Gene expression Genome-wide Association Studies (GWAS) Gene Regulation Epigenetics Comparative Genomics

Transcription

1

2 Gene expression Genome-wide Association Studies (GWAS) Gene Regulation Epigenetics Comparative Genomics

3 David Valle Malaria Institute Aravinda Chakravarti Microarray core Stanley Institute Genetic Epi Ingo Jef Boeke Joe Coresh Rafa Kung-Yee Tom Andy Feinberg Ciprian HongKai Chi Dang Biostatistics J Pevsner Giovanni & Co Terry Speed David Sidransky Grace Wahba Vasan S Yegnasubramanian Wing Wong Steve Baylin Bioconductor Bert Vogelstein

4 Hongkai Ji, Hui Jiang, Wenxiu Ma, David S. Johnson, Richard M. Myers and Wing Hung Wong (2008) An integrated software system for analyzing ChIP-chip and ChIP-seq data. Nature Biotechnology. 26: Steven A. Vokes, Hongkai Ji, Wing Hung Wong and Andrew P. McMahon (2008) A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog mediated patterning of the mammalian limb. Genes & Development. 22: Scharpf RB, Parmigiani G, Pevsner J, Ruczinski I (2008). Hidden Markov Models for the Assessment of Chromosomal Alterations using High-throughput SNP Arrays. Annals of Applied Statistics, 2(2): Scharpf RB, Ting JC, Pevsner J, Ruczinski I (2007). SNPchip: R Classes and Methods for SNP Array Data. Bioinformatics, 23(5): Sull JW, Liang KY, Hetmanski JB, Zarfas K, Fallin MD, Ingersoll RG, Park JW, Wu-Chou YH, Chong S, Cheah F, Yeow V, Park BY, Jee SH, Jabs EW, Redett R, Ruczinski I, Scott AF, Beaty TH (2008). Differential parental transmission of markers in RUNX2 among cleft case-parent trios from four populations. Genetic Epidemiology 32: Irizarry RA, Ladd-Acosta C, Wen B, Wu Zhijin, Montana C, Oyango P, Cui H, Gabo K, Rongione M, Webster M, Ji H, Potash J, Sabunciyan S, Feinbert A (2008) Genome-wide methylation analysis of human colon cancer reveals similar hypo-and hypermethylation at conserved tissue-specific CpG island shores. Nature Genetics (To appear) Irizarry RA, Ladd-Acosta C, Carvalho B, Wu H, Brandenburg SA, Wen B, Feinberg AP (2008) Comprehensive High-throughput Arrays for Restriction endonuclease-based Methylation (CHARM). Genome Research. 18(5): More than 40 collaborative papers in 2007 and 2008

5 Novel Statistical Methods for Gene-Environment Interactions in Complex Diseases PI: Kung-Yee and Ingo (with Ciprian and Tom) Hierarchical Models in Health Services Research PI: Tom (with Ingo) Software for the Statistical Analysis of Microarray. PI: Rafa Preprocessing and Analysis Tools for Contemporary Microarray Applications PI: Rafa (with Ingo, Ciprian, and Hongkai) Collaborative Bioconductor: An Open Computing Resource for Genomics PI: Robert Gentleman Center for the Epigenetics of Common Human Diseases PI: Andrew Feinberg Genetic study of schizophrenia and bipolar PI: Ann Pulver Genetic study of obsessive and compulsive disorder (OCD) PI: Gerry Nestadt International genetic study of oral cleft PI: Terri Beaty Institute for Clinical and Translational Research. PI: Daniel Ford Genome-Wide Association Studies of Asthma In Populations Of African Descent PI: Kathleen Barnes DNA Repair, Skin Cancer and Overall Cancer Risk PI: Anthony Alberg Genotypic Determinants of Aspirin Response in High Risk Families PI: Lewis Becker Provost Initiatives Nucleating a discipline: Creating leadership in bioinformatics and computational biology PI: Sarah Wheelan The Johns Hopkins Individualized Medicine Program. PI: David Valle

6 Genome-wide Association Studies Epigenetics Gene Regulation

7

8 Affymetrix SNP chip terminology Genomic DNA: PM probe for Allele A: SNP A TACATAGCCATCGGTANGTACTCAATGATGATA G ATCGGTAGCCATTCATGAGTTACTA PM probe for Allele B: ATCGGTAGCCATCCATGAGTTACTA Genotyping: answering the question about the two copies of the chromosome on which the SNP is located: Is a person AA, AG or GG at this Single Nucleotide Polymorphism?

9

10

11

12

13 A A A TF1 TF2 B B B C C C TF1 TF2 TACTACCACCCACAACATAATAAAATCTAA Gene1 TF2 TF1 TTAATAAAATACCACCCACAACCTAAGGAT Gene2 TF3 TF3 Gene3 Transcription factors Other genes Activation Repression Other Interactions

14

15 Moving Average t-statistic, variance shrinking t-statistic Mean(X 1 )-Mean(X 2 ) Vokes SA, Ji H, Wong WH, McMahon AP et al. Development 2007, 134:

16 TF GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TF TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA TF CTGGGAGGTCCTCGGTTCAGAGTCACAGAGCAGATAATCA TF TTAGAGGCACAATTGCTTGGGTGGTGCACAAAAAAACAAG TF AACAGCCTTGGATTAGCTGCTGGGGGGGTGAGTGGTCCAC TF ATCAGAATGGGTGGTCCATATATCCCAAAGAAGAGGGTAG

17 Peak Detection Working Group Rafael Irizarry Ciprian Crainiceanu Christopher Barr Hongkai Ji Hao Wu

18 In the field of functional genomics, Perhaps it is not enough to define ourselves only as statisticians. We are an integral part of scientific community and we should also see our role in driving the development of science.