An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes Catalog # pvitro2-gfplacz

Size: px
Start display at page:

Download "An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes Catalog # pvitro2-gfplacz"

Transcription

1 pvitro2-hygro-gfp/lacz An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes Catalog # pvitro2-gfplacz For research use only Version # 04K05-SV PRODUCT INFORMATION Contents: - 20 µg of pvitro2-hygro-gfp/lacz provided as lyophilized DNA - 4 pouches of E. coli FastMedia Hygro Storage and Stability: - Product is shipped at room temperature. - Lyophilized DNA is stable for 12 months when stored at - 20 C - Resuspended DNA is stable for 12 months at -20 C. Avoid repeated freeze-thaw cycles. - Store E. coli FastMedia Hygro pouches at room temperature. FastMedia is stable 18 months when stored properly. Quality control: - Plasmid construct has been confirmed by restriction analysis and sequencing. - Plasmid DNA was purified by ion exchange chromatography and lyophilized. GENERAL PRODUCT USE pvitro is a new family of vectors with improved features. pvitro1 and pvitro2 allow the co-expression of two or more genes from two diff e r e n t transcription units. pvitro plasmids can be stably transfected in mammalian cells and yield high levels of expression. pvitro2-hygro-gfp/lacz contains the reporter genes GFP and LacZ and can be used as a control vector. pvitro2-hygro-gfp/lacz also can be used for cloning of open reading frames (ORF). Both reporter genes are flanked by unique sites (BspH I/Avr II for GFP and Nco I/Nhe I for LacZ) that allow for convenient cloning of ORF s which can be selected from InvivoGen s extensive porf and pblast lists. PLASMID FEATURES hferh and hferl composite promoters: Ferritin is a 24 subunit protein composed of two subunit types, termed H (heavy) and L (light), which perform complementary functions in the protein. Ferritin is ubiquitously expressed. Its synthesis is highly regulated by the iron status of the cell. The iron regulation is achieved at the translational level through the interaction between the iron-responsive element (IRE), located in the 5 untranslated region (5 UTR) of the ferritin mrnas, and the iron regulatory protein 1. To eliminate the iron regulation of the ferritin promoters, the 5 UTR of FerH and FerL have been replaced by the 5 UTR of the mouse and chimpanzee elongation factor 1 (EF1) genes, respectively. SV40 enhancer which is comprised of a 72-base-pair repeat allows the enhancement of gene expression in a large host range. The enhancement varies from 2-fold in non-permissive cells to 20-fold in permissive cells. Furthermore, the SV40 enhancer is able to direct nuclear localization of plasmids 2. CMV enhancer: The major immediate early enhancer of the human cytomegalovirus (HCMV), located between nucleotides -118 and -524, is composed of unique and repeated sequence motifs. The HCMV enhancer can substitute for the 72-bp repeats of SV40 and is severalfold more active than the SV40 enhancer 3. pmb1 ori: A minimal E. coli origin of replication to limit vector size, but with the same activity as the longer Ori. GFP gene: This red-shifted variant of the jellyfish GFP gene encodes a green fluorescent protein that absorbs blue light (major peak at 480 nm) and emits green light (major peak at 505 nm). FMDV IRES: The internal ribosome entry site of the Foot and Mouth Disease Virus enables the translation of two open reading frames from one mrna with high levels of expression 4. EM7 is a bacterial promoter that enables the constitutive expression of the antibiotic resistance gene in E. coli. hph gene: hph confers resistance to Hygromycin B both in E. coli and mammalin cells. In bacteria, hph is expressed from the constitutive E. coli EM7 p r o- m o t e r. In mammalian cells, h p h is transcribed from the human FerH c o m- posite promoter as a polycistronic mrna and translated via the FMDV I R E S. EF1 pan is a strong polyadenylation signal. InvivoGen uses a s e q u e n c e starting after the stop codon of the EF1 cdna and finishing after a bent structure rich in GT. LacZ gene: T h e E. coli lacz gene codes for the enzyme β-galactosidase which catalyzes the hydrolysis of the substrate X-Gal to produce a blue color that is easily visualized under a microscope. SV40 pan: the Simian Virus 40 late polyadenylation signal enables efficient cleavage and polyadenylation reactions resulting in high levels of steady-state mrna. The efficiency of this signal was first described by Carswell et al. 5 METHODS Plasmid resuspension: Quickly spin the tube containing the lyophilized plasmid to pellet the DNA. To obtain a plasmid solution at 1 µg/µl, resuspend the DNA in 20 µl of sterile H 2 O. Store resuspended plasmid at -20 C. Selection of bacteria with E. coli FastMedia Hygro: E. coli F a s t M e d i a Hygro is a n e w, fast and convenient way to prepare liquid and solid media for bacterial culture by using only a microwave. E. coli FastMedia Hygro is a TB (liquid) or LB (solid) based medium with hygromycin B, and contains stabilizers. E. coli FastMedia Hygro can be ordered separately (catalog code # fas-hg-l, fas-hg-s). Method: 1- Pour the contents of a pouch into a clean borosilicate glass bottle or flask. 2- Add 200 ml of distilled water to the flask 3- Heat in a microwave on MEDIUM power setting (about 400Watts), until bubbles start appearing (approximately 3 minutes). Do not heat a closed container. Do not autoclave FastMedia. 4- Swirl gently to mix the preparation. Be careful, the bottle and media are hot, use heatproof pads or gloves and care when handling. 5- Reheat the media for 30 seconds and gently swirl again. Repeat as necessary to completely dissolve the powder into solution. But be careful to avoid overboiling and volume loss. 6- Let agar medium cool to 45 C before pouring plates. Let liquid media cool to 37 C before seeding bacteria. Note: Do not reheat solidified FastMedia as the antibiotic will be permanently destroyed by the procedure. References: 1. Eisenstein RS. and Munro HN Translational regulation of ferritin synthesis by iron. Enzyme 44(1-4): Dean DA. et al Sequence requirements for plasmid nuclear import. Exp. Cell. Res. 253: Boshart M. et al A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 141(2): Ramesh N et al High-titer bicistronic retroviral vectors employing foot-and-mouth disease virus internal ribosome entry site. Nucleic Acids Res. 24(14): Carswell S., and Alwine JC Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences. Mol. Cell Biol. 10: TECHNICAL SUPPORT Toll free (US): Outside US: (+1) info@invivogen.com Website: Sorrento Valley Blvd. Suite A San Diego, CA USA

2 HindIII (679) BglII (1039) HindIII (8278) EM7 hph EF1 pan CMV enh hferl prom chef1 5'UTR XhoI (1438) NcoI (1673) AvrII (7874) FMDV IRES GFP pvitro2-gfp/lacz (10034 bp) LacZ BspHI (7154) mef1 5'UTR hferh prom SV40 enh HindIII (6153) pmb1 ori SV40 pan NotI (6000) PacI (5718) PacI (4978) NheI (4738) 250

3 CCTGCAGGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAA CGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCC TATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCATGATGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATG GGAGTTTGTTTTGACTAGTCAGGGCCCCAACCCCCCCAAGCCCCCATTTCACAACACGCTGGCGCTACAGGCGCGTGACTTCCCCTTGCTTTGGGGCGGG GGGCTGAGACTCCTATGTGCTCCGGATTGGTCAGGCACGGCCTTCGGCCCCGCCTCCTGCCACCGCAGATTGGCCGCTAGGCCTCCCCGAGCGCCCTGCC HindIII (679) TCCGAGGGCCGGCGCACCATAAAAGAAGCCGCCCTAGCCACGTCCCCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCAAGCTTGCCGCCAGAACACAGg taagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattc ttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcg ctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacg BglII (1039) ctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtccc agcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgc gccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagc tcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactcca XhoI (1438) cggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttcc ccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattc NcoI (1673) 1601 tcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaaaactacccctaaaagccaccatggaccctgttgtgctgcaaaggag 1 MetAspProValValLeuGlnArgAr 1701 AGACTGGGAGAACCCTGGAGTGACCCAGCTCAACAGACTGGCTGCCCACCCTCCCTTTGCCTCTTGGAGGAACTCTGAGGAAGCCAGGACAGACAGGCCC 9 gasptrpgluasnproglyvalthrglnleuasnargleualaalahisproprophealasertrpargasnsergluglualaargthraspargpro 1801 AGCCAGCAGCTCAGGTCTCTCAATGGAGAGTGGAGGTTTGCCTGGTTCCCTGCCCCTGAAGCTGTGCCTGAGTCTTGGCTGGAGTGTGACCTCCCAGAGG 43 SerGlnGlnLeuArgSerLeuAsnGlyGluTrpArgPheAlaTrpPheProAlaProGluAlaValProGluSerTrpLeuGluCysAspLeuProGluA 1901 CTGACACTGTTGTGGTGCCCAGCAACTGGCAGATGCATGGCTATGATGCCCCCATCTACACCAATGTCACCTACCCCATCACTGTGAACCCCCCTTTTGT 76 laaspthrvalvalvalproserasntrpglnmethisglytyraspalaproi letyrthrasnvalthrtyrproi lethrvalasnpropropheva 2001 GCCCACTGAGAACCCCACTGGCTGCTACAGCCTGACCTTCAATGTTGATGAGAGCTGGCTGCAAGAAGGCCAGACCAGGATCATCTTTGATGGAGTCAAC 109 lprothrgluasnprothrglycystyrserleuthrpheasnvalaspglusertrpleuglngluglyglnthrargi lei lepheaspglyvalasn 2101 TCTGCCTTCCACCTCTGGTGCAATGGCAGGTGGGTTGGCTATGGCCAAGACAGCAGGCTGCCCTCTGAGTTTGACCTCTCTGCCTTCCTCAGAGCTGGAG 143 SerAlaPheHisLeuTrpCysAsnGlyArgTrpValGlyTyrGlyGlnAspSerArgLeuProSerGluPheAspLeuSerAlaPheLeuArgAlaGlyG 2201 AGAACAGGCTGGCTGTCATGGTGCTCAGGTGGTCTGATGGCAGCTACCTGGAAGACCAAGACATGTGGAGGATGTCTGGCATCTTCAGGGATGTGAGCCT 176 luasnargleualavalmetvalleuargtrpseraspglysertyrleugluaspglnaspmettrpargmetserglyi lepheargaspvalserle 2301 GCTGCACAAGCCCACCACCCAGATTTCTGACTTCCATGTTGCCACCAGGTTCAATGATGACTTCAGCAGAGCTGTGCTGGAGGCTGAGGTGCAGATGTGT 209 uleuhislysprothrthrglni leseraspphehisvalalathrargpheasnaspasppheserargalavalleuglualagluvalglnmetcys 2401 GGAGAACTCAGAGACTACCTGAGAGTCACAGTGAGCCTCTGGCAAGGTGAGACCCAGGTGGCCTCTGGCACAGCCCCCTTTGGAGGAGAGATCATTGATG 243 GlyGluLeuArgAspTyrLeuArgValThrValSerLeuTrpGlnGlyGluThrGlnValAlaSerGlyThrAlaProPheGlyGlyGluI lei leaspg 2501 AGAGAGGAGGCTATGCTGACAGAGTCACCCTGAGGCTCAATGTGGAGAACCCCAAGCTGTGGTCTGCTGAGATCCCCAACCTCTACAGGGCTGTTGTGGA 276 luargglyglytyralaaspargvalthrleuargleuasnvalgluasnprolysleutrpseralaglui leproasnleutyrargalavalvalgl 2601 GCTGCACACTGCTGATGGCACCCTGATTGAAGCTGAAGCCTGTGATGTTGGATTCAGAGAAGTCAGGATTGAGAATGGCCTGCTGCTGCTCAATGGCAAG 309 uleuhisthralaaspglythrleui leglualaglualacysaspvalglyphearggluvalargi legluasnglyleuleuleuleuasnglylys 2701 CCTCTGCTCATCAGGGGAGTCAACAGGCATGAGCACCACCCTCTGCATGGACAAGTGATGGATGAACAGACAATGGTGCAAGATATCCTGCTAATGAAGC 343 ProLeuLeuI leargglyvalasnarghisgluhishisproleuhisglyglnvalmetaspgluglnthrmetvalglnaspi leleuleumetlysg 2801 AGAACAACTTCAATGCTGTCAGGTGCTCTCACTACCCCAACCACCCTCTCTGGTACACCCTGTGTGACAGGTATGGCCTGTATGTTGTTGATGAAGCCAA 376 lnasnasnpheasnalavalargcysserhistyrproasnhisproleutrptyrthrleucysaspargtyrglyleutyrvalvalaspglualaas 2901 CATTGAGACACATGGCATGGTGCCCATGAACAGGCTCACAGATGACCCCAGGTGGCTGCCTGCCATGTCTGAGAGAGTGACCAGGATGGTGCAGAGAGAC 409 ni legluthrhisglymetvalprometasnargleuthraspaspproargtrpleuproalametsergluargvalthrargmetvalglnargasp 3001 AGGAACCACCCCTCTGTGATCATCTGGTCTCTGGGCAATGAGTCTGGACATGGAGCCAACCATGATGCTCTCTACAGGTGGATCAAGTCTGTTGACCCCA 443 ArgAsnHisProSerVal I lei letrpserleuglyasngluserglyhisglyalaasnhisaspalaleutyrargtrpi lelysservalasppros 3101 GCAGACCTGTGCAGTATGAAGGAGGTGGAGCAGACACCACAGCCACAGACATCATCTGCCCCATGTATGCCAGGGTTGATGAGGACCAGCCCTTCCCTGC 476 erargprovalglntyrgluglyglyglyalaaspthrthralathraspi lei lecyspromettyralaargvalaspgluaspglnpropheproal 3201 TGTGCCCAAGTGGAGCATCAAGAAGTGGCTCTCTCTGCCTGGAGAGACCAGACCTCTGATCCTGTGTGAATATGCACATGCAATGGGCAACTCTCTGGGA 509 avalprolystrpseri lelyslystrpleuserleuproglygluthrargproleui leleucysglutyralahisalametglyasnserleugly 3301 GGCTTTGCCAAGTACTGGCAAGCCTTCAGACAGTACCCCAGGCTGCAAGGAGGATTTGTGTGGGACTGGGTGGACCAATCTCTCATCAAGTATGATGAGA 543 GlyPheAlaLysTyrTrpGlnAlaPheArgGlnTyrProArgLeuGlnGlyGlyPheValTrpAspTrpValAspGlnSerLeuI lelystyraspglua 3401 ATGGCAACCCCTGGTCTGCCTATGGAGGAGACTTTGGTGACACCCCCAATGACAGGCAGTTCTGCATGAATGGCCTGGTCTTTGCAGACAGGACCCCTCA 576 snglyasnprotrpseralatyrglyglyasppheglyaspthrproasnaspargglnphecysmetasnglyleuvalphealaaspargthrprohi 3501 CCCTGCCCTCACAGAGGCCAAGCACCAGCAACAGTTCTTCCAGTTCAGGCTGTCTGGACAGACCATTGAGGTGACATCTGAGTACCTCTTCAGGCACTCT 609 sproalaleuthrglualalyshisglnglnglnphepheglnpheargleuserglyglnthri legluvalthrserglutyrleuphearghisser

4 3601 GACAATGAGCTCCTGCACTGGATGGTGGCCCTGGATGGCAAGCCTCTGGCTTCTGGTGAGGTGCCTCTGGATGTGGCCCCTCAAGGAAAGCAGCTGATTG 643 AspAsnGluLeuLeuHisTrpMetValAlaLeuAspGlyLysProLeuAlaSerGlyGluValProLeuAspValAlaProGlnGlyLysGlnLeuI leg 3701 AACTGCCTGAGCTGCCTCAGCCAGAGTCTGCTGGACAACTGTGGCTAACAGTGAGGGTGGTTCAGCCCAATGCAACAGCTTGGTCTGAGGCAGGCCACAT 676 luleuprogluleuproglnprogluseralaglyglnleutrpleuthrvalargvalvalglnproasnalathralatrpserglualaglyhisi l 3801 CTCTGCATGGCAGCAGTGGAGGCTGGCTGAGAACCTCTCTGTGACCCTGCCTGCTGCCTCTCATGCCATCCCTCACCTGACAACATCTGAAATGGACTTC 709 eseralatrpglnglntrpargleualagluasnleuservalthrleuproalaalaserhisalai leprohisleuthrthrserglumetaspphe 3901 TGCATTGAGCTGGGCAACAAGAGATGGCAGTTCAACAGGCAGTCTGGCTTCCTGTCTCAGATGTGGATTGGAGACAAGAAGCAGCTCCTCACCCCTCTCA 743 CysI legluleuglyasnlysargtrpglnpheasnargglnserglypheleuserglnmettrpi leglyasplyslysglnleuleuthrproleua 4001 GGGACCAATTCACCAGGGCTCCTCTGGACAATGACATTGGAGTGTCTGAGGCCACCAGGATTGACCCAAATGCTTGGGTGGAGAGGTGGAAGGCTGCTGG 776 rgaspglnphethrargalaproleuaspasnaspi leglyvalserglualathrargi leaspproasnalatrpvalgluargtrplysalaalagl 4101 ACACTACCAGGCTGAGGCTGCCCTGCTCCAGTGCACAGCAGACACCCTGGCTGATGCTGTTCTGATCACCACAGCCCATGCTTGGCAGCACCAAGGCAAG 809 yhistyrglnalaglualaalaleuleuglncysthralaaspthrleualaaspalavalleui lethrthralahisalatrpglnhisglnglylys 4201 ACCCTGTTCATCAGCAGAAAGACCTACAGGATTGATGGCTCTGGACAGATGGCAATCACAGTGGATGTGGAGGTTGCCTCTGACACACCTCACCCTGCAA 843 ThrLeuPheI leserarglysthrtyrargi leaspglyserglyglnmetalai lethrvalaspvalgluvalalaseraspthrprohisproalaa 4301 GGATTGGCCTGAACTGTCAACTGGCACAGGTGGCTGAGAGGGTGAACTGGCTGGGCTTAGGCCCTCAGGAGAACTACCCTGACAGGCTGACAGCTGCCTG 876 rgi leglyleuasncysglnleualaglnvalalagluargvalasntrpleuglyleuglyproglngluasntyrproaspargleuthralaalacy 4401 CTTTGACAGGTGGGACCTGCCTCTGTCTGACATGTACACCCCTTATGTGTTCCCTTCTGAGAATGGCCTGAGGTGTGGCACCAGGGAGCTGAACTATGGT 909 spheaspargtrpaspleuproleuseraspmettyrthrprotyrvalpheprosergluasnglyleuargcysglythrarggluleuasntyrgly 4501 CCTCACCAGTGGAGGGGAGACTTCCAGTTCAACATCTCCAGGTACTCTCAGCAACAGCTCATGGAAACCTCTCACAGGCACCTGCTCCATGCAGAGGAGG 943 ProHisGlnTrpArgGlyAspPheGlnPheAsnI leserargtyrserglnglnglnleumetgluthrserhisarghisleuleuhisalagluglug 4601 GAACCTGGCTGAACATTGATGGCTTCCACATGGGCATTGGAGGAGATGACTCTTGGTCTCCTTCTGTGTCTGCTGAGTTCCAGTTATCTGCTGGCAGGTA 976 lythrtrpleuasni leaspglyphehismetglyi leglyglyaspaspsertrpserproservalseralaglupheglnleuseralaglyargty NheI (4738) 4701 CCACTATCAGCTGGTGTGGTGCCAGAAGTAAACCTGAGCTAGCTGGCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAG 1009 rhistyrglnleuvaltrpcysglnlys 4801 TGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATT PacI (4978) TTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGAAATGTTAATTAACTAGCCATGACCAAA ATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCT TGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGAT ACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTG GCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCA CACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAG GTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTC TGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGC PacI (5718) CTTTTGCTCACATGTTCTTAATTAACCTGCAGGGCCTGAAATAACCTCTGAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCTGAAAGAACCAGCTGTGG AATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGT NotI (6 CCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCACTAGTTCCGCCAGAGCGCGCGAGGGCCTCCAG CGGCCGCCCCTCCCCCACAGCAGGGGCGGGGTCCCGCGCCCACCGGAAGGAGCGGGCTCGGGGCGGGCGGCGCTGATTGGCCGGGGCGGGCCTGACGCCG HindIII (6153) ACGCGGCTATAAGAGACCACAAGCGACCCGCAGGGCCAGACGTTCTTCGCCGAAGCTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGG CCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGA GGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCG CACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCC GGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGG GCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGT TGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAAT GGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTC CTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGG AGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGT BspHI (7154) ATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAATCATGAGCAAGGGAGAAGAACTCTTTACTGGTGTTGTCCCAATTCTG 1 MetSerLysGlyGluGluLeuPheThrGlyValValProI leleu

5 7201 GTTGAGCTGGATGGTGATGTGAATGGCCACAAATTCTCTGTGTCTGGTGAAGGTGAAGGAGATGCAACTTATGGAAAGCTGACTCTGAAGTTCATTTGTA 16 ValGluLeuAspGlyAspValAsnGlyHisLysPheSerValSerGlyGluGlyGluGlyAspAlaThrTyrGlyLysLeuThrLeuLysPheI lecyst 7301 CAACAGGAAAGCTGCCAGTGCCTTGGCCAACTCTGGTGACCACCCTGACTTATGGTGTTCAATGTTTCAGCAGGTACCCTGACCACATGAAGCAGCATGA 49 hrthrglylysleuprovalprotrpprothrleuvalthrthrleuthrtyrglyvalglncyspheserargtyrproasphismetlysglnhisas 7401 CTTCTTTAAATCTGCAATGCCAGAAGGTTATGTTCAGGAGAGGACAATCTTCTTTAAGGATGATGGAAATTATAAGACAAGGGCAGAAGTGAAGTTTGAA 82 pphephelysseralametprogluglytyrvalglngluargthri lephephelysaspaspglyasntyrlysthrargalagluvallyspheglu 7501 GGTGATACACTGGTTAACAGAATTGAGCTGAAAGGCATTGATTTTAAGGAAGATGGAAACATTCTGGGTCACAAGCTGGAGTACAACTATAATTCTCACA 116 GlyAspThrLeuValAsnArgI legluleulysglyi leaspphelysgluaspglyasni leleuglyhislysleuglutyrasntyrasnserhisa 7601 ATGTTTACATTATGGCAGATAAGCAGAAGAATGGAATTAAGGTTAATTTCAAGATTAGACACAACATTGAGGATGGATCTGTCCAACTGGCAGACCATTA 149 snvaltyri lemetalaasplysglnlysasnglyi lelysvalasnphelysi learghisasni legluaspglyservalglnleualaasphisty 7701 CCAGCAGAACACCCCTATTGGTGATGGCCCAGTTCTCCTCCCAGATAATCACTATCTCCGCACTCAATCTGCTCTGTCCAAAGACCCTAATGAGAAAAGA 182 rglnglnasnthrproi leglyaspglyprovalleuleuproaspasnhistyrleuargthrglnseralaleuserlysaspproasnglulysarg AvrII (7874) 7801 GACCACATGGTCCTCCTGGAGTTTGTGACAGCAGCAGGAATTACTCTGGGAATGGATGAGCTGTACAAGTAAACCTAGGAGCAGGTTTCCCCAATGACAC 216 AspHisMetValLeuLeuGluPheValThrAlaAlaGlyI lethrleuglymetaspgluleutyrlys 7901 AAAACGTGCAACTTGAAACTCCGCCTGGTCTTTCCAGGTCTAGAGGGGTAACACTTTGTACTGCGTTTGGCTCCACGCTCGATCCACTGGCGAGTGTTAG TAACAGCACTGTTGCTTCGTAGCGGAGCATGACGGCCGTGGGAACTCCTCCTTGGTAACAAGGACCCACGGGGCCAAAAGCCACGCCCACACGGGCCCGT CATGTGTGCAACCCCAGCACGGCGACTTTACTGCGAAACCCACTTTAAAGTGACATTGAAACTGGTACCCACACACTGGTGACAGGCTAAGGATGCCCTT HindIII (8278) CAGGTACCCCGAGGTAACACGCGACACTCGGGATCTGAGAAGGGGACTGGGGCTTCTATAAAAGCGCTCGGTTTAAAAAGCTTCTATGCCTGAATAGGTG ACCGGAGGTCGGCACCTTTCCTTTGCAATTACTGACCCTATGAATACAACTGACTGTTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATA CGACTCACTATAGGAGGGCCACCATGAAGAAACCTGAACTGACAGCAACTTCTGTTGAGAAGTTTCTCATTGAAAAATTTGATTCTGTTTCTGATCTCAT 1 MetLysLysProGluLeuThrAlaThrSerValGluLysPheLeuI leglulyspheaspservalseraspleume GCAGCTGTCTGAAGGTGAAGAAAGCAGAGCCTTTTCTTTTGATGTTGGAGGAAGAGGTTATGTTCTGAGGGTCAATTCTTGTGCTGATGGTTTTTACAAA tglnleusergluglyglugluserargalapheserpheaspvalglyglyargglytyrvalleuargvalasnsercysalaaspglyphetyrlys GACAGATATGTTTACAGACACTTTGCCTCTGCTGCTCTGCCAATTCCAGAAGTTCTGGACATTGGAGAATTTTCTGAATCTCTCACCTACTGCATCAGCA AspArgTyrValTyrArgHisPheAlaSerAlaAlaLeuProI leprogluvalleuaspi leglygluphesergluserleuthrtyrcysi lesera GAAGAGCACAAGGAGTCACTCTCCAGGATCTCCCTGAAACTGAGCTGCCAGCTGTTCTGCAACCTGTTGCTGAAGCAATGGATGCCATTGCAGCAGCTGA rgargalaglnglyvalthrleuglnaspleuprogluthrgluleuproalavalleuglnprovalalaglualametaspalai lealaalaalaas TCTGAGCCAAACCTCTGGATTTGGTCCTTTTGGTCCCCAAGGCATTGGTCAGTACACCACTTGGAGGGATTTCATTTGTGCCATTGCTGATCCTCATGTC pleuserglnthrserglypheglypropheglyproglnglyi leglyglntyrthrthrtrpargaspphei lecysalai lealaaspprohisval TATCACTGGCAGACTGTGATGGATGACACAGTTTCTGCTTCTGTTGCTCAGGCACTGGATGAACTCATGCTGTGGGCAGAAGATTGTCCTGAAGTCAGAC TyrHisTrpGlnThrValMetAspAspThrValSerAlaSerValAlaGlnAlaLeuAspGluLeuMetLeuTrpAlaGluAspCysProGluValArgH ACCTGGTCCATGCTGATTTTGGAAGCAACAATGTTCTGACAGACAATGGCAGAATCACTGCAGTCATTGACTGGTCTGAAGCCATGTTTGGAGATTCTCA isleuvalhisalaasppheglyserasnasnvalleuthraspasnglyargi lethralaval I leasptrpserglualametpheglyaspsergl ATATGAGGTTGCCAACATTTTTTTTTGGAGACCTTGGCTGGCTTGCATGGAACAACAAACAAGATATTTTGAAAGAAGACACCCAGAACTGGCTGGTTCC ntyrgluvalalaasni lephephetrpargprotrpleualacysmetgluglnglnthrargtyrphegluargarghisprogluleualaglyser CCCAGACTGAGAGCCTACATGCTCAGAATTGGCCTGGACCAACTGTATCAATCTCTGGTTGATGGAAACTTTGATGATGCTGCTTGGGCACAAGGAAGAT ProArgLeuArgAlaTyrMetLeuArgI leglyleuaspglnleutyrglnserleuvalaspglyasnpheaspaspalaalatrpalaglnglyargc GTGATGCCATTGTGAGGTCTGGTGCTGGAACTGTTGGAAGAACTCAAATTGCAAGAAGGTCTGCTGCTGTTTGGACTGATGGATGTGTTGAAGTTCTGGC ysaspalai levalargserglyalaglythrvalglyargthrglni lealaargargseralaalavaltrpthraspglycysvalgluvalleual TGACTCTGGAAACAGGAGACCCTCCACAAGACCCAGAGCCAAGGAATGAATATTAGCTAGATTATCCCTAATACCTGCCACCCCACTCTTAATCAGTGGT aaspserglyasnargargproserthrargproargalalysglu GGAAGAACGGTCTCAGAACTGTTTGTTTCAATTGGCCATTTAAGTTTAGTAGTAAAAGACTGGTTAATGATAACAATGCATCGTAAAACCTTCAGAAGGA AAGGAGAATGTTTTGTGGACCACTTTGGTTTTCTTTTTTGCGTGTGGCAGTTTTAAGTTATTAGTTTTTAAAATCAGTACTTTTTAATGGAAACAACTTG ACCAAAAATTTGTCACAGAATTTTGAGACCCATTAAAAAAGTTAAATGAGAAACCTGTGTGTTCCTTTGGTCAACACCGAGACATTTAGGTGAAAGACAT CTAATTCTGGTTTTACGAATCTGGAAACTTCTTGAAAATGTAATTCTTGAGTTAACACTTCTGGGTGGAGAATAGGGTTGTTTTCCCCCCACATAATTGG AAGGGGAAGGAATATCATTTAAAGCTATGGGAGGGTTGCTTTGATTACAACACTGGAGAGAAATGCAGCATGTTGCTGATTGCCTGTCACTAAAACAGGC CAAAAACTGAGTCCTTGGGTTGCATAGAAAGCTG

pvivo1-gfp/lacz An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes in tumors Catalog # pvivo1-gfp-lacz

pvivo1-gfp/lacz An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes in tumors Catalog # pvivo1-gfp-lacz pvivo1-gfp/lacz An innovative multigenic plasmid for high levels of expression of the GFP and LacZ reporter genes in tumors Catalog # pvivo1-gfp-lacz For research use only Version # 12H31-MM PROduCT information

More information

pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT

pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT P R O D U C T I N F O R M AT I O N C o n t e n t s : - 20

More information

pvivo1-mcs A multigenic cloning plasmid for strong and sustained expression in tumors Catalog # pvivo1-mcs For research use only Version # 12H31-MM

pvivo1-mcs A multigenic cloning plasmid for strong and sustained expression in tumors Catalog # pvivo1-mcs For research use only Version # 12H31-MM pvivo1-mcs A multigenic cloning plasmid for strong and sustained expression in tumors Catalog # pvivo1-mcs For research use only Version # 12H31-MM PRoduCT InFoRMATIon Content: - 20 µg of pvivo1-mcs provided

More information

pvitro2-blasti-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-bmcs For research use only Version # 05C24-MT

pvitro2-blasti-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-bmcs For research use only Version # 05C24-MT pvitro2-blasti-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-bmcs For research use only Version # 05C24-MT PRODUCT INFORMATION Contents: - 20 µg of pvitro2-blasti-mcs

More information

STOP. Before using this product, please read the Limited Use License statement below:

STOP. Before using this product, please read the Limited Use License statement below: STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-hnphsi The purchase of the pdrive5lucia-hnphsi vector conveys

More information

pbroad2 Kit An optimized vector for mouse and rat transgenesis For research use only Version # 02F17-SV

pbroad2 Kit An optimized vector for mouse and rat transgenesis For research use only Version # 02F17-SV pbroad2 Kit An optimized vector for mouse and rat transgenesis Catalog # kbroad2 For research use only Version # 02F17-SV PRODUCT INFORMATION Content: - 20 µg of pbroad2-mcs provided as lyophilized DNA

More information

pduo-mcs A plasmid containing two multiple cloning sites and the blasticidin resistance gene Catalog # pduo-mcs For research use only

pduo-mcs A plasmid containing two multiple cloning sites and the blasticidin resistance gene Catalog # pduo-mcs For research use only pduo-mcs A plasmid containing two multiple cloning sites and the blasticidin resistance gene Catalog # pduo-mcs For research use only Version # 14C19-MM PRODUCT INFORMATION Content: - 20 mg of pduo-mcs

More information

pwhere An optimized vector for mouse and rat transgenesis Catalog # pwhere For research use only Version # 05B11SV

pwhere An optimized vector for mouse and rat transgenesis Catalog # pwhere For research use only Version # 05B11SV pwhere An optimized vector for mouse and rat transgenesis Catalog # pwhere For research use only Version # 05B11SV PRODUCT INFORMATION Content: pwhere is provided as 20 µg of lyophilized DNA. Storage and

More information

pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz

pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz For research use only Version # 03B04-MT PRODUCT INFORMATION Content: - 20 µg of pbroad3-lacz provided as lyophilized

More information

pfusen-hg1fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1

pfusen-hg1fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1 pfusen-hg1fc Plasmid designed for the fusion of an Fc domain to the N-terminus of a protein of interest Catalog # pfcn-hg1 For research use only Version # 13H28-JC-35 ProduCt information Content: - 20

More information

Plasmid for the expression of GFP-C-terminal tagged proteins. For research use only Version # 10K15-MM

Plasmid for the expression of GFP-C-terminal tagged proteins. For research use only Version # 10K15-MM pselect-cgfp-blasti Plasmid for the expression of GFP-C-terminal tagged proteins Catalog # psetb-cgfp For research use only Version # 10K15-MM ProduCt information Content: - 20 µg of pselect-cgfp-blasti

More information

pselect-cha-zeo Plasmid for the expression of HA-C-terminal tagged proteins

pselect-cha-zeo Plasmid for the expression of HA-C-terminal tagged proteins pselect-cha-zeo Plasmid for the expression of HA-C-terminal tagged proteins Catalog # psetz-cha For research use only Version # 10H09-MM ProduCt information Content: - 20 µg of pselect-cha-zeo plasmid

More information

pfusen-lucia-mg2afc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lcmg2a

pfusen-lucia-mg2afc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lcmg2a pfusen-lucia-mg2afc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lcmg2a For research use only Version # 13H30-JC-36 ProduCt information Content: - 20

More information

STOP. Before using this product, please read the Limited Use License statement below:

STOP. Before using this product, please read the Limited Use License statement below: STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-sv40-hferh-mef1 The purchase of the pdrive5lucia-sv40-hferh-mef1

More information

pfusen-lucia-hg1fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg1

pfusen-lucia-hg1fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg1 pfusen-lucia-hg1fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg1 For research use only Version # 13H30-JC-36 ProduCt information Content: - 20 µg

More information

pfusen-lucia-hg2fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg2

pfusen-lucia-hg2fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg2 pfusen-lucia-hg2fc Plasmid designed for Lucia::Fc fusion to the N-terminus of a protein of interest Catalog # pfcn-lchg2 For research use only Version # 13H30-JC-36 ProduCt information Content: - 20 µg

More information

pfuse-higg1e5-fc2 Plasmid containing a human engineered IgG1 Fc region

pfuse-higg1e5-fc2 Plasmid containing a human engineered IgG1 Fc region pfuse-higg1e5-fc2 Plasmid containing a human engineered IgG1 Fc region Catalog # pfc2-hg1e5 For research use only Version # 10E04-MM ProduCt information Content: - 20 µg of pfuse-higg1e5-fc2 (il2ss) plasmid

More information

pfuse-chig-hg4 Plasmid featuring the constant region of the human IgG4 heavy chain Catalog # pfuse-hchg4 For research use only Version # 12I25-MM

pfuse-chig-hg4 Plasmid featuring the constant region of the human IgG4 heavy chain Catalog # pfuse-hchg4 For research use only Version # 12I25-MM pfuse-chig-hg4 Plasmid featuring the constant region of the human IgG4 heavy chain Catalog # pfuse-hchg4 For research use only Version # 12I25-MM PRoDUCT InFoRMATIon Content: - 20 µg of pfuse-chig-hg4

More information

pfuse-chig-hg1 Plasmid featuring the constant region of the human IgG1 heavy chain Catalog # pfuse-hchg1 For research use only Version # 12I04-MM

pfuse-chig-hg1 Plasmid featuring the constant region of the human IgG1 heavy chain Catalog # pfuse-hchg1 For research use only Version # 12I04-MM pfuse-chig-hg1 Plasmid featuring the constant region of the human IgG1 heavy chain Catalog # pfuse-hchg1 For research use only Version # 12I04-MM PRoDUCT InFoRMATIon Content: - 20 µg of pfuse-chig-hg1

More information

Plasmid featuring the constant region of the canine IgG1 heavy chain. For research use only

Plasmid featuring the constant region of the canine IgG1 heavy chain. For research use only pfuse-chig-dg1 Plasmid featuring the constant region of the canine IgG1 heavy chain Catalog # pfuse-dchg1 For research use only Version # 16I22v40-JC PRODUCT INFORMATION Content: - 20 µg of pfuse-chig-dg1

More information

pfuse2ss-clig-hl2 Plasmid featuring the constant region of the human Ig lambda 2 light chain and the IL2 signal sequence Catalog # pfuse2ss-hcll2

pfuse2ss-clig-hl2 Plasmid featuring the constant region of the human Ig lambda 2 light chain and the IL2 signal sequence Catalog # pfuse2ss-hcll2 pfuse2ss-clig-hl2 Plasmid featuring the constant region of the human Ig lambda 2 light chain and the IL2 signal sequence Catalog # pfuse2ss-hcll2 For research use only Version # 13A14-MM-v30 PRoDUCT InFoRMATIon

More information

Plasmid featuring the constant region of the canine IgG2 heavy chain. For research use only

Plasmid featuring the constant region of the canine IgG2 heavy chain. For research use only pfuse-chig-dg2 Plasmid featuring the constant region of the canine IgG2 heavy chain Catalog # pfuse-dchg2 For research use only Version # 16I22v40-JC PRODUCT INFORMATION Content: - 20 µg of pfuse-chig-dg2

More information

Plasmid featuring the constant region of the human Ig kappa light chain and the IL2 signal sequence Catalog # pfuse2ss-hclk

Plasmid featuring the constant region of the human Ig kappa light chain and the IL2 signal sequence Catalog # pfuse2ss-hclk pfuse2ss-clig-hk Plasmid featuring the constant region of the human Ig kappa light chain and the IL2 signal sequence Catalog # pfuse2ss-hclk For research use only Version # 13G12-MM PRoDUCT InFoRMATIon

More information

Plasmid featuring the constant region of the rabbit immunoglobulin kappa 1 light chain. For research use only

Plasmid featuring the constant region of the rabbit immunoglobulin kappa 1 light chain. For research use only pfuse2-clig-rk1 Plasmid featuring the constant region of the rabbit immunoglobulin kappa 1 light chain Catalog # pfuse2-rclk1 For research use only Version # 16H10-MM PRODUCT INFORMATION Content: - 20

More information

For research use only Version # 13I16-MM-36

For research use only Version # 13I16-MM-36 pfusess-chig-hm Plasmid featuring the constant region of the human IgM (allele 3) heavy chain, and the IL2 signal sequence Catalog # pfusess-hchm3 For research use only Version # 13I16-MM-36 PRoDUCT InFoRMATIon

More information

pfusess-chig-rg*03 Plasmid featuring the constant region of the rabbit Ig (allele 3/2) heavy chain and the IL2 signal sequence Catalog # pfusess-rchg

pfusess-chig-rg*03 Plasmid featuring the constant region of the rabbit Ig (allele 3/2) heavy chain and the IL2 signal sequence Catalog # pfusess-rchg pfusess-chig-rg*03 Plasmid featuring the constant region of the rabbit Ig (allele 3/2) heavy chain and the IL2 signal sequence Catalog # pfusess-rchg For research use only Version # 11C07-MM PRoDUCT InFoRMATIon

More information

STOP. Before opening this package, please read the Limited Use License statement below:

STOP. Before opening this package, please read the Limited Use License statement below: STOP Before opening this package, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-vitronmcs The purchase of the pcpgfree-vitronmcs vector conveys

More information

pselect-zeo-seap A SEAP Reporter Gene System Selectable with Zeocin

pselect-zeo-seap A SEAP Reporter Gene System Selectable with Zeocin pselect-zeo-seap A SEAP Reporter Gene System Selectable with Zeocin Catalog # psetz-seap Version # 12I18-MM ProduCt information Content: - 20 µg of pselect-zeo-seap plasmid provided as lyophilized DNA

More information

Plasmid featuring the constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1

Plasmid featuring the constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1 pfusess-chig-hg1 Plasmid featuring the constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1 For research use only Version # 12I25-MM PRoDUCT InFoRMATIon Content:

More information

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e9

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e9 pfusess-chig-hg1e9 Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e9 For research use only Version # 12A13-MM PRODUCT InFORMATIOn

More information

pfusess-chig-hg2 Plasmid featuring the constant region of the human IgG2 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg2

pfusess-chig-hg2 Plasmid featuring the constant region of the human IgG2 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg2 pfusess-chig-hg2 Plasmid featuring the constant region of the human IgG2 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg2 For research use only Version # 12I25-MM PRoDUCT InFoRMATIon Content:

More information

pfusess-chig-mg1 Plasmid featuring the constant region of the mouse IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-mchg1

pfusess-chig-mg1 Plasmid featuring the constant region of the mouse IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-mchg1 pfusess-chig-mg1 Plasmid featuring the constant region of the mouse IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-mchg1 For research use only Version # 15I16v40-JC PRoDUCT InFoRMATIon

More information

pfusess-chig-rhg3 Plasmid featuring the constant region of rhesus monkey IgG3 heavy chain and the IL2 signal sequence Catalog # pfusess-rhchg3

pfusess-chig-rhg3 Plasmid featuring the constant region of rhesus monkey IgG3 heavy chain and the IL2 signal sequence Catalog # pfusess-rhchg3 pfusess-chig-rhg3 Plasmid featuring the constant region of rhesus monkey IgG3 heavy chain and the IL2 signal sequence Catalog # pfusess-rhchg3 For research use only Version # 13J01-JC-35 PRoDUCT InFoRMATIon

More information

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e6

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e6 pfusess-chig-hg1e6 Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e6 For research use only Version # 12A12-MM PRoDUCT InFoRMATIon

More information

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e4

Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e4 pfusess-chig-hg1e4 Plasmid featuring a mutated constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1e4 For research use only Version # 12A04-MM PRoDUCT InFoRMATIon

More information

Expression vector containing an isoform of human STING lacking exon 7. For research use only

Expression vector containing an isoform of human STING lacking exon 7. For research use only puno1-hsting-mrp Expression vector containing an isoform of human STING lacking exon 7 Catalog # puno1-hsting-mrp Version # 15J12-MM - 20 µg of lyophilized plasmid DNA - 4 pouches of E. coli Fast-Media

More information

psirna-hh1neo G2 A simple and innovative tool to create sirnas Catalog # psirna2-n11g2c For research use only Version # 03F13-MT

psirna-hh1neo G2 A simple and innovative tool to create sirnas Catalog # psirna2-n11g2c For research use only Version # 03F13-MT psirna-hh1neo G2 A simple and innovative tool to create sirnas Catalog # psirna2-n11g2c For research use only Version # 03F13-MT PRODUCT INFORMATION Content: - 20 µg of lyophilized circular psirna-hh1neo

More information

pselect-ngfp-zeo Plasmid for the expression of GFP-N-terminal tagged proteins

pselect-ngfp-zeo Plasmid for the expression of GFP-N-terminal tagged proteins pselect-ngfp-zeo Plasmid for the expression of GFP-N-terminal tagged proteins Catalog # psetz-ngfp For research use only Version # 10K22-MM ProduCt information Content: - 20 µg of pselect-ngfp-zeo plasmid

More information

pfuse-higg2-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hfc1 For research use only Version # 06G06-MT

pfuse-higg2-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hfc1 For research use only Version # 06G06-MT pfuse-higg2-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hfc1 For research use only Version # 06G06-MT PRODUCT INFORMATION Content: - 20 µg of pfuse-higg2-fc1 plasmid

More information

pfuse-higg1-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc1 For research use only Version # 06G05-MT

pfuse-higg1-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc1 For research use only Version # 06G05-MT pfuse-higg1-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc1 For research use only Version # 06G05-MT PRODUCT INFORMATION Content: - 20 µg of pfuse-higg1-fc1 plasmid

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

pfuse-higg4-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg4fc1 For research use only Version # 06G07-MT

pfuse-higg4-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg4fc1 For research use only Version # 06G07-MT pfuse-higg4-fc1 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg4fc1 For research use only Version # 06G07-MT PRODUCT INFORMATION Content: - 20 µg of pfuse-higg4-fc1 plasmid

More information

pfuse-higg1-fc2 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc2 For research use only Version # 06G05-MT

pfuse-higg1-fc2 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc2 For research use only Version # 06G05-MT pfuse-higg1-fc2 Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse-hg1fc2 For research use only Version # 06G05-MT PRODUCT INFORMATION Content: - 20 µg of p F U S E - h I g G 1

More information

Cat. #FP981. Vector description

Cat. #FP981. Vector description p2fp-rnai vector Cat. #FP981 Vector description p2fp-rnai vector is a mammalian expression vector designed for RNA interference studies. The vector encodes two fluorescent proteins: and JRedneomycin phosphotransferase

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631971

More information

pfuse-higg1e3-fc1 Plasmid containing a human engineered IgG1 Fc region Catalog # pfc1-hg1e3 For research use only Version # 11E10-JC

pfuse-higg1e3-fc1 Plasmid containing a human engineered IgG1 Fc region Catalog # pfc1-hg1e3 For research use only Version # 11E10-JC pfuse-higg1e3-fc1 Plasmid containing a human engineered IgG1 Fc region Catalog # pfc1-hg1e3 For research use only Version # 11E10-JC PRODUCT INFORMATION Content: - 20 µg of pfuse-higg1e3-fc1 plasmid provided

More information

TransIT -mrna Transfection Kit

TransIT -mrna Transfection Kit Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2225 INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with

More information

pfuse-migg2a-fc1 Plasmid containing a mouse IgG2A Fc region Catalog # pfuse-mg2afc1 For research use only Version # 08F06-SV

pfuse-migg2a-fc1 Plasmid containing a mouse IgG2A Fc region Catalog # pfuse-mg2afc1 For research use only Version # 08F06-SV pfuse-migg2a-fc1 Plasmid containing a mouse IgG2A Fc region Catalog # pfuse-mg2afc1 For research use only Version # 08F06-SV PRODUCT INFORMATION Content: - 20 µg of pfuse-migg2a-fc1 plasmid provided as

More information

- Vector information Packet ROIS-pAID-001

- Vector information Packet ROIS-pAID-001 PRODUCT: paid1.1-n Vector, paid1.1-c Vector AMOUNT: 20 µg LOT NUMBER: Specified on product label STORAGE CONDITIONS: Store plasmid at -20 o C. Avoid repeated freeze/thaw cycles. SHELF LIFE: One year from

More information

3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc

3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc 3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid

More information

GeNei TM Transformation Teaching Kit Manual

GeNei TM Transformation Teaching Kit Manual Teaching Kit Manual Cat No. New Cat No. KT07 107385 KT07A 106220 Revision No.: 00060505 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided 7 Procedure 9 Observation & Interpretation

More information

TransIT -mrna Transfection Kit

TransIT -mrna Transfection Kit INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly

More information

Important Limited Use License information for pcpgfree-sirna Kit

Important Limited Use License information for pcpgfree-sirna Kit STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-sirna Kit The purchase of the pcpgfree-sirna Kit conveys to the

More information

HiPer Plasmid DNA Cloning Teaching Kit

HiPer Plasmid DNA Cloning Teaching Kit HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-

More information

mirnaselect pmir-gfp Reporter System

mirnaselect pmir-gfp Reporter System Product Data Sheet mirnaselect pmir-gfp Reporter System CATALOG NUMBER: MIR-GFP STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pmir-gfp Reporter Vector (Part No.

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Human Cell-Free Protein Expression System

Human Cell-Free Protein Expression System Cat. # 3281 For Research Use Human Cell-Free Protein Expression System Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

HiPer Transformation Teaching Kit

HiPer Transformation Teaching Kit HiPer Transformation Teaching Kit Product Code: HTBM017 Number of experiments that can be performed: 10 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day 2- Inoculation

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

Bacterial Transformation and Protein Purification

Bacterial Transformation and Protein Purification Bacterial Transformation and Protein Purification Group 4 Natalie Beale Gregory A. Pate Justin Rousseau Dohee Won Introduction The purpose of this experiment is to perform a genetic transformation and

More information

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see

More information

Amgen Laboratory Series. Tabs C and E

Amgen Laboratory Series. Tabs C and E Amgen Laboratory Series Tabs C and E Chapter 2A Goals Describe the characteristics of plasmids Explain how plasmids are used in cloning a gene Describe the function of restriction enzymes Explain how to

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631972

More information

DNA TRANSFORMATION OF BACTERIA RED COLONY REVISED 3/2003

DNA TRANSFORMATION OF BACTERIA RED COLONY REVISED 3/2003 DNA TRANSFORMATION OF BACTERIA RED COLONY REVISED 3/2003 Prepared by the Office of Biotechnology, Iowa State University TEACHER PREPARATION AND INSTRUCTION GUIDE Preparation for the DNA transformation

More information

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03

Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03 RECOMBINANT DNA: DUAL ANTIBIOTIC-RESISTANCE GENES Prepared by the Office of Biotechnology, Iowa State University DRAFT 4/03 ** Portions of this protocol were adapted from DNA Science: A First Course in

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

IP-Free Electra DAUGHTER Vectors Mammalian with CMV promoter

IP-Free Electra DAUGHTER Vectors Mammalian with CMV promoter IP-Free Electra DAUGHTER Vectors Mammalian with CMV promoter Electra cloning DNA2.0 has developed a simple one-tube universal cloning process that can be performed in a 5 minute bench-top reaction with

More information

pd2528-cmv CMV-ORF, Mamm-ElecD 5934 bp

pd2528-cmv CMV-ORF, Mamm-ElecD 5934 bp EES Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions.

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE

More information

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I

7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I 7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis pet6xhn Expression Vector Set Contents Product Information... 1 pet6xhn-n, pet6xhn-c, and pet6xhn-gfpuv Vector Information... 2 Location of Features... 4 Additional Information...

More information

TransIT Transfection Reagent

TransIT Transfection Reagent INTRODUCTION TransIT -2020 is a broad spectrum transfection reagent that provides superior transfection of plasmid DNA into mammalian cells. TransIT-2020 is suitable for both transient and stable transfection

More information

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Maxim Biotech, Inc. 780 Dubuque Avenue, So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296

More information

WEPRO7240/7240H/7240G Expression Kit. Instruction manual for protein synthesis with wheat germ cell-free system

WEPRO7240/7240H/7240G Expression Kit. Instruction manual for protein synthesis with wheat germ cell-free system ENDEXT Technology WEPRO7240/7240H/7240G Expression Kit Instruction manual for protein synthesis with wheat germ cell-free system (Catalog No. CFS-TRI-7240, CFS-TRI-7240H, CFS-TRI-7240G) CellFree Sciences

More information

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

WEPRO1240/1240H/1240G Expression Kit. Instruction manual for protein synthesis with wheat germ cell-free system

WEPRO1240/1240H/1240G Expression Kit. Instruction manual for protein synthesis with wheat germ cell-free system ENDEXT Technology WEPRO1240/1240H/1240G Expression Kit Instruction manual for protein synthesis with wheat germ cell-free system (Catalog No. CFS-TRI-1240, CFS-TRI-1240H, CFS-TRI-1240G) CellFree Sciences

More information

pfb and pfb-neo Retroviral Vectors

pfb and pfb-neo Retroviral Vectors pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY

More information

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph

More information

These vectors are primarily designed for high level protein expression in transiently transfected cells. Your Gene GGT ATG. Intron acceptor_mouse IgH

These vectors are primarily designed for high level protein expression in transiently transfected cells. Your Gene GGT ATG. Intron acceptor_mouse IgH Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Mammalian

More information

phcmv Expression Vectors Instruction Manual

phcmv Expression Vectors Instruction Manual phcmv Expression Vectors Instruction Manual Catalog Numbers P003100 P003200 P003300 A Division of Gene Therapy Systems, Inc. 10190 Telesis Court San Diego, CA 92121 Phone: 888-428-0558 (US. Toll-Free)

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Linköpings Universitet. Site-directed mutagenesis of proteins

Linköpings Universitet. Site-directed mutagenesis of proteins IFM/Kemi August2011/LGM Linköpings Universitet Site-directed mutagenesis of proteins Competent E. coli cells Site-specific mutagenesis Analysis on agarose gel Transformation of plasmids in E. coli Preparation

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Cell-Free Protein Expression Kit

Cell-Free Protein Expression Kit Cell-Free Protein Expression Kit Handbook Version v.01, January 2018 Cat# 507024 (Sigma 70 Master Mix Kit, 24 Rxns) Cat# 507096 (Sigma 70 Master Mix Kit, 96 Rxns) Please refer to this product in your publication

More information

pcmv-script XR Predigested Vector

pcmv-script XR Predigested Vector pcmv-script XR Predigested Vector Instruction Manual Catalog #212224 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 212224-12 LIMITED PRODUCT WARRANTY This warranty limits our

More information

Yesterday s Picture UNIT 3B

Yesterday s Picture UNIT 3B Warm-Up Plasmids are circular pieces of DNA which bacterial cells are able to take up from the environment, then replicate and transcribe. Eukaryotic cells, by contrast, contain large, linear (non-circular)

More information

Transformation: Theory. Day 2: Transformation Relevant Book Sections

Transformation: Theory. Day 2: Transformation Relevant Book Sections Day 2: Transformation Relevant Book Sections We will follow the protocols provided in various industry-standard kits, instead of the protocols described in these chapters, but the chapters provide good

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Code No Retrovirus Packaging Kit Ampho

Code No Retrovirus Packaging Kit Ampho Code No. 6161 Retrovirus Packaging Kit Ampho Precautions for the use of this product Please follow the guideline for experiments using recombinant DNA issued by the relevant authorities and the safety

More information

TransIT -Keratinocyte Transfection Reagent

TransIT -Keratinocyte Transfection Reagent TransIT -Keratinocyte Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2800 INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically

More information

TransIT Transfection Reagent

TransIT Transfection Reagent INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells. TransIT-2020

More information

ENDEXT TM Technology. Wheat Germ Premium Expression Kit. Ver 1.7. CellFree Sciences Co., Ltd.

ENDEXT TM Technology. Wheat Germ Premium Expression Kit. Ver 1.7. CellFree Sciences Co., Ltd. ENDEXT TM Technology Wheat Germ Premium Expression Kit Ver 1.7 CellFree Sciences Co., Ltd. 1. Purpose Wheat Germ Premium Expression Kit is a starter kit to ascertain if the Wheat Germ Cell-Free System

More information