & Dr. Jingfa Xiao
32 Thank you!
VCGDB: a dynamic genome database of the Chinese population
Ling et al. BMC Genomics 2014, 15:265 DATABASE Open Access VCGDB: a dynamic genome database of the Chinese population Yunchao Ling 1,2, Zhong Jin 3, Mingming Su 1,2, Jun Zhong 1,2, Yongbing Zhao 1,2, Jun
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationTHE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE
: GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS
More informationWhole Genome Sequencing. Biostatistics 666
Whole Genome Sequencing Biostatistics 666 Genomewide Association Studies Survey 500,000 SNPs in a large sample An effective way to skim the genome and find common variants associated with a trait of interest
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationPersonal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationPrioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
More informationDNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing
TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence
More informationC3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationMAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
More informationSNPTracker: A swift tool for comprehensive tracking and unifying dbsnp rsids and genomic coordinates of massive sequence variants
G3: Genes Genomes Genetics Early Online, published on November 19, 2015 as doi:10.1534/g3.115.021832 SNPTracker: A swift tool for comprehensive tracking and unifying dbsnp rsids and genomic coordinates
More informationISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction
INTERNATIONAL ORGANISATION FOR STANDARDISATION ORGANISATION INTERNATIONALE DE NORMALISATION ISO/IEC JTC 1/SC 29/WG 11 CODING OF MOVING PICTURES AND AUDIO ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June
More informationAxiom Biobank Genotyping Solution
TCCGGCAACTGTA AGTTACATCCAG G T ATCGGCATACCA C AGTTAATACCAG A Axiom Biobank Genotyping Solution The power of discovery is in the design GWAS has evolved why and how? More than 2,000 genetic loci have been
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationTraining materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationNovel Variant Discovery Tutorial
Novel Variant Discovery Tutorial Release 8.4.0 Golden Helix, Inc. August 12, 2015 Contents Requirements 2 Download Annotation Data Sources...................................... 2 1. Overview...................................................
More informationChallenges in precision medicine: From sequencing to big data processing Mikel Hernaez
Challenges in precision medicine: From sequencing to big data processing Mikel Hernaez Torino, July 19th 2017 Tonight I m launching a new Precision Medicine Initiative to bring us closer to curing diseases
More informationIntroducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager
Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationBriefly, this exercise can be summarised by the follow flowchart:
Workshop exercise Data integration and analysis In this exercise, we would like to work out which GWAS (genome-wide association study) SNP associated with schizophrenia is most likely to be functional.
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationStructural(varia+on!
Structural(varia+on! Programming)for)Biology)! CSH,!October!2012!!!! Tomas!Marques7Bonet! ICREA!Research!Professor! InsAtut!de!Biologia!EvoluAva! Nucleotide Forms!of!geneAc!variaAon.!! Single)base8pair)changes)
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationGenome 373: Mapping Short Sequence Reads II. Doug Fowler
Genome 373: Mapping Short Sequence Reads II Doug Fowler The final Will be in this room on June 6 th at 8:30a Will be focused on the second half of the course, but will include material from the first half
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationGlobal Screening Array (GSA)
Technical overview - Infinium Global Screening Array (GSA) with optional Multi-disease drop in (MD) The Infinium Global Screening Array (GSA) combines a highly optimized, universal genome-wide backbone,
More informationUSER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationLinking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5
More informationUsage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager
Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications
More informationSeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationWhole genome sequencing in the UK Biobank
Whole genome sequencing in the UK Biobank Part of the UK Government s Industrial Strategy Challenge Fund (ISCF) for the Data to Early Diagnosis and Precision Medicine initiative Aim to produce deep characterisation
More informationBionano Access v1.2 Release Notes
Bionano Access v1.2 Release Notes Document Number: 30220 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics, Inc. All Rights Reserved. Table
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationInvestigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationLees J.A., Vehkala M. et al., 2016 In Review
Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial
More informationGenome variation - part 1
Genome variation - part 1 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 21 th January 2016 Aims of the session Introduce major
More informationFrom genome-wide association studies to disease relationships. Liqing Zhang Department of Computer Science Virginia Tech
From genome-wide association studies to disease relationships Liqing Zhang Department of Computer Science Virginia Tech Types of variation in the human genome ( polymorphisms SNPs (single nucleotide Insertions
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationAccelerate precision medicine with Microsoft Genomics
Accelerate precision medicine with Microsoft Genomics Copyright 2018 Microsoft, Inc. All rights reserved. This content is for informational purposes only. Microsoft makes no warranties, express or implied,
More informationChromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Supplementary Material
Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions Joshua N. Burton 1, Andrew Adey 1, Rupali P. Patwardhan 1, Ruolan Qiu 1, Jacob O. Kitzman 1, Jay Shendure 1 1 Department
More informationDe Novo Repeats Construction: Methods and Applications
University of Connecticut DigitalCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 5-5-2017 De Novo Repeats Construction: Methods and Applications Chong Chu chong.chu@engr.uconn.edu
More informationNature Genetics: doi: /ng.3143
Supplementary Figure 1 Quantile-quantile plot of the association P values obtained in the discovery sample collection. The two clear outlying SNPs indicated for follow-up assessment are rs6841458 and rs7765379.
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationThe Human Genome and its upcoming Dynamics
The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001
More informationNormal-Tumor Comparison using Next-Generation Sequencing Data
Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per
More informationSupplementary Figures
Supplementary Figures A B Supplementary Figure 1. Examples of discrepancies in predicted and validated breakpoint coordinates. A) Most frequently, predicted breakpoints were shifted relative to those derived
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationGenomics. Data Analysis & Visualization. Camilo Valdes
Genomics Data Analysis & Visualization Camilo Valdes cvaldes3@miami.edu https://github.com/camilo-v Center for Computational Science, University of Miami ccs.miami.edu Today Sequencing Technologies Background
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!
More informationResources at HapMap.Org
Resources at HapMap.Org HapMap Phase II Dataset Release #21a, January 2007 (NCBI build 35) 3.8 M genotyped SNPs => 1 SNP/700 bp # polymorphic SNPs/kb in consensus dataset International HapMap Consortium
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationShannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits
Shannon pipeline plug-in: For human mrna splicing mutations CLC bio Genomics Workbench plug-in CLC bio Genomics Server plug-in Features and Benefits Cytognomix introduces a line of Shannon pipeline plug-ins
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationQuantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
More informationIntroduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationBionano Access 1.0 Software User Guide
Bionano Access 1.0 Software User Guide Document Number: 30142 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved.
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationNext Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs
Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease
More informationDe novo human genome assemblies reveal spectrum of alternative haplotypes in diverse
SUPPLEMENTARY INFORMATION De novo human genome assemblies reveal spectrum of alternative haplotypes in diverse populations Wong et al. The Supplementary Information contains 4 Supplementary Figures, 3
More informationGalaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive
More informationVariant Analysis. CB2-201 Computational Biology and Bioinformatics! February 27, Emidio Capriotti!
Variant Analysis CB2-201 Computational Biology and Bioinformatics February 27, 2015 Emidio Capriotti http://biofold.org/emidio Division of Informatics Department of Pathology Variant Call Format The final
More informationSCIENCE CHINA Life Sciences. High-performance single-chip exon capture allows accurate whole exome sequencing using the Illumina Genome Analyzer
SCIENCE CHINA Life Sciences RESEARCH PAPERS October 2011 Vol.54 No.10: 945 952 doi: 10.1007/s11427-011-4232-4 High-performance single-chip exon capture allows accurate whole exome sequencing using the
More informationGenetic Analysis of Vaccine Adverse Effects
Genetic Analysis of Vaccine Adverse Effects Jason H. Moore, Ph.D. Frank Lane Research Scholar in Computational Genetics Professor of Genetics and Community and Family Medicine Dartmouth Medical School,
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationAnalysis of large deletions in human-chimp genomic alignments. Erika Kvikstad BioInformatics I December 14, 2004
Analysis of large deletions in human-chimp genomic alignments Erika Kvikstad BioInformatics I December 14, 2004 Outline Mutations, mutations, mutations Project overview Strategy: finding, classifying indels
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationComparing a few SNP calling algorithms using low-coverage sequencing data
Yu and Sun BMC Bioinformatics 2013, 14:274 RESEARCH ARTICLE Open Access Comparing a few SNP calling algorithms using low-coverage sequencing data Xiaoqing Yu 1 and Shuying Sun 1,2* Abstract Background:
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationOffice Hours. We will try to find a time
Office Hours We will try to find a time If you haven t done so yet, please mark times when you are available at: https://tinyurl.com/666-office-hours Thanks! Hardy Weinberg Equilibrium Biostatistics 666
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationComparative genomics exploration tools
University of New Hampshire University of New Hampshire Scholars' Repository Master's Theses and Capstones Student Scholarship Winter 2009 Comparative genomics exploration tools Shilpa M. Kulkarni University
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More information