Sanger vs Next-Gen Sequencing
|
|
|
- Samson Carpenter
- 6 years ago
- Views:
Transcription
1 Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics and Systems Biology Core University of Nebraska Medical Center Fall, 2017 GCBA/MGCB/BMI 815 Sanger vs Next-Gen Sequencing Source: st=
2 Next-Gen Sequencing No in vivo cloning Source: Cost of Human Genome Sequencing Source: 2
3 Next-Gen Sequencing Workflow Source: Lu and Shen, 2016, Biochemistry, Genetics and Molecular Biology. DOI: /61657 Applications of NGS Genome Whole genome sequencing Whole exome sequencing Targeted gene panels (cancer, newborns, autism, etc.) Transcriptome Whole RNA sequencing mrna transcriptome (poly-a selection) Small RNA analysis (sirna, snorna, lincrna, etc.) Gene expression profiling for selected target genes Metagenome Bulk sequencing of many types of bacteria Examples: human gut microbiome, soil samples, food contamination, extremophiles, etc. Epigenome Chromatin Immunoprecipitation Sequencing (ChIP-Seq) Methylation Sequencing (Methyl-Seq) 3
4 Different Sequencing Libraries Source: Paired-end Sequencing Source: 4
5 FASTQ Files from Paired-end Sequencing Source: Demultiplexing Mixed Samples Source: 5
6 Different File Types in NGS analysis Fastq file generated by the sequencer, contains NGS reads SAM file Sequence Alignment/Map (generated by aligning the NGS reads with the reference genome) BAM file Binary version of the SAM file (SAMtools are used to manipulate SAM/BAM files) GFF file General Feature Format used to hold genome annotation (chromosome, strand, frame, exon, CDS, etc.) GTF file Gene Transfer Format (Also contains all the info as in GFF and in addition contains gene annotation information) VCF file Variant Call Format (used to store variant data such as SNPs, InDels, short structural rearrangements) Fall, 2017 GCBA/MGCB/BMI 815 GAGGCTATAGCATGGTCAAGGCACAAGAAGATCACTGGACTGCCCTCGCTCAGCCCTCAGCTACTG + >>?>?@>?>@@>?@@=@@@@@??>??@??@?@A?>@@@?>@@???A@:@A@@A@@@A@@AAB@@BB Row 1: Information from the sequencer about the location of this read on the plate Row 2: The Sequence Row 3: Metadata provided by the sequencing team Row 4: Quality scores pertaining to each nucleotide in the sequence 6
7 FASTQ format: FASTQ is based on the popular FASTA format for sequences FASTA format >sequence_id; header in one line AGTTGTAGTCCGTGATAGTCGGATCGG FASTQ format provides additional information that includes the quality TTGTATTTTTAGTAGAGACGGAGTTTCGCCATGTTGGTCAGGCTGGCCTCGAATTCCTGACCTCAAGTGATCCGCCCGCCTCGGCCTCCCAACGTTTTGG ASCII code for Quality score (Phred score, ranges from 0-50) ASCII code for Quality score (in the increasing order;! is the worst and ~ is the best Fall, 2017 GCBA/MGCB/BMI 815 Sequence Alignment / Map (SAM / BAM) SRR chr M = BD:Z:NOJKPQQQQMONOMKKKLNOMNLLLJLMINLJLMLMLKKKKJLJJJMKCKLINJMMLJKKKMOOMNNOLPQSNMK K PG:Z:MarkDuplicates RG:Z:NA12878 BI:Z:OOMLRRPPRPPQQONOLOPOONOOOKLNMONJKMNONMMMMLMKKKMLGMNLNMMNNJMJLNOMLNMPNONONNM M NM:i:0 MQ:i:60 AS:i:76 XS:i:0 Similar to the Fastq file in that it contains the raw sequence and its quality scores. It also tells you where the sequence aligned to the genome, and how well (this scre is also phred-scaled). In this case, this read aligned to chromosome 22, position , and has a quality score of 60 (or a 1 in 1,000,000 chance of being placed incorrectly). 7
8 Variant Call Format (VCF) RNA-Seq Data Analysis 8
9 Computational Analysis of RNA-Seq Data Source: Conesa et al., Genome Biology, 2016, 17:13 RNA-Seq Data Analysis Workflow Illumina, Ion Torrent, PacBio FastQC, FQTrim STAR, HISAT, TopHat, Sailfish, Salmon Cufflinks, EdgeR, DESeq CuffDiff, DESeq, DegeR, Limma GSEA, IPA, DAVID, GO, etc. 9
10 Input Files for RNA-seq Analysis Download Test Data file from the Course Page and unzip the folder Galaxy Server A large compilation of open-source NGS data analysis tools that are accessible to users on web-based platforms Data can be uploaded from a PC/Mac and computing can be done on the cloud No need to install tools and maintain servers locally In-depth tutorials are available to use Galaxy services A list of Public Galaxy Servers can be found at Today s RNA-seq analysis will be performed from the following link 10
11 Phred Score (Q) explained Phred&score&(Q)&vs&Error&probability&(P)& Q = 10 log10 P & Base Sequence Quality Interpretation Bad Quality Excellent Quality Quality drops at the tail end Bad Quality 11
12 Read Mapping and Assembly Source: Downstream Analysis of RNA-seq Results Hierarchical Clustering IPA: Ingenuity Pathway Analysis GSEA- Gene Set Enrichment Analysis Source: Yoo et al., Nature Genetics, 2014 Source: Li et al, Scientific Reports, 2015 Source: Graner et al, Front. Oncology, 2015 Source: Bee et al., PLoS ONE,
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
Analytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
Next Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
Differential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, March 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 1: Introduction into high-throughput
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina
Quantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.
Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche
Introduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
DATA FORMATS AND QUALITY CONTROL
HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)
RNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
Gene Expression analysis with RNA-Seq data
Gene Expression analysis with RNA-Seq data C3BI Hands-on NGS course November 24th 2016 Frédéric Lemoine Plan 1. 2. Quality Control 3. Read Mapping 4. Gene Expression Analysis 5. Splicing/Transcript Analysis
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
Long and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
NEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Bioinformatics Analyst September 2014 Workshop Overview of Today s Activities Morning RNA-Seq Concepts, Terminology, and Work Flows Two-Condition Differential
RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018
RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
Course Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
Wheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
Introduction to bioinformatics (NGS data analysis)
Introduction to bioinformatics (NGS data analysis) Alexander Jueterbock 2015-06-02 1 / 45 Got your sequencing data - now, what to do with it? File size: several Gb Number of lines: >1,000,000 @M02443:17:000000000-ABPBW:1:1101:12675:1533
RNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
Illumina Sequencing Error Profiles and Quality Control
Illumina Sequencing Error Profiles and Quality Control RNA-seq Workflow Biological samples/library preparation Sequence reads FASTQC Adapter Trimming (Optional) Splice-aware mapping to genome Counting
Applications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
NGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
Differential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 3 QC of aligned reads
Sequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
Introduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
Transcriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010
Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong
RNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
UAB DNA-Seq Analysis Workshop. John Osborne Research Associate Centers for Clinical and Translational Science
+ UAB DNA-Seq Analysis Workshop John Osborne Research Associate Centers for Clinical and Translational Science ozborn@uab.,edu + Thanks in advance You are the Guinea pigs for this workshop! At this point
G E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
Introduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
Lecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
VM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE
VM origin Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE NGS intro + Genome-Based Transcript Reconstruction and Analysis Using RNA-Seq Data Based on material
RNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
RNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford
RNAseq Applications in Genome Studies Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Protocols Next generation sequencing protocol cdna, not RNA sequencing
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
NGS Data Analysis and Galaxy
NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
RNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
SCALABLE, REPRODUCIBLE RNA-Seq
SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq Advances in the RNA sequencing workflow, from sample preparation through data analysis, are enabling deeper and more accurate exploration
Reference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
Introduction to human genomics and genome informatics
Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer
Reference genomes and common file formats
Reference genomes and common file formats Dóra Bihary MRC Cancer Unit, University of Cambridge CRUK Functional Genomics Workshop September 2017 Overview Reference genomes and GRC Fasta and FastQ (unaligned
Introduction to RNA-Sequencing Analysis for Differential Expression on Galaxy
Introduction to RNA-Sequencing Analysis for Differential Expression on Galaxy Part 2: DNA/RNA Sequencing Course, Westmead Authors: Tracy Chew, Nicholas Ho, Rosemarie Sadsad Sydney Informatics Hub https://informatics.sydney.edu.au
Francisco García Quality Control for NGS Raw Data
Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical
Differential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 4 overview (brief) theoretical
Eucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
QIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
High performance sequencing and gene expression quantification
High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
Introduc)on to Bioinforma)cs of next- genera)on sequencing. Sequence acquisi)on and processing; genome mapping and alignment manipula)on
Introduc)on to Bioinforma)cs of next- genera)on sequencing Sequence acquisi)on and processing; genome mapping and alignment manipula)on Ruslan Sadreyev Director of Bioinformatics Department of Molecular
Genomic Data Analysis Services Available for PL-Grid Users
Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus Domain-oriented services and resources of Polish Infrastructure
Bioinformatics for NGS projects. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics for NGS projects Guidelines genomescan.nl GenomeScan s Guidelines for Bioinformatics Services on NGS Data Using our own proprietary data analysis pipelines Dear
RNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Arraygen Technologies Pvt. Ltd.
P r o j e c t s 50 M O N T H LY Arraygen Technologies Pvt. Ltd. Our Services ArrayGen offers an expanded selection of custom services and solutions in Genomics Bioinformatics. We assess and evaluate the
Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
Introduc)on to Genomics
Introduc)on to Genomics Libor Mořkovský, Václav Janoušek, Anastassiya Zidkova, Anna Přistoupilová, Filip Sedlák h1p://ngs-course.readthedocs.org/en/praha-january-2017/ Genome The genome is the gene,c material
GSA ---------------------------------------------------------------------------------------------------------------------- GSA Submission *Alias Submission name of the GSA. This field is used when the
CNV and variant detection for human genome resequencing data - for biomedical researchers (II)
CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common
ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction
INTERNATIONAL ORGANISATION FOR STANDARDISATION ORGANISATION INTERNATIONALE DE NORMALISATION ISO/IEC JTC 1/SC 29/WG 11 CODING OF MOVING PICTURES AND AUDIO ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June
02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
2nd (Next) Generation Sequencing 2/2/2018
2nd (Next) Generation Sequencing 2/2/2018 Why do we want to sequence a genome? - To see the sequence (assembly) To validate an experiment (insert or knockout) To compare to another genome and find variations
Next-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
Genomic DNA ASSEMBLY BY REMAPPING. Course overview
ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation
NGS, Cancer and Bioinformatics. 5/3/2015 Yannick Boursin
NGS, Cancer and Bioinformatics 5/3/2015 Yannick Boursin 1 NGS and Clinical Oncology NGS in hereditary cancer genome testing BRCA1/2 (breast/ovary cancer) XPC (melanoma) ERCC1 (colorectal cancer) NGS for
Total RNA isola-on End Repair of double- stranded cdna
Total RNA isola-on End Repair of double- stranded cdna mrna Isola8on using Oligo(dT) Magne8c Beads AAAAAAA A Adenyla8on (A- Tailing) A AAAAAAAAAAAA TTTTTTTTT AAAAAAA TTTTTTTTT TTTTTTTT TTTTTTTTT AAAAAAAA
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
NGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
ChIP-seq data analysis with Chipster. Eija Korpelainen CSC IT Center for Science, Finland
ChIP-seq data analysis with Chipster Eija Korpelainen CSC IT Center for Science, Finland chipster@csc.fi What will I learn? Short introduction to ChIP-seq Analyzing ChIP-seq data Central concepts Analysis
Differential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput
Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu
Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS
BICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte
BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis
NGS sequence preprocessing. José Carbonell Caballero
NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality
ChIP-seq analysis 2/28/2018
ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines