BioXp 3200 System: NGS Library Construction Kit User Guide

Transcription

1 BioXp 3200 System: NGS Library Construction Kit User Guide Catalog Number BX and BX REV Part number 40024

2 LEGAL NOTICES Limited Use Label License Except as otherwise agreed in writing by our authorized representative, this product is for INTERNAL RESEARCH USE ONLY AND NOT FOR HUMAN, ANIMAL, THERAPEUTIC OR DIAGNOSTIC USE. For additional information about your rights under this research license, please see our website at sgidna.com. Limited Warranty a) Synthetic Genomics entire liability and your exclusive remedy if the Product fails to conform to the following warranty (a Nonconforming Product ) shall be, at Synthetic Genomics sole option, either repair or replacement of such Nonconforming Product, or, if neither is practicable, a refund of the fees paid for the Product. The warranty for the repaired or replaced Product is limited to the scope and remaining duration of the original warranty for the Nonconforming product or, if longer, for 30 days after the date of shipment to you of the repaired or replaced Product. The warranty is contingent upon proper use of the Product in accordance with the user Guide and does not apply to any Product that is subjected to unusual physical or electrical stress, misuse, neglect, improper testing or storage, modification or unauthorized repair or upgrade. b) Synthetic Genomics warrants that the product, as delivered, will be free from defects in material and workmanship for a period of one year from the date it is delivered to you ( the Warranty Period ). c) This warranty gives you specific legal rights and you may have other legal rights which vary from state to state. This warranty is non-transferable. d) OTHER THAN AS EXPRESSLY SET FORTH ABOVE, SYNTHETIC GENOMICS MAKES NO WARRANTIES, EXPRESS, STATUTORY, IMPLIED, OR OTHERWISE. NO DISTRIBUTOR, AGENT OR EMPLOYEE IS AUTHORIZED TO MAKE ANY MODIFICATIONS, EXTENSIONS OR ADDITIONS TO THIS WARRANTY. e) You shall indemnify, defend and hold harmless Synthetic Genomics from any costs, expenses, damages, or other losses arising out of i) any warranty of greater scope or duration than that set forth in this Synthetic Genomics Limited Warranty; and ii) failure to disclaim implied warranties and limit remedies and liabilities, by and on behalf of Synthetic Genomics. Trademark Information Synthetic Genomics is a registered trademark and BioXp and Bio360 are trademarks of Synthetic Genomics Inc. Qubit is a registered trademark and Quant-iT and Nunc are trademarks of Thermo Fisher Scientific. Illumina, TruSeq, and MiSeq are registered trademarks of Illumina, Inc. Regulatory Statement Statement of Proprietary Information For Research Use Only Copyright in this work is vested in Synthetic Genomics and the document is issued in confidence for the purpose only for which it is supplied. It must not be reproduced in whole or in part except under an agreement or with the consent in writing of Synthetic Genomics and then only on the condition that this notice is included in any such reproduction. No information as to the contents or subject matter of this document or any part thereof arising directly or indirectly there from shall be given orally or in writing or communicated in any manner whatsoever to any third party being an individual firm or company or any employee thereof without the prior consent in writing of Synthetic Genomics. 2

3 Limitation of Liability SYNTHETIC GENOMICS LIABILITY ARISING OUT OF OR RELATING TO A PRODUCT SHALL NOT EXCEED THE AGGREGATE AMOUNTS YOU PAID TO SYNTHETIC GENOMICS FOR THE PRODUCT. IN NO EVENT WILL SYNTHETIC GENOMICS BE LIABLE FOR LOST USE, PROFITS, REVENUE, COST OF PROCUREMENT OF SUBSTITUTE GOODS, OR ANY OTHER SPECIAL, INDIRECT, RELIANCE, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, HOWEVER CAUSED AND UNDER ANY THEORY OF LIABILITY. THE FOREGOING LIMITATIONS SHALL APPLY REGARDLESS OF WHETHER SYNTHETIC GENOMICS HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES AND NOT WITHSTANDING THE FAILURE OF ESSENTIAL PURPOSE OF ANY LIMITED REMEDY. Technical Services For technical assistance, contact technical services at techservices@sgidna.com or (toll-free within North America) (outside North America) Synthetic Genomics, Inc. syntheticgenomics.com 2017 Synthetic Genomics Inc. All rights reserved. 3

4 Table of Contents 1. Overview 5 2. Product Information 5 A. Kit components 5 B. Reagent sizes 5 C. Required materials (not provided) 6 3. Guidance and Recommendations 6 4. Safety Warnings 7 5. Before starting 8 A. Prepare samples 9 B. Preparing for a BioXp NGS library construction run 10 C. Consumables and reagents BioXp System Operation for NGS Library Construction 12 A. Load the instrument 12 B. Begin the run 15 C. After the run Analyze libraries 18 A. Quantification Appendix 19 A. Sequence information 19 B. Frequently asked questions 20 4

5 1. Overview The use of this kit requires access to a BioXp 3200 Instrument. If you do not have access to a BioXp 3200 system, you can use a non-automated version of this chemistry (SGI-DNA NGS Library Construction Kit, catalog number BX M). The BioXp NGS Library Construction Kit enables walk-away, fully automated generation of bar-coded, Illumina-compatible next generation sequencing libraries. The kit described in this user guide contains all reagents (except ethanol) to enable the conversion of fragmented DNA samples into bar-coded, purified, ready-to-sequence libraries. Two reaction sizes are available to enable the generation of up to 8 or 16 uniquely bar-coded libraries. 2. Product Information A. Kit components Familiarize yourself with the names and appearance of the different NGS Library kit components prior to setting up an instrument run. IMPORTANT: Store DNA Purification Strips at 4 C (do not freeze). Store all other components of the BioXp 3200 NGS kit at 20 C. BioXp NGS Library Reagent Module Component Sample Plate Reagent Plate Barcode Plate Quantity 1 plate Storage Temperature Store at 20 C Loading Map and Checklist NGS Library 1 document N/A BioXp NGS Purification Module Component DNA Purification Strip(s) (black) Quantity 1 strip (8 reactions) or 2 strips (16 reactions, shown) Storage Temperature Store at 4 C The 96-well plate labeled Sample Plate has a black aluminum lid on the top. A 2D barcode is printed on this lid. This barcode is used by the instrument to run the protocol specific to the number of reactions supported by your kit. The instrument's program is specific to the number of reactions supplied in the kit. It is important to not swap components of a 16 reaction kit for an 8 reaction kit and vise versa. B. Reagent sizes 8 16 Note that each box is marked with a sticker or stickers (e.g., or ) to indicate the reagent size of the contents. Be certain to use appropriately sized reagents for your job. 5

6 C. Required materials (not provided) From SGI-DNA Accessory products Quantity Cat. No. BioXp 50 µl Natural Tips * 1 Case of 24 Racks CS BioXp 200 µl Conductive Black Tips * 1 Case of 24 Racks CS *BioXp Tips have been standardized for use on the instrument. It is critical to the success of BioXp system runs that these are the only tips used with the BioXp instrument. User supplied reagents Item Notes Recommended supplier Fresh 70% ethanol You will need 20 ml per run User supplied equipment Item Notes Recommended Mini Centrifuge Must be capable of 8-well strip centrifugation SGI-DNA Bio360 Minifuge Cat. No. SGI-C1008-B 3. Guidance and Recommendations Use plates and strips within 6 months of receipt. Use pipettes that have been accurately calibrated as pipetting errors can negatively impact kit performance. Thaw the Barcode Plate on ice. Do not heat the Barcode Plate above room temperature (20 C to 25 C) as this will adversely impact NGS library construction. This kit uses a single index barcode system. If you plan to load fewer samples than the kit capacity, load your samples consecutively beginning with well A1 to ensure balanced barcode pairing during the adapter ligation step to avoid registration failures during your sequencing run. See "Sequence information" on page 19 for more information and guidelines. Best results are obtained using high quality DNA for library preparation (260/280 nm ratio of ). The use of nicked or degraded DNA may result in library preparation failure. Ensure that the input sample does not contain contaminating RNA, nucleotides and singlestranded DNA. Mechanical or acoustic DNA fragmentation methods that randomly break up DNA into fragments less than 800 bp in size are compatible with this kit. Enzymatic methods of fragmentation are not recommended as they may introduce cleavage bias that will lead to suboptimal results. Barcodes and primers are included with this kit. Use of included primers and barcodes is highly recommended to avoid errors due to primer design. If you will be designing your own primers, see "Sequence information" on page 19 for primer and adapter sequences. 6

7 4. Safety Warnings Hazardous chemical warning Always wear protective gear including safety goggles, gloves, and a lab coat when handling chemicals. Exercise caution when handling flammable liquid. Follow all national, state, and local health and safety regulations and laws. Use proper waste disposal in accordance with all relevant regulations. Refer to applicable Material Safety Data Sheets (MSDSs). Flammable liquids: solution handling warning Keep flammable liquids in covered containers when not in use. Provide means to promptly and safely dispose of flammable liquid leaks or spills. Do not transfer liquids using air pressure. Read applicable MSDSs. Store flammable liquids in cool, well-ventilated areas away from corrosives, oxidizers, and ignition sources. Label containers and cabinets as "flammable materials" where applicable. Use only approved safety vessels for flammable liquid storage. Never pour flammable liquids down a drain or sink. Dispose of empty flammable containers in an approved manner. 7

8 5. Before starting The BioXp NGS Library Construction kit offers a fully automated workflow to prepare single, paired-end and multiplexed DNA libraries starting from ng of user-fragmented plasmid or genomic DNA. The BioXp NGS Library Construction workflow produces amplified libraries which are optimized for sequencing on Illumina platforms and require no further purification prior to use. Barcode adapters provided with the kit enable pooling of libraries into multiplexed runs. Sheared input DNA sample End-repair and adenylation Adapter ligation Magnetic bead-based purification Bar-coded library ready for normalization, pooling and sequencing Library amplification Magnetic bead-based purification Figure 1. BioXp NGS Library Construction Kit workflow. Starting with sheared DNA, the BioXp 3200 System allows walk-away automation of the NGS library construction process resulting in bar-coded libraries ready for normalization, pooling and sequencing. This same chemistry is available in a nonautomated format for those without access to a BioXp system. 8

9 A. Prepare samples Prepare input DNA for use on the BioXp instrument by first fragmenting your DNA sample. We recommend mechanical or acoustic DNA fragmentation methods. After fragmenting the DNA sample, quantify the DNA before loading the BioXp Sample Plate as described below. Input DNA requirements for the BioXp NGS Library Construction kit Amount Concentration ng per reaction ng/ul (32 ul sample in nuclease-free water) Quantify samples using a fluorescence-based method such as the Qubit dsdna BR Assay Kit (Thermo Fisher Cat. No. Q32850) or if low sample input is a concern, use the Quant-iT dsdna Assay Kit, high sensitivity (Thermo Fisher Cat. No. Q33120). Determine post-fragmentation size distribution and concentration using the 2100 BioAnalyzer system and recommended high sensitivity kits (Agilent Cat. Nos or , reagents only) or the 2200 TapeStation system with the recommended high sensitivity kits (Agilent Cat. Nos , ScreenTape, and , reagents). After determining the concentration by Qubit or BioAnalyzer/TapeStation analysis, dilute the fragmented sample to ng total DNA in 32 ul nuclease-free water. Load samples onto the Sample Plate in its carrier according to the following plate maps. 8 Samples 16 Samples A B C D E F G H A B C D E F G H

10 B. Preparing for a BioXp NGS library construction run 1. Remove reagents from storage and thaw according to the following instructions: Component* Reagent Plate Barcode Plate Thawing temperature and duration Thaw at room temperature for 30 minutes Thaw on ice for 30 minutes Note: The Barcode Plate must remain on ice at all times * Contents in plates can be dispersed during shipping and handling. We highly recommend performing a pulse spin of the plates after thawing. 2. Prepare 20 ml of fresh 70% ethanol by adding 14 ml of 200 proof ethanol to 6 ml of nuclease-free water. Note: Use fresh ethanol for optimal results. Refer to the "Safety Warnings" on page 7 for important ethanol handling information. C. Consumables and reagents Consumables Image Item Remarks Notch 50 µl Tip Tray (2 Trays per run) Plate notch is located in the upper left hand corner of the tray, near the well A1 position Notch 200 µl Tip Tray (2 Tray per run) Plate notch is located in the upper left hand corner of the tray, near the well A1 position Barcode Plate (1 Plate per run) Plate notch is located in the upper left hand corner of the plate, near the well A1 position 10

11 Reusable Instrument Components Ethanol Reservoir Reusable Reagent and Recovery Plate Thermal Covers (for the Cover Stands) Placed during initial instrument set up The instrument returns thermal covers to proper locations at the end of each run Reagents Image Item Remarks Sample Plate The Sample Plate notch is in the upper left hand corner of the plate, near the well A1 position Housed in a Carrier Tray Comes with a metal lid Reagent Plate The Reagent Plate notch is in the lower left hand corner of the plate, near well H1 Foil-sealed pinhole DNA Purification Strip Black Strip Color One strip for 8-reaction runs Two strips for 16-reaction runs 70% EtOH 70% ethanol for Ethanol Reservoir Prepare fresh 70% ethanol User supplied (not included with reagents) IMPORTANT: Be sure to match all reagents to your BioXp System order. Each system run is accomplished from a matched set of reagent components. 11

12 6. BioXp System Operation for NGS Library Construction A. Load the instrument Fill and load the Ethanol Reservoir 1. Add 15 ml fresh 70% ethanol to the reusable Ethanol Reservoir. Note: Do not add ethanol to the reservoir while the reservoir is in the retainer on the instrument deck. Always remove the reservoir to a lab bench away from the instrument before filling to prevent any accidental spillage from seeping onto the instrument. 2. Secure the reservoir lid onto the Ethanol Reservoir and place in the right-most side of the Reservoir Retainer on the instrument deck as shown. Note: When loading the reservoir onto the instrument deck, ensure that the reservoir fits snugly within the retainer and that the tabs of the reservoir are seated properly within the retainer groove. 12

13 Load the job-specific reagents 1. Centrifuge the DNA Purification Strip for at least one minute to fully collect the tube contents at the bottom of the wells. Note: The Bio360 Minifuge (SGI DNA Cat. No. SGC1008-B) is the ideal BioXp System centrifugation companion. 2. Confirm that the contents of the strips have been collected to the bottom of the wells following pulse centrifugation. With the clasps unlocked, load the strips with strip numbers on top in the positions shown. Load one strip for 8-reaction runs Load two strips for 16-reaction runs 3. While holding the strips in place, lock the clasps by gently lifting and returning the clasps to their locked position

14 Load remaining deck components Refer to the following image and load all remaining NGS library components: 1. Load tips by aligning the tip tray notch with the upper left corner of each Tip Tray Retainer a. Load 2 x 50 μl tips b. Load 2 x 200 μl tips 2. Load the Barcode Plate onto the Recovery Chiller. 3. Load the Sample Plate containing DNA samples onto into the Thermocycler. Note: See "Prepare samples" on page 9 for sample loading instructions. 4. Load the Reagent Plate into the Reagent Chiller. Sample Plate Thermal Cover Reagent Plate Barcode Plate Ethanol Reservoir black strip(s) 50 μl tips 50 μl tips 200 μl tips 200 μl tips 14

15 B. Begin the run 1. Close the door. Note: You will hear the door latch lock and the door will remain locked throughout the job process. Do not open the door during a job run. 2. The system reads the job barcode and displays a Job Initiation Screen: Press... To... Begin the run. Cancel the job. Delay the job start time (up to 2 hours). 15

16 C. After the run Removing materials from the instrument When the job is complete, the system displays the Job Complete Screen: 1. Press Unlock Door to open the door and remove all applicable materials. Note: Expect a delay (< ~1 minute) after pressing Unlock Door while the instrument removes the thermal covers. 2. Remove all applicable materials. Purified libraries are located in the Sample Plate, which is circled in red in the following image. keep save keep keep 3. Properly discard or store each item (refer to the table on the following page for instructions). 16

17 Location of purified libraries After completion of the job run, the purified libraries are located in the following locations: Number of reactions Purified library location Sample Plate 8 Column 12 of the Sample Plate 16 Columns 11 and 12 of the Sample Plate You may store the libraries by applying a seal to the Sample Plate and placing the plate at 2 C to 8 C for short-term (1 week) or 20 C for up to one month. We recommend sealing the Sample Plate with an adhesive film (e.g., Nunc Sealing Plates, Thermo Fisher Catalog number ) prior to storage. Properly discard or store each of the following items. Item Deck location at the end of the run Save or Discard? What should I do with each item? Sample Plate Thermocycler (circled in red on the previous page) Save The Sample Plate, located within the Thermocycler, contains the prepared libraries. Seal the plate and store at 2 C to 8 C for one week or at 20 C for up to one year. Reagent Plate Reagent Chiller Discard Barcode Plate Recovery Chiller Discard Strip Wells Strip Well Holder Discard Ethanol Reservoir Reservoir Rack Save 1. Empty and discard remaining ethanol according to the appropriate guidelines for hazardous chemical waste. 2. Rinse the Ethanol Reservoir with water and dry the Reservoir so that it will be ready for future use. Pipette Bin Save Empty after use and dispose of used pipette tips in an appropriate waste container. Tip Trays Tip Tray Receptacles Discard 17

18 7. Analyze libraries Purified bar-coded libraries are located in columns 11 and 12 (for 16-reaction runs) or column 12 (for 8-reaction runs) of the Sample Plate. Prepared libraries are ready for loading onto flow cells for sequencing. Manual purification is not necessary prior to preparing libraries for loading onto flow cells for sequencing. For optimal results, quantify libraries to normalize multiple libraries prior to pooling for multiplexed sequencing runs. A. Quantification We recommend determining both size distribution and concentration with the Agilent 2100 BioAnalyzer system or 2200 TapeStation system. Expected results Library Quantification Kits for NGS (Kapa Cat. No. KK4824) can be used as a highly sensitive method to determine concentration without size distribution. Expected results 18

19 8. Appendix A. Sequence information Barcode Adapter sequences Barcode Sequence Barcode Sequence 1 GCCAAT 9 TGACCA 2 CTTGTA 10 ATCACG 3 CGATGT 11 TTAGGC 4 CAGATC 12 ACTTGA 5 ACAGTG 13 GATCAG 6 GTGAAA 14 TAGCTT 7 AGTCAA 15 GGCTAC 8 ATGTCA 16 AGTTCC Table 1. Barcode adapter sequences. Suggested barcode combinations to use with 1 8 samples Good index combination example Barcode 1 G C C A A T Barcode 2 C T T G T A Bad index combination example Barcode 3 C G A T G T Barcode 4 C A G A T C Barcode 5 A C A G T G X X X = signal missing in one color channel Figure 1. Suggested Barcode combinations for multiplexing fewer than 8 samples. Illumina sequencing instruments use a green laser to read G/T bases and a red laser to read A/C bases. At each cycle at least one of the two nucleotides for each color channel needs to be read to ensure proper registration of a barcode index. When performing multiplex sequencing, it is important to maintain color balance for each base of the index read to prevent sequencing failures as a result of registration failures. Use this table to select specific barcode combinations for different multiplex levels to help prevent registration failures. P5 58 nt Location and index of adapter sequences GTTCGTCTTCTGCCGTATGCTCTA-INDEX-CACTGACCTCAAGTCTGCACA P7 57 nt PCR Primer 1.0 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC Rd1 Seq Primer GCTCTTCCGATC*T CGAGAAGGCTAG-P Index Sequence P-GATCGGAAGAGC T*CTAGCCTTCTCG Read Seq Primer The adapter is ligated to both ends of the A-tailed DNA library The 12 nucleotides of the adapter adjacent to the sequence-of-interest (shown in blue) are complementary, allowing them to anneal and form the forked structure PCR Primer 2.0 ACACGTCTGAACTCCAGTCAC-INDEX-ATCTCGTATGCCGTCTTCTGCTTG TAGAGCATACGGCAGAAGACGAAC CAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA Figure 2. Location of index and adapter sequences in final library. Index and adapter sequences used to identify your template DNA are shown. The last 12 nt of the adapters are complementary, allowing them to anneal and form the forked structure. The adapter is ligated to both ends of the A-tailed DNA library. 19 P5 58 nt P7 57 nt

20 B. Frequently asked questions 1. What are the recommended applications for the SGI-DNA NGS Library Construction Kit? Whole-genome shotgun sequencing Plasmid sequence verification 2. What are the input DNA requirements? The protocol provided here has been validated for library construction of ng of appropriately fragmented dsdna. 3. What are the major steps in library construction? End repair and A-tailing, which produces end repaired 5 phosphorylated, 3 da tailed, dsdna fragments Adapter ligation, during which dsdna adapters with 3 -dtmp overhangs are ligated to 3 -da-tailed library fragments Library amplification, which employs high-fidelity, low-bias PCR to amplify library fragments carrying appropriate adapter sequences on both ends 4. What are your Covaris shearing recommendations? If you are performing a cleanup between shearing and end repair, shear in 10 mm Tris-HCl (ph 8 or 8.5) + 1 mm EDTA If you are not performing a cleanup between shearing and end repair, shear in 10 mm Tris HCl (ph 8 or 8.5) mm EDTA Never shear DNA in water 5. What if I am unsure of whether there is or what the concentration of EDTA is in my sample? Perform column or bead-based purification or buffer exchange and resuspend in 10 mm Tris HCl, ph Is enzymatic fragmentation compatible with the NGS Library Construction Kit? Mechanical shearing is highly recommended. Enzymatic shearing is not always completely random and may introduce sequencing bias. We recommend mechanical shearing to ensure the best possible sequencing results. 7. Can I assess the outcome of my fragmentation before proceeding into library preparation? While it is possible to remove aliquots of the fragmentation reaction product for analysis in the integrated fragmentation/library construction workflow, it is most productive to assess the outcome of fragmentation once the entire workflow has been completed for the following reasons: It is difficult and disruptive to process low-volume aliquots in a way that is fully representative of the final library. Fragmentation profiles for low-input samples (1 10 ng) may not be informative, even when high sensitivity assays are used. 8. What adapters should I use with this kit? Adapters provided in the NGS Library Construction Kit are 6 nt single-index adapters similar to those used in TruSeq technology. 20

21 9. What QC testing is performed on Adapters? Optimal library construction efficiency, conversion rate: yield of adapter-ligated library (before amplification) by qpcr as a % of input DNA Minimal levels of adapter-dimer formation, modified library construction protocol designed to measure adapter dimer with high sensitivity (0 2%) Nominal levels of barcode cross-contamination, sequenced by MiSeq : % correct insert to total insert by each barcode, 115, ,000 each. Total level of contamination for any barcode is ~ %, measuring chemical crosscontamination and adapter cross-talk. 10. What is the proportion of fragmented DNA that is converted to adapter-ligated molecules? The proportion of fragmented DNA that is successfully converted to adapterligated molecules decreases as input is reduced. When starting end repair/a-tailing with >10 ng fragmented genomic DNA, 5 35% of input DNA is typically recovered as adapter-ligated molecules. 11. What enzyme is used for amplification? A low-bias, high-efficiency, high-fidelity DNA Polymerase is used for PCR. 12. How do I assess the quality of my library after preparation? Library size distribution, and the absence of primer dimers and/or overamplification products should be confirmed by means of an electrophoretic method. qpcr-based quantification of libraries prior to pooling for target capture or sequencing. qpcr-based quantification of adapter-ligated libraries (prior to library amplification) is not routinely done, but can provide useful data for protocol optimization and troubleshooting. Technical Services: For technical assistance, contact technical services at techservices@sgidna.com or (toll-free within North America) (outside North America) 2017 Synthetic Genomics, Inc. All rights reserved. 21