BD Single-Cell Multiplexing Kit Human Protocol

Transcription

1 BD Single-Cell Multiplexing Kit Protocol For use with the BD Rhapsody system 11/2017 Doc ID: Rev. 1.0

2 Contents Overview on page 3 Sample Tag library preparation workflow on page 4 Reference for BD Rhapsody single cell targeted library construction on page 5 Required and recommended materials on page 5 BD single cell multiplexing workflow on page 11 Sequencing on page 22 Sample Tag sequences on page 23 Troubleshooting on page 24 Contact information on page 27 2 Doc ID: Rev. 1.0

3 Overview The BD Single-Cell Multiplexing Kit utilizes an innovative antibodyoligo technology to provide higher sample throughput for BD Rhapsody assays. [See the Single Cell Targeted Library Preparation with BD Rhapsody User Guide (Doc ID: 47395).] Every antibody-oligo in the kit, referred to as Sample Tag, has a unique sample barcode conjugated to a human universal antibody. (See Figure 1.) Adjacent to the Sample Tag barcode are a universal PCR handle and poly(a) tail, which allow each Sample Tag to be captured by 3' single cell RNA-seq methods and amplified by PCR. A kit of 12 Sample Tags and two Sample Tag-specific primers is provided, along with additional library preparation materials for Sample Tag library generation. The labelling of Sample Tags utilizes a simple antibody staining procedure prior to pooling different samples into a BD Rhapsody Cartridge. By pooling multiple samples into the same BD Rhapsody workflow, the BD Single-Cell Multiplexing Kit enables you to: Increase sample throughput and reduce library preparation cost. Reduce sample-to-sample variability due to technical errors during library preparation. Detect intra-sample Tag multiplets. [See the BD Single Cell Genomics Bioinformatics Handbook (Doc ID: 54169).] Figure 1 Sample Tag design ensures compatibility with the BD Rhapsody assay. Doc ID: Rev

4 Sample Tag library preparation workflow Sample Tags are captured with mrna content of single cells during the BD Rhapsody Cartridge workflow through the poly(a) tail, and a cdna copy is generated on the BD Rhapsody Cell Capture Bead after reverse transcription. (See Figure 2.) Sample Tags are first amplified together with the targeted panel in PCR1 and then amplified separately in subsequent PCRs (PCR2 and final amplification). As a result, two sequencing libraries are generated: a gene panel targeted library and a Sample Tag library. Since Sample Tag expression is higher than typical mrna expression, this parallel approach allows you to optimize the percentage of reads allocated to Sample Tags in a sequencing run samples per run Sample ing and pooling Time varies Single cell capture, reverse transcription, xonuclease I treatment on beads ~ 2 hr 45 min PCR1 ~ 120 min PCR2 targeted CR2 ~ 125 min Final amplification targeted library Final library ~ 60 min Library quantification and sequenc on compatible Illumina sequencers Time varies Figure 2 Workflow for generating parallel libraries with Sample Tags. 4 Doc ID: Rev. 1.0

5 Reference for BD Rhapsody single cell targeted library construction For detailed protocols using the BD Rhapsody system, see the Single Cell Targeted Library Preparation with BD Rhapsody User Guide (Doc ID: 47395). Required and recommended materials Required kits Store the kit boxes at the specified storage temperatures. Sample Tags should not be frozen. Protect from exposure to light. Each reagent is stable until the expiration date shown on the label when stored as directed. Keep the reagents on ice unless instructed otherwise. Workflow steps Single cell multiplexing and amplification Required kits BD Single-Cell Multiplexing Kit Sample Tag (12) Component (PN ) BD Single-Cell Multiplexing Kit Library Amplification Component (PN ) BD Rhapsody Targeted Amplification Kit (PN ) BD Rhapsody Cartridge Reagent Kit (PN ) Single cell capture through Exonuclease I inactivation BD Rhapsody Cartridge Kit (PN ) a BD Rhapsody cdna Kit (PN ) a a. For these kit components, see the Single Cell Targeted Library Preparation with BD Rhapsody User Guide (Doc ID: 47395). Doc ID: Rev

6 Kit Components Quantity Volume per unit Storage BD Single-Cell Multiplexing Kit Sample Tag (12) Component (PN ) Sample Tag 1 Sample Tag 2 Sample Tag 3 Sample Tag 4 Sample Tag 5 Sample Tag 6 Sample Tag 7 Sample Tag 8 Sample Tag 9 Sample Tag 10 Sample Tag 11 Sample Tag 12 4 C 6 Doc ID: Rev. 1.0

7 Kit Components Quantity Volume per unit Storage BD Single-Cell Multiplexing Kit Library Amplification Component (PN ) PCR MasterMix 1 vial 300 µl Elution Buffer 1 vial 500 µl Universal Oligo 1 vial 20 µl Library Forward Primer 20 C Sample Tag PCR1 Primer Sample Tag PCR2 Primer Doc ID: Rev

8 Kit Component Quantity Volume per unit Storage BD Rhapsody Targeted Amplification Kit (PN ) Nuclease-Free Water RT/PCR Enhancer 1vial 1mL 1vial 50µL PCR MasterMix 1 vial 800 µl Elution Buffer 1 vial 400 µl Universal Oligo 1 vial 110 µl Library Forward Primer Library Reverse Primer 1 Library Reverse Primer 2 Library Reverse Primer 3 Library Reverse Primer 4 20 C Bead Resuspension Buffer 1vial 1mL Kit Components Quantity Volume per unit Storage BD Rhapsody Cartridge Reagent Kit (PN ) Sample Buffer a 1bottle 28mL a. Only required reagent for the BD single cell multiplexing workflow. 4 C 8 Doc ID: Rev. 1.0

9 Required reagents Material a Supplier Catalog no. BD Stain Buffer (FBS) BD Biosciences Calcein AM, cell-permanent dye, b 2mM Thermo Fisher Scientific C1430 Draq7, 0.3 mm BD Biosciences Agencourt AMPure XP magnetic beads Beckman Coulter Life Sciences A % isopropyl alcohol Major laboratory supplier a. All reagents except for BD Stain Buffer (FBS) are required for the BD Rhapsody system. b. Protect Calcein AM from light. Avoid multiple freeze-thaw cycles. See manufacturer s storage recommendations. Doc ID: Rev

10 Required consumables and equipment Material Supplier Catalog no. DNA LoBind Tubes, 1.5 ml a Eppendorf Falcon Tube with Cell Strainer Cap Thermo Fisher Scientific Improved Neubauer Hemocytometer INCYTO DHC-N01-5 DNA LoBind Tubes, 1.5 ml a Eppendorf ml PCR 12-strip tubes a Major supplier Nuclease-Free Water Major supplier Low retention filtered pipette tips a Major supplier Laminar flow hood Major supplier Digital timer a Major supplier Pipettes (P10, P20, P200, P1000) a Major supplier Microcentrifuge for ml tubes a Major supplier Microcentrifuge for 0.2 ml tubes a Major supplier Centrifuge and rotor for 15 ml tubes Major supplier Vortexer a Major supplier Pipet-Aid Major supplier a. Provide material in both pre- and post-amplification workspaces. 10 Doc ID: Rev. 1.0

11 BD single cell multiplexing workflow Preparing pooled single cell cdna Unless specified, perform the procedure in a pre-amplification workspace. Protect Calcein AM and Draq7 from light until ready to use. Some cell dissociation reagents, such as trypsin, may damage cell surface markers and decrease Sample Tag sensitivity. Use cell dissociation reagents suitable for cell surface staining. Cells may be lost during the wash steps (25 50%). For low-abundance samples (<100,000 cells), account for cell loss when preparing single cell samples. 1 Resuspend 12,000 2 x10 6 cells in 200 µl of BD Stain Buffer (FBS). 2 Briefly centrifuge the Sample Tag tubes to collect the contents at the bottom. 3 For each sample, transfer 180 µl of the cell suspension to a Sample Tag tube, and mix by pipette only. Caution. Aqueous buffered solution (Sample Tag) contains BSA and 0.1% sodium azide. Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. 4 Incubate the cell suspension at room temperature for 20 minutes. 5 Add 200 µl of BD Stain Buffer (FBS) to the cell suspension, and mix by pipette only. 6 Centrifuge the cells at 300 x g for 5 minutes. Doc ID: Rev

12 7 Remove the supernatant without disturbing the pellet, and resuspend the pellet in 500 µl of BD Stain Buffer (FBS). For low-abundance samples, leave 50 µl of supernatant before resuspending the pellet in 500 µl of BD Stain Buffer (FBS). 8 Centrifuge the cells at 300 x g for 5 minutes. 9 Remove the supernatant without disturbing the pellet, and resuspend the cells in 500 µl of Sample Buffer from BD Rhapsody reagents. For low-abundance samples, leave 50 µl of supernatant. Resuspend the cells in Sample Buffer so that the total volume is 100 µl. 10 Add 2 mm Calcein AM and 0.3 mm Draq7 at 1:200 dilution each to the total volume of cell suspension. For example, pipette 2.5ul of each dye into 500 µl of cell suspension. 11 Incubate the cell suspension at 37 C protected from light for 5 minutes. 12 Filter the cell suspension through a Falcon Tube with Cell Strainer Cap (Thermo Fisher Scientific Cat. No ). Place the cell suspension on ice. 13 Prepare the BD Rhapsody Cartridge according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide (Doc ID: 47395). 14 Count each sample using the Hemocytometer Adapter in the BD Rhapsody Scanner according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. 15 Pool cells according to the desired relative amounts of cells and the volumes calculated in the BD Rhapsody Scanner software. See the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Minimize the time between cell pooling and single cell capture. 16 Proceed with single cell capture through inactivation of Exonuclease I in the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. 12 Doc ID: Rev. 1.0

13 Performing PCR1 on the pooled samples 1 In the pre-amplification workspace, add these components in the following order to prepare the PCR1 reaction mix in a new 1.5 ml LoBind Tube: PCR1 reaction mix Component Nuclease-Free Water (PN ) a 1 library (µl) 1 library + 20% overage (µl) Up to 28.8 Up to 34.6 PCR MasterMix (PN ) a Universal Oligo (PN ) a RT/PCR Enhancer (PN ) a PCR1 Primers b (Optional) PCR1 Supplemental Primers c Sample Tag PCR1 Primer (PN ) d (10.0) (12.0) Total a. Use from the BD Rhapsody Targeted Amplification Kit (PN ). b. Component in BD Rhapsody targeted primer panel. c. Order from BD Biosciences, if desired. d. Use from the BD Single-Cell Multiplexing Kit Sample Tag (12) Component Kit (PN ). Doc ID: Rev

14 2 Gently vortex and centrifuge the mix, and place it back on ice until ready to use. 3 (Optional) Sub-sample the Exonuclease I-treated beads according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. 4 Place the tube of Exonuclease I-treated beads in cold Bead Resuspension Buffer (PN ) on the 1.5 ml tube magnet. Carefully remove and discard the supernatant without disturbing the beads and while leaving the tube on the magnet. 5 Remove the tube from the magnet, and then use a low retention tip to pipet 200 µl of PCR1 reaction mix to gently resuspend the beads. Do not vortex. 6 Ensuring that the beads are fully suspended, pipet 50 µl of the PCR1 reaction mix with beads into each of four 0.2 ml PCR tubes. Transfer any residual mix to one of the tubes. 7 Bring the PCR1 reaction mix into the post-amplification workspace. 8 Start the PCR1 thermal cycler program to ramp the heated lid and heat block of the thermal cycler to 95 C, and then pause the thermal cycler. 9 For each 0.2 ml PCR tube, gently mix the suspension of beads by pipette only, and then immediately put the tube in the thermal cycler that has been ramped to 95 C. Do not vortex. Do not proceed to thermal cycling until each tube is gently mixed by pipette to ensure uniform bead suspension. 10 Proceed with the PCR1 thermal cycler program and post-amplification steps according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. 14 Doc ID: Rev. 1.0

15 11 Purify the PCR1 products with 1X (200 µl) of Agencourt AMPure XP magnetic beads according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Use the ratio (volume) of Agencourt AMPure XP magnetic beads specified in this step. Due to the smaller fragment size of the Sample Tags, the ratio in this step differs from the ratio specified for the purification of PCR1 products in the User Guide. Performing PCR2 on the PCR1 products 1 In the pre-amplification workspace, add these components in the following order to prepare the two reaction mixes, targeted PCR2 and Sample Tag PCR2, in separate, new 1.5 ml LoBind Tubes: Targeted PCR2 reaction mix Component Nuclease-Free Water (PN ) a 1 library (µl) 1 library + 20% overage (µl) Up to 8.0 Up to 9.6 PCR MasterMix (PN ) a Universal Oligo (PN ) a PCR2 Primers b (Optional) PCR2 Supplemental Primers c (8.0) (9.6) Total a. Use from the BD Rhapsody Targeted Amplification Kit (PN ). b. Component in BD Rhapsody Targeted primer panel. c. Order from BD Biosciences, if desired. Doc ID: Rev

16 Sample Tag PCR2 reaction mix Component Nuclease-Free Water (PN ) a PCR MasterMix (PN ) b 1 library (µl) library + 20% overage (µl) Universal Oligo (PN ) b Sample Tag PCR Primer ( ) b Total a. Use from the BD Rhapsody Targeted Amplification Kit (PN ). b. Use from the BD Single-Cell Multiplexing Kit Library Amplification Component (PN ). 2 Gently vortex and centrifuge the mixes, and place them back on ice until ready to use. 3 Bring the PCR2 reaction mixes to the post-amplification workspace. 4 In two separate and new 0.2 ml PCR tubes: a b Targeted: Pipet 5.0 µl of the purified PCR1 products to 45 µl of the targeted PCR2 reaction, and mix by pipette for a total of 50 µl. Sample Tag: Pipet 5.0 µl of the purified PCR1 products to 45 µl of the Sample Tag PCR2 reaction, and mix by pipette for a total of 50 µl. Gently vortex and centrifuge the tubes. 16 Doc ID: Rev. 1.0

17 5 Proceed with the PCR2 thermal cycler program according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Stopping point: Targeted and Sample Tag PCR2 can run overnight. 6 Purify the PCR2 products according to the procedure in the Single Cell Targeted Library Preparation with BD Rhapsody User Guide: - Targeted PCR2 products: Use 0.7X (35 µl) of Agencourt AMPure XP magnetic beads. - Sample Tag PCR2 products: Use 1X (50 µl) of Agencourt AMPure XP magnetic beads. 7 Quantify the targeted PCR2 and Sample Tag PCR2 products with a Qubit Fluorometer using the Qubit dsdna HS Assay. See the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Dilute an aliquot of each product to the following concentrations: - Targeted PCR2 products: 10 ng/µl. - Sample Tag products: 0.5 ng/µl. Doc ID: Rev

18 Performing final amplification of pooled samples 1 In the pre-amplification workspace, prepare the 1 library + 20% overage of the final amplification mix for each of the two products. Add these components in the following order to prepare the mix in a new 1.5 ml LoBind Tube: NOTE Using the same Library Reverse Primer for both final amplification mixes is recommended but not required. Targeted final amplification mix Component Nuclease-Free Water (PN ) a 1 library (µl) library + 20% overage (µl) PCR MasterMix (PN ) a Library Forward Primer (PN ) a Library Reverse Primer 1 4 (PN , ) a Total a. Use from the BD Rhapsody Targeted Amplification Kit (PN ). 18 Doc ID: Rev. 1.0

19 Sample Tag final amplification mix Component Nuclease-Free Water (PN ) a PCR MasterMix (PN ) b Library Forward Primer b (PN ) Library Reverse Primer 1 4 (PN , ) a 1 library (µl) library + 20% overage (µl) Total a. Use from the BD Rhapsody Targeted Amplification Kit (PN ). b. Use from the BD Single-Cell Multiplexing Kit Library Amplification Component (PN ). 2 Gently vortex and centrifuge the mixes, and place them back on ice until ready to use. 3 Bring the final amplification mixes into the post-amplification workspace. Doc ID: Rev

20 4 In two separate and new 0.2 ml PCR tubes: a b Targeted library master mix: Pipet 3.0 µl of 10 ng/µl of targeted PCR2 products to 47.0 µl of the targeted final amplification mix for a total of 50 µl. Gently vortex and centrifuge the mix. Sample Tag library master mix: Pipet 3.0 µl of 0.5 ng/µl of Sample Tag PCR2 products to 47.0 µl of the Sample Tag final amplification mix for a total of 50 µl. Gently vortex and centrifuge the mix. 5 Proceed with the final amplification thermal cycler program according to the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. 6 Purify the final amplification products according to the procedure in the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Note that each of the final amplification products requires specific cleanup conditions: - Final targeted library: Use 0.6X (30 µl) of Agencourt AMPure XP magnetic beads. - Final Sample Tag library: Use 1X (50 µl) of Agencourt AMPure XP magnetic beads. 7 Perform quality control, and sequence the final libraries. See Sequencing on page Doc ID: Rev. 1.0

21 The Sample Tag library shows a fragment distribution of bp. The BD Rhapsody targeted library shows a fragment distribution that depends on the panel used. For example: BD Rhapsody Immune Response Panel Hs () Sample Tag library Doc ID: Rev

22 Sequencing Sequencing requirements Illumina BaseSpace and sample sheet sequencing run setup: Unless different Library Reverse primers were used for the targeted library and Sample Tag library, enter the pooled targeted and Sample Tag library as one sample. For all other requirements, see the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. Sequencing recommendations Sample Tag library Pooling samples of the same type: 120 reads/cell. For example: combining different donor peripheral blood mononuclear cells. Pooling different sample types: 600 reads/cell. For example: combining Jurkat cells with peripheral blood mononuclear cells. BD Rhapsody targeted library For the recommended sequencing amount of the specific gene panel used, see the Single Cell Targeted Library Preparation with BD Rhapsody User Guide. NOTE To determine the ratio of BD Rhapsody targeted library to Sample Tag library to pool for sequencing, there is a Sample Tag sequencing calculator available. Contact BD Biosciences technical support at techsupport.genomics@bd.com. 22 Doc ID: Rev. 1.0

23 Sample Tag sequences Each Sample Tag is a human universal antibody conjugated with a unique oligonucleotide sequence to allow for sample identification. Each Sample Tag has common 5' and 3' ends and the Sample Tag sequence: GTTGTCAAGATGCTACCGTTCAGAG[Sample Tag sequence]aaaaaaaaaaaaaaaaaaaaaaaaa Sample Tag Sample Tag 1 Sample Tag 2 Sample Tag 3 Sample Tag 4 Sample Tag 5 Sample Tag 6 Sample Tag 7 Sample Tag 8 Sample Tag 9 Sample Tag 10 Sample Tag 11 Sample Tag 12 Sample Tag sequence ATTCAAGGGCAGCCGCGTCACGATTGGATACGACTGTTGGACCGG TGGATGGGATAAGTGCGTGATGGACCGAAGGGACCTCGTGGCCGG CGGCTCGTGCTGCGTCGTCTCAAGTCCAGAAACTCCGTGTATCCT ATTGGGAGGCTTTCGTACCGCTGCCGCCACCAGGTGATACCCGCT CTCCCTGGTGTTCAATACCCGATGTGGTGGGCAGAATGTGGCTGG TTACCCGCAGGAAGACGTATACCCCTCGTGCCAGGCGACCAATGC TGTCTACGTCGGACCGCAAGAAGTGAGTCAGAGGCTGCACGCTGT CCCCACCAGGTTGCTTTGTCGGACGAGCCCGCACAGCGCTAGGAT GTGATCCGCGCAGGCACACATACCGACTCAGATGGGTTGTCCAGG GCAGCCGGCGTCGTACGAGGCACAGCGGAGACTAGATGAGGCCCC CGCGTCCAATTTCCGAAGCCCCGCCCTAGGAGTTCCCCTGCGTGC GCCCATTCATTGCACCCGCCAGTGATCGACCCTAGTGGAGCTAAG Doc ID: Rev

24 Troubleshooting Cell preparation troubleshooting Observation Possible causes Recommended solutions No pellet after centrifuging cells or very few cells Do not have the recommended staining buffer Cells require staining at a different temperature Accidentally resuspended cells in BD Stain Buffer (FBS) rather than Sample Buffer before cell counts Rare or dilute sample Various Physiological requirement Various After each centrifugation step, leave 50 µl of supernatant. Stain samples in BD Stain Buffer (FBS) (PN ) or 1X PBS with 1% FBS or 0.1% BSA. Use cell surface staining protocols that have been optimized for the specific sample type. BD recommends centrifuging the samples and resuspending the cells in Sample Buffer after the staining step. This ensures optimal performance of cell loading in the BD Rhapsody Cartridge. The sample calculator on the BD Rhapsody Scanner displays a negative volume for Sample Buffer to be added Sample is too dilute Centrifuge the sample, resuspend it in a lower volume, and recount the cells before pooling. If the calculated volume is greater than the entered total volume, the calculated buffer volume is negative, or a warning displays, bring the total volume to 610 µl in cold Sample Buffer for cartridge cell loading. 24 Doc ID: Rev. 1.0

25 Library preparation troubleshooting Observation Possible causes Recommended solutions Yield of Sample Tag Library is too low (<1 ng/µl) Various Ensure that the cells were stained correctly during sample preparation. During library preparation, Sample Tag PCR1 and PCR2 Primers may have been swapped. Ensure that correct primers are used for each step. AMPure purification of <1X concentration leads to significant loss of Sample Tag products. Re-amplify and purify the product with 1X AMPure Beads. Low sequencing quality Insufficient PhiX Sequencing targeted library and Sample Tag library together: Use 20% PhiX and a loading concentration of 1.2 pm. Sequencing Sample Tag library alone: Use 50% PhiX and a loading concentration of 1.0 pm. Low sensitivity of Sample Tags (<95%) Insufficient sequencing of the Sample Tag library Pooled samples of the same cell type: 120 reads/cell. Pooled samples of different cell types: 600 reads/cell. Doc ID: Rev

26 Copyrights/trademarks Trademarks are the property of their respective owners BD. BD, BD Logo and all other trademarks are property of Becton, Dickinson and Company. The information in this guide is subject to change without notice. BD Biosciences reserves the right to change its products and services at any time to incorporate the latest technological developments. Although this guide has been prepared with every precaution to ensure accuracy, BD Biosciences assumes no liability for any errors or omissions, nor for any damages resulting from the application or use of this information. BD Biosciences welcomes customer input on corrections and suggestions for improvement. Regulatory information For Research Use Only. Not for use in diagnostic or therapeutic procedures. FCC information WARNING: Changes or modifications to this unit not expressly approved by the party responsible for compliance could void the user's authority to operate the equipment. NOTICE: This equipment has been tested and found to comply with the limits for a Class A digital device, pursuant to Part 15 of the FCC Rules. These limits are designed to provide reasonable protection against harmful interference when the equipment is operated in a commercial environment. This equipment generates, uses, and can radiate radio frequency energy and, if not installed and used in accordance with the instruction manual, may cause harmful interference to radio communications. Operation of this equipment in a residential area is likely to cause harmful interference in which case the user will be required to correct the interference at his own expense. BD is not responsible for any radio or television interference caused by unauthorized changes or modifications to this equipment. Unauthorized changes or modifications could void the user's authority to operate the equipment. This Class A digital apparatus meets all requirements of the Canadian Interference-Causing Equipment Regulations. Cet appareil numérique de la classe A respecte toutes les exigences du Réglement sur le matériel brouilleur du Canada. Patents The BD Rhapsody is covered by one or more of the following US patents: , , , , , , and History Revision Date Change made Doc ID: Rev /2017 Initial release 26 Doc ID: Rev. 1.0

27 Contact information Becton, Dickinson and Company BD Biosciences 2350 Qume Drive San Jose, CA USA Tel Doc ID: Rev