Accurate identification of Candida parapsilosis (sensu lato) using

Transcription

1 JCM Accepts, published online ahead of print on 25 April 2012 J. Clin. Microbiol. doi: /jcm Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Accurate identification of Candida parapsilosis (sensu lato) using mitochondrial DNA and real-time PCR Ana Carolina R. Souza 1, Renata C. Ferreira 1,2,3, Sarah S. Gonçalves 1, Guillermo Quindós 4, Elena Eraso 4, Fernando C. Bizerra 1, Marcelo R. S. Briones 2,3 and Arnaldo L. Colombo 2,# 1 Laboratório Especial de Micologia, Disciplina de Infectologia, Universidade Federal de São Paulo, Rua Pedro de Toledo 669, 5 andar, CEP , São Paulo, SP, Brasil 2 Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Rua Botucatu 862, ECB 3 andar, CEP , São Paulo, SP, Brasil 3 Laboratório de Genômica Evolutiva e Biocomplexidade, Universidade Federal de São Paulo, Rua Pedro de Toledo 669, 4 andar, CEP , São Paulo, SP, Brasil 4 Laboratorio de Micología Médica, Departamento de Inmunología, Microbiología y Parasitología, Facultad de Medicina y Odontología, Universidad del País Vasco/Euskal Herriko Unibertsitatea, Bilbao, Spain Running title: C. parapsilosis species identification by TaqMan PCR #Corresponding author: Arnaldo L. Colombo Laboratório Especial de Micologia Universidade Federal de São Paulo, Rua Botucatu 740, CEP , São Paulo, SP, Brasil Phone and Fax: arnaldolcolombo@gmail.com

2 32 Abstract Candida parapsilosis is the second most frequently isolated Candida species from blood cultures in South America and some European countries, such as Spain. Since 2005, this species has been considered a complex of 3 closely related species: C. parapsilosis, Candida metapsilosis and Candida orthopsilosis. Here, we described a real-time TaqMan-MGB PCR assay, using mitochondrial DNA (mtdna) as target, which readily distinguishes these 3 species. We first used comparative genomics to locate syntenic regions between these 3 mitochondrial genomes and then selected NADH5 as target for the real-time PCR assay. Probes were designed to include a combination of different SNPs that are able to differentiate each species within C. parapsilosis complex. This new methodology was first tested using mtdna and then genomic DNA from 4 reference and 5 clinical strains. For assay validation, a total of 96 clinical isolates and 4 American Type Culture Collection (ATCC) previously identified by ITS rdna (internal transcribed spacers of rdna) sequencing were tested. Real-time PCR using genomic DNA was able to differentiate the 3 species with 100% accuracy. No amplification was observed when DNA from other species was used as templates. We observed 100% congruence with ITS rdna sequencing identification, including 30 strains used in blind testing. This novel method allows a quick and accurate intra-complex identification of C. parapsilosis and saves time compared with sequencing, which so far has been considered the gold standard for yeast identification. In addition, this assay provides a useful tool for epidemiological and 54 clinical studies of these emergent species. 2

3 55 Introduction Candida albicans remains the most prevalent species in human superficial and invasive Candida infections, although there is concern over the increasing rates of non-c. albicans infections worldwide (2, 18). C. parapsilosis is a relevant pathogen primarily in South America, where it causes from 19% to 38% of all episodes of candidemia (6, 25, 26). Similarly, data by Almirante et al. (2005) and Canton et al. (2011) show that C. parapsilosis causes from 15% to 23% of all hematogenous candidiasis cases in Spanish hospitals (1, 4) Recently, the genetically heterogeneous taxon C. parapsilosis was reclassified into 3 species: Candida parapsilosis (sensu stricto), Candida orthopsilosis and Candida metapsilosis (30). Although the epidemiological and clinical differences caused by these Candida species have not yet been fully determined, several in vitro studies have demonstrated biological differences between them, including the expression of virulence factors, susceptibility to antifungal agents and geographical distribution (3, 10, 12, 13, 22, 24) Currently, species identification within the C. parapsilosis complex is based on DNA techniques such as RAPD, RFLP of the SADH locus and sequencing of the internal transcribed spacer, ITS (13, 20, 31). These methods are time consuming, labor intensive and, with the exception of DNA sequencing, may have accuracy and reproducibility limitations (23, 27) Because mutation rates in the mitochondrial genome are higher than in the nuclear genome, it is possible to obtain sufficient resolution to distinguish close 3

4 phylogenetic relationships (5). Indeed, our group has shown that mitochondrial DNA (mtdna) sequences can be readily used to discriminate Candida glabrata isolates. Analysis of the cytochrome c oxidase subunit 2 (COX2) enables typing of C. glabrata and clustering of strains associated with their geographical origins (28) In the present study, we describe a specific, fast, sensitive and accurate real-time PCR method based on mtdna-specific target detection that is capable of discriminating all 3 species within the C. parapsilosis complex. 84 Material and Methods Microorganisms: A total of 100 C. parapsilosis (sensu lato) strains were used to validate our assay: (i) four reference strains obtained from the American Type Culture Collection (ATCC), C. parapsilosis (sensu stricto) ATCC and ATCC 90018, C. orthopsilosis ATCC and C. metapsilosis ATCC 96143; (ii) a panel of 66 clinical isolates obtained from different body sites and geographical regions of Brazil, previously identified at the species level by sequencing of the ITS region (part of this collection had already been deposited in GenBank (NCBI) (13); and (iii) a group of 30 well-characterized C. parapsilosis (sensu lato) clinical isolates that were kindly provided in a blind fashion by Dr. Quindós (Bilbao, Spain) (Table S1) (24). In addition, the reference strains C. albicans (ATCC 90029), Candida tropicalis (ATCC 750), C. glabrata (ATCC 90030), Candida lusitaniae (ATCC 66035), Candida krusei (ATCC 6258) and Lodderomyces elongisporus (CBS 2605) were also tested as controls. Viability, purity and phenotypic identification of the samples were performed as previously described (13). 4

5 Microorganism identification using amplification and sequencing of the ITS region of rdna:. The genomic DNA was extracted from single colonies using glass beads (19). Amplification and sequencing were performed with the universal primers ITS1 and ITS4 (Table 1) (32). PCR and sequencing were performed as previously described by our group (14). The sequences generated in this study have been deposited in the GenBank (NCBI) database ( In silico selection of the mtdna target gene for species identification: Complete mitochondrial genome sequences from 3 Candida species were retrieved from GenBank (NCBI): C. parapsilosis CBS7157 (access number- X74411), C. parapsilosis CLIB214 (DQ026513), C. orthopsilosis MCO456 (AY962590), C. orthopsilosis MCO471 (DQ026513), C. metapsilosis MCO448 (NC006971) and C. metapsilosis PL448 (AY391853). We generated a whole genome alignment using the MAUVE program, Progressive Mauve algorithm (7) to verify the sinteny. Selected sequences were aligned using Seaview v.4 (16) Extraction and amplification of yeast mitochondrial DNA for verification of the SNP presence on the target gene: Mitochondrial DNA was isolated as described elsewhere with a yield of 100 ng/µl (8). A 620bp fragment of mitochondrial NADH5 was amplified and sequenced with specific primers (Table 1). PCR (25µl) were performed using the MasterMix protocol (Promega, Madison, WI). The conditions of PCR cycles were: 3 min at 95 ºC, followed by 40 cycles at 5

6 ºC for 45 s, 52 ºC for 45 s, and 1 min at 72 ºC, followed by a final 5 min, 72 ºC, extension PCR products were purified using Amicon Ultra-0.5 kit (Millipore Massachusetts, United States) and sequenced in an ABI3100 automated sequencer (Applied Biosystems). Phred-Phrap-Consed were used for the assembly and finishing of high quality sequences (Phred scores>40) (9, 15). Species were identified by Basic Local Alignment Search Tool (BLAST), with e- value <10-5 as cutoff Identification of C. parapsilosis (sensu stricto), C. orthopsilosis and C. metapsilosis strains by Real-Time PCR Primers and probes design: Primers and specific probes for NADH5 gene were designed using the Primer Express Software (Applied Biosystems). Sequences and characteristics of primers and probes are shown in table Real-Time PCR assay: Real-time PCR was performed in a StepOnePlus Real- Time PCR System (Applied Biosystems). The reaction mix contained 12.5 μl of TaqMan Universal PCR Master Mix (Applied Biosystems), 400 nm of each primer, 250 nm of probe and 160 ng of genomic DNA (or 40 ng of mtdna) from the different tested strains in a final volume of 25 μl. A single-color simplex assay was used, in which each probe was added to different reaction tubes. Real-time PCR conditions were as follows: initial denaturation at 50 ºC for 2 min and 95 ºC for 10 min; 40 cycles of 95 ºC for 15 s and 51 ºC for 30 s; and a final elongation step of 1 min at 60 ºC. Fluorescence was measured for 1 min during the elongation step. 6

7 The assay sensitivity was estimated by comparing the real-time identification results with the identification by ITS sequencing. To ensure the specificity of the assay, we used genomic DNA from L. elongisporus and different Candida species (C. albicans, C. tropicalis, C. glabrata, C. lusitaniae and C. krusei) as templates in the reaction. 147 Results Molecular Identification by sequencing of the ITS region of all clinical isolates (66 Brazilian and 30 Spanish strains): The strains were initially identified as C. parapsilosis (sensu lato) on the basis of their micromorphology characteristics and biochemical profiles using ID32C System (biomérieux, Marcy l Etoile, France) (data not shown). ITS sequencing was used as gold standard for the identification at the species level of all clinical strains tested. The amplicons lengths of the ITS regions were 593bp to 612bp and sequences generated were used in BLAST searches ( to confirm the preliminary identifications. BLAST analysis with the ITS sequences were capable of identifying all reference and clinical strains as follows: 50 isolates were identified as C. parapsilosis (sensu stricto); 40, as C. orthopsilosis; and 10, as C. metapsilosis In silico analysis: In silico analysis showed that the mitochondrial genomes of C. parapsilosis (sensu stricto), C. orthopsilosis and C. metapsilosis are syntenic. The criterion for selecting the target gene was to find regions with different singlenucleotide polymorphism (SNP) profiles that were capable of discriminating the 3 species and that were flanked by conserved sequences in the same region of the 7

8 chromosome. On the basis of the alignments from the 6 mitochondrial wholegenome sequences, we selected NADH5 as the target for real-time PCR. The pairwise uncorrected distances between three species for complete sequence were: 5.10% for C. parapsilosis (sensu stricto) and C. metapsilosis; 4.85% for C. parapsilosis (sensu stricto) and C. orthopsilosis and 5.16% for C. metapsilosis and C. orthopsilosis. SNPs identified in silico were confirmed by sequencing 620bp of NADH5 of the 4 reference strains and 6 clinical isolates (LEMI6492, LEMI6814, LEMI7685, LEMI8521, LEMI7787, LEMI7518) (Figure 1). The partial sequence of C. parapsilosis (sensu stricto) and C. metapsilosis showed 100% sequence similarity with each of the control strains. Strain LEMI7518 identified as C. orthopsilosis has seven nucleotide differences to the reference strain, one inside the probe region (Figure 1). Molecular Identification by Real-time PCR: Primers were designed to be specific for the C. parapsilosis species complex and to anneal to a highly conserved region of the NADH5. Three different specific probes (TaqMan-MGB) targeting a region of the NADH5 were designed for the 3 species within the C. parapsilosis complex. Initially, the ability of each probe to specifically identify its target was assessed using mtdna as template from 4 reference strains and 5 clinical isolates (LEMI7294, LEMI6492, LEMI3523, LEMI3494, LEMI8521). Different annealing temperatures, probes and mtdna concentrations were tested to ensure specificity and good reproducibility (data not shown) of the PCR assay, and the best performance was obtained using 51 ºC, 250 nm and 40 ng/reaction, respectively. The assay was determined to be species specific because: (i) all strains tested 8

9 were correctly identified; (ii) non-specific amplification was not observed; and, (iii) no cross-species probe signal was observed. To show that we obtain identical results using either purified mtdna or total cellular DNA we compared the specificity and sensitivity of the method using total DNA from reference strains as template. We used the same annealing temperature and probe concentrations established for the mtdna assays. Different genomic DNA concentrations were tested (data not shown), and a concentration of 160 ng/reaction was selected. Similar to the mtdna analysis, the probes were very specific at the species level, and all strains tested were correctly identified. After the standardization of the real-time PCR assay, we applied this method to analyze the genomic DNA of all the clinical isolates from Brazil included in this study (n= 66). By real-time PCR, we identified 37 as C. parapsilosis (sensu stricto), 24 as C. orthopsilosis and 5 as C. metapsilosis. The results generated by real-time PCR showed 100% concordance with the results obtained by ITS sequencing (Table 2). In addition, all isolates that were sent to our lab in a blind fashion by Dr. Quindós (n= 30) were correctly identified as the following: 21 C. parapsilosis (sensu stricto), 5 C. orthopsilosis and 4 C. metapsilosis. The Spanish strains were originally identified in Dr. Quindós lab by ITS sequencing (24). 205 Discussion In the present study, we described a rapid and accurate method using mtdna and TaqMan technology for identification of the 3 species within the C. parapsilosis complex. We decided to use mtdna because it has been recognized 9

10 as a valuable target for evaluating close phylogenetic relationships because of its higher mutation rate compared with nuclear DNA (5, 28, 33). To explore the mtdna potential for species identification, we first performed an in silico analysis to check for possible polymorphic regions capable of differentiating the 3 target species within the C. parapsilosis complex. After checking the whole mtdna sequence of the 3 species, we found polymorphic regions within the NADH5 gene, which were chosen as targets for real time PCR. The pairwise distances of NADH5 homologs are well balanced between the three pair-groups and are higher than those found for ITS and COX3 in the C. parapsilosis complex and for COX2 in C. glabrata (28,30) The probes were designed to include a combination of different SNPs able to differentiate each species within the C. parapsilosis complex (Figure 1). The large adenine and thymine content in mtdna as a whole and, consequently, in the selected region impairs the design of probes with high annealing temperatures. This problem was solved using the TaqMan Minor Groove Binder (MGB), which enhances the melting temperature of probes. Despite all progress obtaining specific probes based on mtdna, we considered the protocol for its extraction to be time consuming and labor intensive (8). Therefore, we showed that during the genomic DNA extraction from yeast cells, some mtdna is also obtained, making it possible to run the PCR assays on extracted total DNA and still correctly identify all strains (Table 2). Consequently, the new assay becomes more suitable to clinical laboratories. 10

11 In the present study, we tested 100 C. parapsilosis (sensu lato) strains and a control group of 6 other species (Table 2). Because all C. parapsilosis (sensu lato) were correctly identified, we have established that the primer and probe sets exhibited 100% specificity, with no background fluorescence within the species of the complex. No amplification was observed when DNA from other species were used as the template, including L. elongisporus, which is biochemically indistinguishable from the C. parapsilosis species complex (21). Finally, we observed 100% concordance with the ITS sequencing identification, including the thirty strains used for blind testing. Recently, some authors proposed new identification assays to distinguish these closely related species. In 2011, Hays et al. described a real-time PCR assay using melting curve analysis on a portion of the SADH gene. This method provides a rapid identification; however, the assay may exhibit low reproducibility because it is possible to observe variations in the melting curve when different thermocyclers are used (17). Garcia-Effron et al. (2011) proposed a new real-time PCR assay that can differentiate these 3 species using molecular beacons technology and the ITS region as the target. This assay was highly specific, exhibited good reproducibility and showed that the C. parapsilosis species complex can be identified quickly, thus demonstrating its suitability for clinical applications (11). Santos et al. (2011) developed an assay using matrix-assisted laser desorption/ionization time-of-flight intact cell mass spectrometry (MALDI-TOF ICMS) for identification of some emerging pathogenic Candida species. These authors have shown that this method identifies the 3 species within the C. 11

12 parapsilosis complex, however, a quality-controlled database must be available to provide an accurate analysis (29). In all methods described above, only a limited number of C. metapsilosis (1, 6 and 2, respectively) were tested by the authors (11, 17, 29). In our analysis, we were able to validate our strategy by testing 50 strains of C. parapsilosis (sensu stricto), 40 strains of C. orthopsilosis and 10 strains of C. metapsilosis, including strains from 2 different countries In conclusion, we found an unexpected high variability in NADH5, a gene that encodes a respiratory chain protein and therefore, expected to be under strong negative selection. Nevertheless, we described a level of variability whose analysis reveals that it can be exploited for epidemiological purposes. Our data shows that the variability described in our study is sufficient to unequivocally distinguish the three species of the C. parapsilosis complex. We were able to validate a real-time PCR assay using mtdna as template. This new identification method allows the C. parapsilosis species complex to be identified quickly and accurately and saves time when compared with conventional sequencing, which has been considered the gold standard for yeast identification. In addition, this assay provides a useful tool for epidemiological and clinical studies of these emergent species Acknowledgments This work was supported in part by the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Brazil (grant 2007/ ), and the Conselho Nacional de Pesquisas Científicas e Tecnológicas (CNPq), Brazil (grant /2010-4). A.C.R.S. received a master fellowship from FAPESP 12

13 (2010/ ). R.C.F. and F.C.B. received a postdoctoral fellowship from FAPESP (grants 2009/ and 2010/ ). S.S.G. received a postdoctoral fellowship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazil (PNPD / ). A. L. C received grants from FAPESP and CNPq. M.R.S.B. received grants from FAPESP, CNPq, and the International Program of the Howard Hughes Medical Institute. We thank Dr. Quindós for sending strains for blind testing. 284 References Almirante, B., D. Rodriguez, B. J. Park, M. Cuenca-Estrella, A. M. Planes, M. Almela, J. Mensa, F. Sanchez, J. Ayats, M. Gimenez, P. Saballs, S. K. Fridkin, J. Morgan, J. L. Rodriguez-Tudela, D. W. Warnock, A. Pahissa, and G. Barcelona Candidemia Project Study Epidemiology and predictors of mortality in cases of Candida bloodstream infection: results from population-based surveillance, Barcelona, Spain, from 2002 to J Clin Microbiol 43: Azevedo, A. C., F. C. Bizerra, D. A. da Matta, L. P. de Almeida, R. Rosas, and A. L. Colombo In vitro susceptibility of a large collection of Candida Strains against fluconazole and voriconazole by using the CLSI disk diffusion assay. Mycopathologia 171: Bizerra, F. C., A. S. Melo, E. Katchburian, E. Freymuller, A. H. Straus, H. K. Takahashi, and A. L. Colombo Changes in cell wall synthesis and ultrastructure during paradoxical growth effect of caspofungin on four different Candida species. Antimicrob Agents Chemother 55: Canton, E., J. Peman, G. Quindos, E. Eraso, I. Miranda-Zapico, M. Alvarez, P. Merino, I. Campos-Herrero, F. Marco, E. G. de la Pedrosa, G. Yague, R. Guna, 13

14 C. Rubio, C. Miranda, C. Pazos, D. Velasco, and F. S. Group Prospective multicenter study of the epidemiology, molecular identification, and antifungal susceptibility of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis isolated from patients with candidemia. Antimicrob Agents Chemother 55: Clark-Walker, G. D Contrasting mutation rates in mitochondrial and nuclear genes of yeasts versus mammals. Curr Genet 20: Colombo, A. L., M. Nucci, B. J. Park, S. A. Nouer, B. Arthington-Skaggs, D. A. da Matta, D. Warnock, J. Morgan, and S. Brazilian Network Candidemia Epidemiology of candidemia in Brazil: a nationwide sentinel surveillance of candidemia in eleven medical centers. J Clin Microbiol 44: Darling, A. C., B. Mau, F. R. Blattner, and N. T. Perna Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res 14: Defontaine, A., F. M. Lecocq, and J. N. Hallet A rapid miniprep method for the preparation of yeast mitochondrial DNA. Nucleic Acids Res 19: Ewing, B., L. Hillier, M. C. Wendl, and P. Green Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res 8: Gacser, A., W. Schafer, J. S. Nosanchuk, S. Salomon, and J. D. Nosanchuk Virulence of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis in reconstituted human tissue models. Fungal Genet Biol 44: Garcia-Effron, G., E. Canton, J. Peman, A. Dilger, E. Roma, and D. S. Perlin Assessment of two new molecular methods for identification of Candida parapsilosis sensu lato species. J Clin Microbiol 49:

15 Ge, Y. P., G. X. Lu, Y. N. Shen, and W. D. Liu In vitro evaluation of phospholipase, proteinase, and esterase activities of Candida parapsilosis and Candida metapsilosis. Mycopathologia 172: Goncalves, S. S., C. S. Amorim, M. Nucci, A. C. Padovan, M. R. Briones, A. S. Melo, and A. L. Colombo Prevalence rates and antifungal susceptibility profiles of the Candida parapsilosis species complex: results from a nationwide surveillance of candidaemia in Brazil. Clin Microbiol Infect 16: Goncalves, S. S., A. M. Stchigel, J. F. Cano, P. C. Godoy-Martinez, A. L. Colombo, and J. Guarro Aspergillus novoparasiticus: a new clinical species of the section Flavi. Med Mycol 50: Gordon, D., C. Abajian, and P. Green Consed: a graphical tool for sequence finishing. Genome Res 8: Gouy, M., S. Guindon, and O. Gascuel SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol 27: Hays, C., C. Duhamel, V. Cattoir, and J. Bonhomme Rapid and accurate identification of species belonging to the Candida parapsilosis complex by real-time PCR and melting curve analysis. J Med Microbiol 60: Horn, D. L., D. Neofytos, E. J. Anaissie, J. A. Fishman, W. J. Steinbach, A. J. Olyaei, K. A. Marr, M. A. Pfaller, C. H. Chang, and K. M. Webster Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin Infect Dis 48: Jain, P., Z. K. Khan, E. Bhattacharya, and S. A. Ranade Variation in random amplified polymorphic DNA (RAPD) profiles specific to fluconazole- 15

16 resistant and -sensitive strains of Candida albicans. Diagn Microbiol Infect Dis 41: Lehmann, P. F., D. Lin, and B. A. Lasker Genotypic identification and characterization of species and strains within the genus Candida by using random amplified polymorphic DNA. J Clin Microbiol 30: Lockhart, S. R., S. A. Messer, M. A. Pfaller, and D. J. Diekema Lodderomyces elongisporus masquerading as Candida parapsilosis as a cause of bloodstream infections. J Clin Microbiol 46: Melo, A. S., F. C. Bizerra, E. Freymuller, B. A. Arthington-Skaggs, and A. L. Colombo Biofilm production and evaluation of antifungal susceptibility amongst clinical Candida spp. isolates, including strains of the Candida parapsilosis complex. Med Mycol 49: Melo, A. S., L. P. de Almeida, A. L. Colombo, and M. R. Briones Evolutionary distances and identification of Candida species in clinical isolates by randomly amplified polymorphic DNA (RAPD). Mycopathologia 142: Miranda-Zapico, I., E. Eraso, J. L. Hernandez-Almaraz, L. M. Lopez-Soria, A. J. Carrillo-Munoz, J. M. Hernandez-Molina, and G. Quindos Prevalence and antifungal susceptibility patterns of new cryptic species inside the species complexes Candida parapsilosis and Candida glabrata among blood isolates from a Spanish tertiary hospital. J Antimicrob Chemother 66: Nishikaku, A. S., A. S. A. Melo, and A. L. Colombo Geographic Trends in Invasive Candidiasis. Current Fungal Infection Reports 4: Pfaller, M. A., and D. J. Diekema Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 20:

17 Power, E. G RAPD typing in microbiology--a technical review. J Hosp Infect 34: Sanson, G. F., and M. R. Briones Typing of Candida glabrata in clinical isolates by comparative sequence analysis of the cytochrome c oxidase subunit 2 gene distinguishes two clusters of strains associated with geographical sequence polymorphisms. J Clin Microbiol 38: Santos, C., N. Lima, P. Sampaio, and C. Pais Matrix-assisted laser desorption/ionization time-of-flight intact cell mass spectrometry to detect emerging pathogenic Candida species. Diagn Microbiol Infect Dis 71: Tavanti, A., A. D. Davidson, N. A. Gow, M. C. Maiden, and F. C. Odds Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J Clin Microbiol 43: Tavanti, A., L. A. Hensgens, E. Ghelardi, M. Campa, and S. Senesi Genotyping of Candida orthopsilosis clinical isolates by amplification fragment length polymorphism reveals genetic diversity among independent isolates and strain maintenance within patients. J Clin Microbiol 45: White, T. J., T. D. Bruns, S. B. Lee, and J. W. Taylor Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. 33. Yokoyama, K., S. K. Biswas, M. Miyaji, and K. Nishimura Identification and phylogenetic relationship of the most common pathogenic Candida species inferred from mitochondrial cytochrome b gene sequences. J Clin Microbiol 38:

18 398 Figure Legend Figure 1: Local alignment of the NADH5 gene. Primer regions are shown in boxes (forward primer from 223 to 246 bp; reverse from 284 to 307 bp), and the probe region (from 251 to 276 bp) is in the dashed box. The SNP between the C. orthopsilosis strains located in the probe region is at position 270 bp. Cp: C. parapsilosis (sensu stricto); Cm: C. metapsilosis and Co: C. orthopsilosis. 18

19

20 TABLE 1. Oligonucleotide primers and probes sequences used in this study. Oligonucleotide* Sequence 5 to 3 Modification Purpose 5 end 3 end ITS1** TCCGTAGGTGAACCTGCGG none none ITS sequencing ITS4** GCATATCAATAAGCGGA none none ITS sequencing NADH5 F GTGCTGGTTCTGTTATTCATAG none none NADH5 sequencing NADH5 R GCCAGAGTCTACCATTAACCTAC none none NADH5 sequencing RT - NADH5 F CATATACATGAAAATATACGTATG none none Real -Time PCR RT - NADH5 R CATTATCTCTATTAAATCCAATAA none none Real -Time PCR Cp NADH5 TTCCTATGATTATATTAGTTATCTAT FAM MGB C. parapsilosis NADH5 probe Co NADH5 TACCTATGGTAATATTAGTAATATAT VIC MGB C. orthopsilosis NADH5 probe Cm NADH5 TACCTATGGTTATTTTAGTAATTTAT NED MGB C. metapsilosis NADH5 probe *The letters F and R in the primer names describe the orientation of the primer 5 to 3. F: Forward (sense) or R: Reverse (antisense). ** White et al. (17). 1

21 TABLE 2. Comparison of the identification of C. parapsilosis species complex isolates by ITS sequencing and the Real-Time PCR assay. Species identified by ITS sequencing (no isolates tested Strains (nº tested) Species Identified by Real-Time PCR assay (No. of isolates tested) % agreement* C. parapsilosis C. orthopsilosis C. metapsilosis (sensu stricto) Reference strains (4) 100% C. parapsilosis (sensu stricto) (2) C. orthopsilosis (1) C. metapsilosis (1) Clinical isolates (66) 100% C. parapsilosis (sensu stricto) (27) C. orthopsilosis (34) C. metapsilosis (5) Blinded strains (30) 100% C. parapsilosis (sensu stricto) (21) C. orthopsilosis (5) C. metapsilosis (4) Control strains (5) C. albicans (1) C. tropicalis (1) C. krusei (1) C. glabrata (1) C. lusitaniae (1) L. elongisporus (1) 0 0 *Agreement analysis was performed between the Real-Time PCR assay described in the current study and the gold standard technique (ITS sequencing) **N/A: not applicable N/A**