Supporting information for. In Situ Hot-Spot Assembly as a General Strategy for Probing Single

Size: px

Start display at page:

Download "Supporting information for. In Situ Hot-Spot Assembly as a General Strategy for Probing Single"

Ashley Wells
6 years ago
Views:

1 Supporting information for In Situ Hot-Spot Assembly as a General Strategy for Probing Single Biomolecules Huiqiao Liu, Qiang Li, Mingmin Li, Sisi Ma, and Dingbin Liu* H. Liu, Q. Li, M. Li, S. Ma, Prof. Dr. D. Liu College of Chemistry, Research Center for Analytical Sciences, State Key Laboratory of Medicinal Chemical Biology, and Tianjin Key Laboratory of Molecular Recognition and Biosensing, Nankai University, Tianjin (China) Prof. Dr. D. Liu Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin (China) *E mail: liudb@nankai.edu.cn. S1

2 Experimental Section: Materials and Instrumentation. Silver nitrate (AgNO3 99+%), sulfo-nhs-acetate, sulfuric acid (H2SO4, 98%), hydrogen peroxide (H2O2 37%), magnetic beads (8-9 μm) and 3-Aminopropyltriethoxysilane (APTES) were purchased from Aladdin. Trisodium citrate dehydrate (Na3C6H5O7), tris (2-carboxyethyl) phosphine (TCEP), N-(γmaleimidobutyryloxy) succinimide ester (GMBS), bovine serum albumin (BSA) were purchased from Sigma-Aldrich. Sodium chloride (NaCl), ascorbic acid (AA), sodium hydroxide (NaOH), bismaleimide (BMI), absolute ethanol, phosphate buffer (10 PBS), Tween 20 were purchased from Heowns. 4, 4 -Biphenyldithiol (DBDT) was purchased from TCI. SH-PEG (MW 1000), SH-PEG (MW 350), mpeg-nh2 (MW 5000) were purchased from Biomatrik Inc. The RT-PCR kit for mirna, RNase inhibitor and DEPC-treated water were purchased from TaKaRa Bio Inc. (Dalian, China; DEPC=diethylpyrocarbonate). MiRNAs and other oligonucleotides were synthesized by TaKaRa Bio Inc. (Dalian, China). Human IgG and anti-igg antibody were purchased from Biocell Biotechnol. Co., Ltd. (Zhengzhou, China). The morphology was characterized by scanning electron microscopy (SEM; JEOL JSM7500) and transmission electron microscopy (TEM; FEI, Tecnai G2 F20). RT-PCR was carried out on LightCycler 480II (Roche, Germany). The UV-vis spectra were recorded with U-3900 spectrophotometer (Hitachi). The Raman measurements were carried out in capillaries for liquid and on glass surface for aneroid (Renishaw invia Raman microscope, 50 objective lens with NA= 0.75, Leica) Dynamic light scattering (DLS) were performed on a Zeta Sizer Nano ZS (Malvern Zetasizer 3000HS and He/Ne laser at nm at scattering angles of 90 at 25 C). De-ionized water (Milli-Q grade, Millipore) with a resistivity of 18.2 MΩ-cm was used throughout this study. Preparation of AgNPs. The preparation of AgNPs mainly depend on the reported literature after a slight modification. 1 The procedure is simply as follows: 100 μl of the aqueous solution of AA with the concentration of 0.10 mm was added into 100 ml of boiling water, followed by boiling for an additional 1 min. 2 ml of the aqueous solution of sodium citrate (1 wt%) and 15 μl of the aqueous solution of AgNO3 (1 M) were S2

3 consecutively added under stirring at room temperature. After 5 min incubation at room temperature, 2 µl NaCl (1 M) was introduced to the aqueous solutions of citrate/agno3 mixtures before the solution was injected into the boiling aqueous solutions of AA (just after 1 min boiling after AA addition to boiling water). The color of the reaction solution quickly changed from colorless to yellow. The transparent and yellow reaction solution was further boiled for 1 h under stirring to produce uniform quasi-spherical AgNPs. Preparation of AgNP dimers. A step-by-step procedure for the preparation of AgNP dimers was shown in Figure S1. 2 First, Glass slides (22 mm 22 mm) were treated with a solution of H2SO4 (98 %) and H2O2 (3:1 v/v) for 30 min. After washing with water ( 3), the glass slides were immersed in an ethanol solution of APTES (10% v/v) for 30 min for amino-functionalization of the glass surface. Then, the glass was thoroughly washed by sonication with ethanol for three times. After that the glass was drying in an oven at 120 o C for 1 h. The amine-coated glass slides was immersed into the solution of the as-prepared AgNPs (160 pm) for 3 h to form the first layer of AgNPs. Later, the glass loading with AgNPs was treated with NaOH (2 mm) for 2 h to remove the free amine functional groups. In order to form AgNP dimers, DBDT (500 μm) was introduced to the immobilized AgNPs on the glass and incubated for 30 min. After gently washing with water, the resulted glass slide was transferred into AgNPs solution (160 pm) so as to bind the second layer of AgNPs. After 2 h incubation, the AgNP dimers were formed on the glass. Functionalization of the AgNP dimers with hairpin pairs. To functionalize the dimers for the subsequent detection, we imparted hairpin pairs (H1 and H2) to the dimeric AgNPs. The procedures mainly include the following three steps: 1) the immobilized AgNP dimers were further coated with a layer of DBDT (10 μm) to increase the amount of DBDT dyes on individual dimers; 2) bismaleimide (BMI) (1 mm) was employed to mask all the free thiol groups on DBDT coated on the AgNP dimers through Michael addition reaction; 3) thiolated hairpins (either H1 or H2, 500 nm) pre-treated with TCEP were conjugated with BMI. Finally, the AgNP dimers were S3

4 sonicated and released into water containing HS-PEG (MW 1000) (1 μm, 1 ml), by which the free maleimides were blocked by PEG. The obtained probes were stored in 1 PBS buffer at 4 o C for further use. MiRNA-21 detection using the AgNP dimer probes. The detection was performed on a glass slide. The APTES-modified slide prepared in the section of Preparation of AgNP dimers was immersed into an anhydrous DMF solution containing 2 mm GMBS for 2 h. GMBS was conjugated with amine of APTES via NHS/EDC chemistry. The obtained slide was then washed with EtOH and air-dried. A PDMS membrane with a panel of holes (d=5 mm) was covered on the GMBS-modified glass surface. Later, LNA capture sequences were added into each hole with a final concentration of 2 μm. After 2 h, the capture sequences were connected to the glass substrate through the crosslinking effect of GMBS. Sulfo-NHS-Acetate (10 mm) and HS-PEG (MW 350) (1 mm) were added to the glass surface to block the excess amines and maleimides on APTES and GMBS respectively. Subsequently, LNA trigger sequences (1 μm) and different amounts of mirna-21 were added into each hole and the whole slide was treated at 95 o C for 2 min and -20 o C for 1 min. The holes were then added with RNAase inhibitors (0.5 U/μl) and then left at room temperature for 12 h, followed by adding the equal amounts of AgNP dimer probes (probe 1 and probe 2) for signal amplification. Note that the probes were pre-annealed at 70 o C for 2 min and added to the mixture immediately. Discarding the solutions in the holes after 12 h and washed with PBST (1 PBS containing 0.1% Tween 20) ( 3), PBS ( 3), and deionized water ( 3). MiRNAs extraction from cell lines. All the materials used in this process were treated with 0.1% DEPC and autoclaved. MiRNAs were extracted using Takara RNAiso for small RNA according to the manufacture protocol. First, 1 ml RNAiso for small RNA extraction was added into centrifuge tubes with cells and allowed a vigorous vortex to completely lyse the cells; Then, chloroform (1/5 volume of RNAiso for small RNA) was added to the tubes and left at room temperature for 5 min. The mixtures were centrifuged at g for 15 min to separate the aqueous and organic phases. S4

5 Removing the upper liquid carefully to a fresh tube and adding equivalent volume of isopropanol to the above tubes. The resulted solutions were centrifuged at g for 10 min to yield white precipitates at the bottom of the tube. After washing with EtOH and adding 300 μl nuclease-free water, total mirna was obtained. Detection of mirna-21 extracted from single cells with magnetic beads. In this single-molecule detection system, magnetic beads were employed to capture mirnas and acted as mapping substrate. The magnetic beads with amino functional groups (0.05 mg/ml, diameter = 8-9 μm) were modified with LNA capture sequences by the same procedure as that on glass slide. The obtained beads were washed with PBS for three times with the assistant of magnet and then blocked with Sulfo-NHS-Acetate (10 mm) and HS-PEG (MW 350) (1 mm) simultaneously. Single cells were picked up by precision pipette tips with the micromanipulator system (Leica DMi8) and then suspended into 5 μl of RNase free water containing 0.01 mg/ml LNA capture sequences modified magnetic beads. The mixtures were lysed at 95 ºC for 10 min with PCR instrument, followed by adding LNA trigger sequences (1 μm) and RANase inhibitor (0.5 U/μL) immediately. The remaining steps are consistent with that on glass substrate. It is worth mentioning that all the washing steps were completed with the magnet sticking on the bottom of the PCR plates. Raman measurement for the detection of mirna-21. For mirnas detection on the glass substrate, 360 different scattering points were randomly chosen for Raman measurement. For these samples, measurement conditions: ex = 532 nm, Pex 18 mw, acquisition time = 1 s, and laser beam size 1 μm 2. For single-cell mirna-21 detection, 8 magnetic beads were randomly chosen for Raman measurements for each cell; four parallel experiments (i.e., 4 single cells) were conducted for each cell line. For these samples, measurement conditions: ex = 532 nm, Pex 0.9 mw, acquisition time = 1 s, and laser beam size 1 μm 2. The normalized Raman intensity of signal points were defined by the following calculation: I Normalized = I Total N Signal N Total. I Total is the total S5

6 measurable Raman intensity; N Total is the total signal points for signal collection and N Signal is the number of measurable signal points (the signal point is defined with Raman intensity above three times the standard variation in the mean background signal). RT-PCR for the detection of mirna 21. RT-PCR reactions were performed using a Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr kit according to manufacturer s instructions. Firstly, specific cdna sequences were prepared with the following steps: (i) In an RNase-free 0.2 ml tube, mrq Buffer, RNA sample, and mrq enzyme were mixed with a total volume of 10 μl. (ii) The mixture was incubated at 37 C for 1 hour, then terminated at 85 C for 5 min to inactivate the enzymes. 90 μl ddh2o was finally added to the mixture to enable the total volume to be 100 μl. The cdnas were now ready for the mirna quantification. 20 μl PCR solution contained cdna, has-mirna-21 specific Primer and mrq 3 Primer was performed with: Denaturation at 95 C 10 sec; qpcr x 40 cycles: 95 C 5 sec, 60 C 20 sec; dissociation curve: 95 C 60 sec, 55 C 30 sec, 95 C 30 sec. Preparation of DNA-labeled Antibody. The DNA labeled antibody (DNA-Ab) was prepared by a modified coupling procedure. At room temperature, anti-igg (1 mg/ml) reacted with a 50-fold molar excess of GMBS in PBS (ph 7.4) for 1 h. The obtained anti-igg-gmbs was purified three times by ultrafiltration with a 30 KD Millipore (10000 rpm, 10 min). In parallel, 200 μl of thiolated trigger sequence (10 μm thioltrigger DNA) was reduced with 2 μl of 100 mm TCEP in PBS for 10 min at 90 C. The product was purified three times with a 3 KD Millipore at rpm for 10 min. Then, the obtained anti-igg-gmbs and reduced oligonucleotide were mixed in PBS (ph 7.4) and incubated overnight at 4 C. IgG detection using the hot-spot assembly strategy. Different amounts of IgG were S6

7 firstly fixed on the surface of glass substrate according to the following steps: The APTES treated glass slide was immersed in an ethanol solution containing 5% glutaraldehyde for 2 h; then the glass was washed with ethanol and water for three times respectively under ultrasound and dried with a stream of Ar; a PDMS membrane with a panel of holes (d=5 mm) was covered on the aldehyde-functionalized glass surface and different amount of IgG were added into each hole and incubated at room temperature for 1 h; after that, 1 mm mpeg-nh2 (MW 5000) and 1% BSA dissolved in 10 mm PB were used to block the surface of glass; 10 μl of the prepared DNA labeled anti-igg were added to each hole and incubated with the substrate for 30 min at 37 o C; at last, the pre-annealed AgNP dimer probes were added to each hole and incubated overnight at room temperature. The procedure of Raman measurement of IgG is the same as that of mirna-21. S7

8 Supplementary Figures Figure S1 Synthetic scheme for the AgNP dimer probes. The surface of glass slide was first oxidized and subsequently functionalized with APTES, which then bound a layer of AgNPs. After removing the free organosilane by NaOH, the slide was immersed into EtOH solution containing DBDT, which acted as the linker to connect the first layer of AgNPs with the second ones. The immobilized AgNP dimers were then modified with BMI through Michael addition reaction, which then reacted with hairpin pairs and PEG to produce probe 1 and probe 2. S8

calculated to be 14.1 %, 48.2 %, 20.4 %, 8.3 %, and 9 %.

9 Figure S2 SEM images of the glass substrate with (a) one layer of AgNPs and (b) two layers of AgNPs; (c) the corresponding yields for monomer, dimer, trimer, tetramer, and multimer are calculated to be 14.1 %, 48.2 %, 20.4 %, 8.3 %, and 9 %. Figure S3 TEM images of (a) AgNP monomers and (b) AgNP dimers. The small gap in individual AgNP dimer creates hot spot for SERS measurement. S9

10 Figure S4 DLS of (a) AgNP monomers and (b) AgNP dimers. The hydration diameter of dimers was nearly twice to that of the monomers. Figure S5 UV-vis spectra of AgNP monomers and AgNP dimers. The appearance of the new absorption peak at 550 nm demonstrated the formation of dimeric structure of AgNPs. 3 S10

Figure S6 Raman intensity of the aggregates formed by annealing probe 1 and probe 2 and then allowing the mixture to incubate at room temperature for different time.

11 Figure S6 Raman intensity of the aggregates formed by annealing probe 1 and probe 2 and then allowing the mixture to incubate at room temperature for different time. The Raman intensity of the solution increased when prolonged incubation time to 12 h. Figure S7 Raman intensity of AgNP dimers and aggregates in solutions. The aggregates were formed by annealing probe 1 and probe 2 and then allowing the mixture to incubate at room temperature for 12 h. S11

12 Figure S8 (a) PCR amplification curves of mirna-21 before and after immobilizing on array substrates. (b) PCR amplification curves and (c) its corresponding linear fit of standard mirna-21. Through the calibration curve, the amounts of free mirna-21 before and after immobilizing on the substrate were calculated to be 1.77 and pm, respectively. The immobilized mirna-21 were calculated to be pm ( pm) and the capture efficiency was thus calculated to be 73.6% (1.303/1.77). S12

Figure S9 (a) Raman mapping images showing integrated 1587 cm -1 Raman peaks for detection of mirna-21 ranging from 1 to 1000 pm with AgNP dimer probes and the hot-spot assembly strategy respectively.

13 Figure S9 (a) Raman mapping images showing integrated 1587 cm -1 Raman peaks for detection of mirna-21 ranging from 1 to 1000 pm with AgNP dimer probes and the hot-spot assembly strategy respectively. (b) Profiles of the relationship between the concentration of mirna-21 and the normalized Raman intensity when measured with AgNP dimer probes (green line) and the hot-spot assembly strategy (red line). S13

Figure S10 (a) Reprehensive SEM images of the assembled aggregates when detected mirna-21 with concentrations of 1, 10, 100, and 1000 pm respectively (I-IV) and (b) the

14 Figure S10 (a) Reprehensive SEM images of the assembled aggregates when detected mirna-21 with concentrations of 1, 10, 100, and 1000 pm respectively (I-IV) and (b) the corresponding average numbers of aggregates (0.89, 7.3, 29.31, and 43.34) per µm 2. Error bars represent the data collected from four independent SEM images for each mirna-21 concentration. S14

15 Figure S11 Statistical analysis of 360 Raman measurements at 1587 cm -1 to detect mirna-21 with one-point mutation (M1), two-point mutation (M2), and the fully complementary sequences. The absence of mirna-21 was employed as the control. The amounts of mirna-21 and the mutants are identical to be 1 pm. S15

16 Figure S12 Calibration curve for the quantification of mirna-21. Different concentrations of mirna-21 were hybridized with the LNA modified magnetic beads and then the AgNP dimer probes were added for hot-spot assembly in situ. 500 points were recorded from randomly distributed microbeads for each concentration. Error bars represent the data collected from three independent experiments. Figure S13 PCR amplification curves (a) and melting curves (b) for mirna-21 detection extracted from four different cell lines. The cell number for each cell line is The average amounts of mirna-21 in each 3T3, HeLa, MCF-7, and HepG 2 are quantified to be 1831, 5468, 11862, and respectively through RT-PCR analysis of the cell extracts. S16

17 Figure S14 PCR amplification curves for mirna-21 quantification in single MCF-7 cells. The cells were destroyed by heating (95 C) and then reverse transcript was conducted. The same amount of RNase free water without cells was set as controls. RT- PCR was unable to quantify the mirna-21 at the single-cell level. S17

18 Figure S15 SERS signals measured at 1587 cm - 1 for the detection of different amounts of IgG: 0, 1, 10, 100, and 1000 ng/ml, respectively. 360 Raman spectra were collected for each sample randomly. Figure S16 Profile of the relationship between amount of IgG and the normalized Raman intensity performed with the hot-spot assembly strategy. S18

19 Table S1 Comparisons of some HCR-based techniques. Method Target LOD Single-cell quantitation Generality Reference Colorimetric BVDV- RNA 0.1 nm N/A Other nucleic acid sequences of pathogens 4 Electrochemical mirna- 199a 0.64 fm N/A More general nucleic acid 5 Fluorescence mirnas 1 am Yes SERS mirna fm N/A Electrochemical mirna fm Yes Other DNAs and mrnas Multiple biomarkers in serum Different mirna biomarkers SERS DNA 3.4 fm N/A Different gens 9 SERS mirna-21 Single molecule Yes MiRNA, DNA, protein This study S19

20 Table S2 Sequences of DNA and RNA used in this study. Name Sequence (5 to 3 ) LNA capture sequence LNA trigger sequence Thiolated trigger sequence H1 H2 MiRNA-21 M1 M2 SH-TTTTTTTCAACATCAGT CTGATAAGCTACAGGACATCGAATAGTC SH-CTGATAAGCTACAGGACATCGAATAGTC SH-TTTTTTTTATCGAATACAGGACTATTCGATGTCCTG SH-TTTTGTCCTGTATTCGATCAGGACATCGAATA UAGCUUAUCAGACUGAUGUUGA UAGAUUAUCAGACUGAUGUUGA UAGAUUAUCAGACUGACGUUGA Note: the red color marked are locked nucleic acid (LNA). Table S3 Primers were used for RT-PCR in this experiment. Primer Sequence (5 to 3 ) U6-F U6-R hsa-mir-21-f GGAACGATACAGAGAAGATTAGC TGGAACGCTTCACGAATTTGCG TAGCTTATCAGACTGATGTTGA References (1) Li, H.; Xia, H.; Wang, D.; Tao, X. Langmuir 2013, 29, (2) Hoon, C.; Jun, H. Y.; Sangwoon, Y. ACS Nano 2014, 8, (3) Cha, H.; Lee, D.; Yoon, J. H.; Yoon, S. J. Colloid Interface Sci. 2016, 464, (4) Monjezi, S.; Rezatofighi, S.; Mirzadeh, K.; Rastegarzadeh, S. Appl. Microbiol. Biotechnol. 2016, 100, S20

21 (5) Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. ACS Appl. Mater. Interfaces 2015, 7, (6) Zhang, X.; Liu, C.; Sun, L.; Duan, X.; Li, Z. Chem. Sci. 2015, 6, (7) Zheng, J.; Ma, D.; Shi, M.; Bai, J.; Li, Y.; Yang, J.; Yang, R. Chem. Commun. 2015, 51, (8) Shi, K.; Dou, B.; Yang, C.; Chai, Y.; Yuan, R. Xiang, Y. Anal. Chem. 2015, 87, (9) Gao, F.; Lei, J.; Ju, H. Anal. Chem. 2013, 85, S21

Supporting Information for

Supporting Information for Building Electromagnetic Hot Spots in Living Cells via Target-Triggered Nanoparticle Dimerization Wen Zhou, 1,2 Qiang Li, 1 Huiqiao Liu, 1 Jie Yang, 1 Dingbin Liu 1,2 * 1. College