Genetic Analysis and Fine Mapping of Two Genes for Grain Shape and. Weight in Rice. State Key Lab for Rice Biology

Transcription

1 Genetic Analysis and Fine Mapping of Two Genes for Grain Shape and Weight in Rice Longbiao Guo 1, Lilian Ma 1,2, Hua Jiang 1, Dali Zeng 1, Jiang Hu 1, Liwen Wu 1,2, Zhenyu Gao 1, Guangheng Zhang 1 and Qian Qian 1 * 1 State Key Lab of Rice Biology, China National Rice Research Institute, Hangzhou , China; 2 Graduate School of Chinese Academy of Agricultural Sciences, Beijing , China; *Corresponding author: State Key Lab for Rice Biology China National Rice Research Institute Hangzhou , China Tel: Fax: qianqian188@hotmail.com

2 Abstract To identify genetic loci controlling grain weight, F 2, F 3 and BC 2 F 2 derived from a cross between indica rice variety Baodali with large grains and japonica rice variety Zhonghua11 with normal grains were used as mapping populations. Linkage analyses demonstrated that two genes controlling grain weight, designated as GW3 and GW6, were mapped to chromosome 3 and chromosome 6, respectively. Fine mapping delimited GW3 to a 122kb physical distance between two STS markers (WGW16 and WGW19) containing 16 ORFs annotated by TIGR ( GW6 was further mapped between two SSR markers (RM7179 and RM3187). These results are useful for both marker assisted selection (MAS) of grain weight, and for further cloning of GW genes, which will contribute to the dissection of the molecular mechanism underlying grain weight in rice. Key words: rice; grain size; primary mapping; fine mapping; marker assisted selection (MAS)

3 Grain weight is one of the three yield components and is of great importance for rice yield. Generally it is indicated as one-thousand-grain weight, which is an integrated index of grain length, width and thickness. Grain length determines seed appearance, and affects milling, cooking and eating quality of rice (Fan et al. 2006). Furthermore, grain weight is important in the evolution of cereal crops because large grains tended to be selected during the early domestication process, as evidenced by the fact that most cultivated species have larger grains than their wild relatives (Li et al. 2004). Since the 1960 s, breeding of large grain varieties has been developed and increasing attention has been paid to improving rice production because large grain is considered one of the key factors for super-rice development. Grain weight is a highly heritable characteristic (40%-60% (Ma et al. 2006)), and several independent studies on rice have been conducted systematically. Shi et al. (1995) reported that grain-weight trait was controlled by multiple genes with dominant effects. Panwar et al. (1983) showed that it was determined by both additive and dominant effects. Because grain weight is a complex trait controlled by multiple genes, it is difficult to map and clone grain-weight related genes. Through the use of molecular biology, a series of quantitative trait loci (QTL) for grain weight have been identified. So far, at least 89 rice grain weight related QTL have been detected and they are distributed on all of 12 chromosomes (Ma et al. 2006). Among them, QTL on chromosome 3 have been identified in several independent studies using different populations. Lin and Wu (2003) identified 16 grain-weight QTL using a recombinant inbred line (RIL) population of H395/Acc8558, and five of them were located on chromosome 3. Additionally, one locus in the pericentromeric region of chromosome 3 has been frequently detected as a major QTL for both grain weight and grain length in many studies with different populations: the crosses of Lemont x Teqing (Li et al. 1997), Zhenshan 97 x Minghui 63 (Xing et al. 2002), V20 x Oryza rufipogon (Xiao et al. 1998), Labelle x Black Gora (Redon a and Mackill 1998), and Asominori x IR24 (Kubo et al. 2001). Li et al. (2004) recently fine-mapped a grain weight QTL, GW3.1, to a 93.8-kb region on chromosome 3 with a set of near-isogenic lines (NILs) from the cross between Oryza sativa, cv, Jefferson and O. rufipogon based on five generations of backcrossing and seven generations of selfing. Fan et al. (2006) isolated a major QTL, GS3, located in the same region using the BC 3 F 2 of Minghui 63/Chuan 7. There seems to be a cluster of QTL/genes controlling yield-related traits in this region of chromosome 3 (Moncada et al. 2001, Brondani et al. 2002,

4 Thomson et al. 2003, Yu et al. 1997, Xing et al. 2001). Recently, QTL GW2 on chromosome 2 for rice grain width and weight, a QTL Ghd7 controlling multiple traits (including number of grains per panicle, plant height and heading date), and a newly identified QTL qsw5 for seed width have been isolated via a map-based cloning strategy (Song et al. 2007, Xue et al. 2008, Shomura et al. 2008). However, only a few QTL have been detected on chromosome 6 (Li et al. 1997; Lu et al. 1997; Xing et al. 2002; Ishimaru et al. 2003; Guo et al. 2003). In this study, an F 2 population derived from a cross between a large grain variety (Baodali) and a normal grain-weight variety (Zhonghua11) was used as population for primary mapping, and large-scale F 2, F 3 and BC 2 F 2 populations were used as the fine-mapping populations. We identified two genetic loci contributing to grain weight and generated a fine-scale map of the genetic region. These results will not only help future characterization of the molecular mechanisms underlying grain size and weight, but also facilitate the design and breeding of super rice. Results Identification of grain traits in an F 2 segregation population The phenotypes of the two rice parents Baodali and Zhonghua11 are shown in the Table 1. No large grain phenotype was observed in the F 1 population of Baodali/Zhonghua11 (Table 1), indicating that the trait was controlled by recessive genes. The grain weight trait showed a continuous distribution, inconsistent with Mendelian single-gene segregation in the F 2 population. This is indicated that grain weight trait was controlled by multiple genes. Ninety-seven individuals with extremely large grains (as large as Baodali) were selected from the F 2 population for primary mapping (Figure 1). Mapping of the QTL for grain weight The recessive F 2 individuals of Baodali/Zhonghua11 with extremely large grains were selected as mapping population. One hundred and fifty SSR markers, evenly distributed on the 12 rice chromosomes, with polymorphisms between Baodali and Zhonghua11 were used to detect the

5 genotypes of the 97 individuals (Figure 2). Linkage analysis identified two QTL: one, GW3, was primarily mapped within a 28.8 cm region between SSR markers RM6836 (54.1 cm) and RM1340 (82.9 cm) on chromosome 6 (Figure 3), and the other, GW6, spanned a 7.5 cm region between SSR markers RM282 (55.8 cm) and RM6080 (63.3 cm) on chromosome 3 (Figure 4). Two different large-grain phenotypes existed in the F 2 population, long large-grain and round large-grain, to which the two identified loci might correspond. Therefore, an F 3 population was constructed for further confirmation. Relationship between grain length/width ratio and GW3 or GW6 According to the grain length/width ratio, 168 F 3 large-grain plants were classified into three types: 55 with round large grains, 54 with long large grains and 59 with middle large grains. Their grain length/width ratios ranged from <2.5, >2.75 and , respectively. In order to detect the relationship between grain length/width ratio and GW3 or GW6, 109 plants with grain length/width ratios >2.75 or <2.5 from the 168 F 3 plants were analyzed for genotypes with SSR markers RM282 and RM6080 on chromosome 3, and RM6836 and RM1340 on chromosome 6. Of the 55 round large-grain plants, 37 and 44 plants had the same band pattern as Baodali for RM282 and RM6080 respectively, and their recombination rates to the target locus were 16.36%-32.72% and 10%-20%. Of the 54 long large-grain plants, 44 and 43 plants had the same band pattern as Baodali for RM282 and RM6080 respectively, and their recombination rates to the target locus were 10.2%-20.4% and 11.22%-22.44%. Compared with round large-grain, long large-grain was mostly controlled by GW3. Of the 55 round large-grain plants, 45 and 45 plants had the same band pattern with Baodali for RM6836 and RM1340 respectively, and their recombination rates to the target locus were both 9.1%-18.2%. Of the 54 long large-grain plants, 35 and 35 plants had the same band pattern with Baodali for RM6836 and RM1340 respectively, and both of their recombination rates to the target locus were 19.39% %. Therefore, GW6 appears to control the round large-grain trait. Confirmation of GW6 and delimitation of GW3 to a 122-kb interval 168 plants showing the extreme large-grain phenotype from 2669 F 3 plants were selected for

6 confirmation of the genetic region of GW6. Fifteen SSR markers spanning RM6836 to RM1340 with polymorphisms between Baodali and Zhonghua11 were utilized for detecting genotypes. Linkage analysis showed that the GW6 locus was further narrowed down to a 4.7 cm region between RM7179 and RM3187 ( cm) on chromosome 6 (Figure 3b). To facilitate the identification of progeny phenotype and decrease the effects of other QTLs, a backcrossed population using Zhonghua11 as a recurrent parent was constructed. Of the two backcrossed generations and one inbred generation, 674 individuals possessing Baodali s phenotype were selected from the BC 2 F 2 population for fine mapping of GW3. BLASTN ( was employed to search for sequences that matched RM282 and RM5551 in the rice nucleotide database. RM282 and RM5551 corresponded to sequences in AC and AC120529, respectively. Based on the BAC clone sequences, five overlapping BAC clones covering the GW3 locus region were identified (Figure 4b). Polymorphisms were detected in 9 of 60 newly developed STS markers (Table 2). Primers derived from these markers were subsequently used for individual genotyping, through which GW3 was mapped between the newly identified STS markers WGW16 and WGW19, within a 122-kb physical distance containing 16 ORFs predicted by TIGR ( (Figure. 4c). Comparison of the mapped QTL for grain weight in our study with previous reports QTL for grain weight on chromosome 6 have been detected by Li et al. (1997), Lu et al. (1997), Xing et al. (2002), Ishimaru et al. (2003) and Guo et al. (2003). To facilitate the comparison of QTL locations, the GW QTL/genes detected in these experiments were aligned on the Baodali/Zhonghua11 map presented in Figure 3b, while the previously identified QTL regions were also located between 57.1 cm and cm, however the relationship between them still needs to be confirmed (Figure 3). Discussion Rich rice germplasm resources and a series of mutants are reserved and available in China as a broad basis for genetic research and functional genomics (Li et al. 2003; Guo et al. 2006). In this study, an elite variety with large grains, Baodali, was used as the mapping material, a different

7 variety from the usual mutants have been studied for mapping before (such as moc1 and bc1 (Li et al. 2003; Li et al. 2004)). Rice variety Baodali has an obvious phenotype that is similar to mutants, so we used the extreme sampling way to select the GW phenotype from the segregating populations and analyzed the linkage markers with the parent phenotype (large-grain character). Two grain weight-associated genes, GW3 and GW6, were detected using the elite variety Baodali with large grains and progeny of Baodali/Zhonghua11. Therefore, it was feasible to use these extreme materials and their F 2 populations for mapping, and the extreme sampling method could be applied for identification of the major multi-genes with extremely phenotype in special germplasm. Two major genes for grain weight, GW3 and GW6, were identified in the present study. RM cM), linked with GW3, is located in the same region on chromosome 3 detected by others (Fan et al 2006, Xiao et al. 1998, Brondani et al. 2002, Thomson et al. 2003, Aluko et al. 2004, Li et al. 2004). GW6 has been detected in four mapping populations (Li et al. 1997, Xing et al. 2002, Ishimaru et al. 2003, Guo et al. 2003) and is located between 57.1 cm and cm. According to the relationship between grain length/width ratio and GW3 or GW6, GW3 could control the long large-grain trait that is identical to, or linked with, GS3, which is a major QTL for grain length and weight and minor QTL for grain width and thickness in rice (Fan et al. 2006). GW6 could control the round large-grain trait and was near the QTL region (gw6) identified by Ishimaru (2003), although the exact position of GW6 in the study needs to be further confirmed. Gw3 was fine mapped in chromosome 3 and located on the same BAC as AC with gs3, but gs3 is in the middle of the BAC, and gw3 is near the end. Further experiments are needed to confirm whether they are in the same locus. Nearly Isogenic Lines (NILs) harboring the target QTL, constructed by backcrossing with a recurrent parent, could simplify or eliminate the effect of genetic background on the expression of a QTL, facilitating fine mapping and isolation of the target gene. Self-pollination of the BC 2 F 1 plants, heterozygous for this fragment, resulted in a pair of NILs with the target gene with almost all the genetic background of recurrent parent except the introgressed segment. Through field examination we determined that the three genotypes differed significantly in an array of traits. In this study, we constructed gw3-nil and gw6-nil. GW3 was mapped to a 122 kb region using BC 2 F 2 populations. GW6 was mapped to a 4.7 cm region with the same populations but proved

8 difficult to further map owing to the lack of informative recombinants, polymorphisms between the parents and the noise of the genetic background in the BC 2 F 2 population. It is possible that both two genes could be isolated by use larger NIL populations. Plant scientists and rice breeders have paid great attention to the improvement of rice yield. Some genes controlling three important components of rice yield have been reported. Li et al. (2003) cloned a switch gene for rice tillering, MOC1, which encodes one of GRAS family proteins. Subsequently, one QTL for number of grains per panicle, Gn1a, was cloned and functionally characterized (Ashikari et al. 2005). In our study two genes gw3 and gw6 controlling the large-grain trait were identified and the construction of NIL-gw populations are in progress. The linkage markers RM6080/RM282 and RM7179 should also be helpful for Marker Assisted Selection (MAS). MAS is a very convenient and efficient breeding strategy in which conventional breeding selection is carried out on a marker genotype linked to target traits, rather than on the traits themselves. Except the construction of an NIL-gw6 population, pyramiding of GW6, MOC1 and Gn1 multi-genes for super-rice breeding is in progress. Materials and methods Plant materials An elite rice variety Baodali with large grains of 48.8 g/one-thousand-weight, selected from the germplasm pool at China National Rice Research Institute (Ma et al. 2006) was crossed with a lower grain-weight rice variety, Zhonghua11. Their F 2, F 3 and BC 2 F 2 with the recurrent parent Zhonghua11 were constructed as mapping populations (Figure 5). All segregation populations and their parents were cultivated in an experimental field of China National Rice Research Institute during the natural growing season from 2003~2007. Identification of grain trait in F 2 segregation population Of 750 F 2 plants from Baodali/Zhonghua11 cross, 97 individuals with extremely large grains were screened for primary mapping. DNA extraction and marker exploration

9 Total DNA was extracted from fresh leaves of each individual using the cetyltrimethylammonium bromide (CTAB) method with minor modifications (Murray and Thompson 1980). Simple sequence repeat (SSR) exploration and PCR protocols were as described by Akagi et al. (2001). The PCR products were separated on a 3.0%-5.0% agarose gel according to the lengths of the amplified fragments and stained with ethidium bromide (Jiang et al. 2006). Linkage analysis The band pattern of F 2 individual identical with that of Baodali or Zhonghua11 was marked as 1 or 2, respectively, and a hybrid pattern marked as 3. A linkage map was constructed with Mapmaker 3.0 (Lander et al. 1987) on the basis of the linkage data of the grain weight loci and polymorphic SSR markers in the F 2 population. Distinguishing traits by MAS In order to identify the relationship between grain length/width ratio and GW3 or GW6, 168 individuals were selected from the F 3 of Baodali/Zhonghua11 for determination of grain length and width (Figure 1a). Meanwhile, some individuals with extremely long or round grains were selected for genotype analysis by linkage markers of GW3 and GW6. Fine mapping of GW3 and GW6 F 3 and BC 2 F 2 with Zhonghua11 as a recurrent parent derived from BaoDali/ZhongHua11 cross were further developed for fine mapping of GW6 and GW3, respectively. 168 individuals having extremely large grains from 2669 F 3 plants were selected for narrowing down GW6 by linkage analysis mentioned in BC 2 F 2 individuals derived by self-pollination of the BC 2 F 1 heterozygotes were used to narrow down the gw3 locus. 9 of 60 newly developed STS markers were detected for polymorphisms analysis and gw3 fine mapping (Table 2). Acknowledgements This study was supported in part by a grant from the National Natural Science Foundation of China ( ) and a grant from the National Basic Program of China (2005CB120807

10 2006AA10A102). References Akagi H, Yokozeki Y, Inagaki A, Mori K, Fujimura T (2001). Micron, a microsatellite-targeting transposable element in the rice genome. Mol Genet Genomics 266, Aluko G, Martinez C, Tohme J, Castano C, Bergman C, Oard JH (2004). QTL mapping of grain quality traits from the interspecific cross Oryza sativa ho. glaberrima. Theor Appl Genet 109, Ashikari M, Sakakibara H, Lin SY, Yamamoto T, Takashi T, Nishimura A et al. (2005). Cytokinin oxidase regulates rice grain production. Science 309, Brondani C, Rangel N, Brondani V, Ferreira E (2002). QTL mapping and introgression of yield-related traits from Oryza glumaepatula to cultivated rice (Oryza sativa) using microsatellite markers. Theor Appl Genet 104, Fan CC, Xing YZ, Mao HL, Lu TT, Han B, Xu CG et al. (2006). GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet 112, Guo LB, Chu CC, Qian Q (2006). Rice mutants and functional genomicschinese Bulletin of Botan 23, 1-13 (in Chinese with an English abstract). Guo LB, Luo LJ, Xing YZ, Xu CG, Mei HW, Wang YP et al.(2003). Dissection of QTLs in two years for important agronomic traits in rice. Chinese J Rice Sci 17, (in Chinese with an English abstract). Ishimaru K (2003). Identification of a locus increasing rice yield and physiological analysis of its function. Plant Physiology 133, Jiang H, Guo LB, Xue DW, Zeng DL, Zhang GH, Dong GJ et al.(2006.genetic analysis and gene-mapping of two reduced-culm-number mutants in rice. Journal of Integrative Plant Biology 48, Kubo T, Takano-kai N, Yoshimura A (2001). RFLP mapping of genes for long kernel and awn on chromosome 3 in rice. Rice Genet Newsl 18, Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoin SE et al. (1987). Mapmaker: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1, Li J, Xiao J, Grandillo S, Jiang L, Wan Y, Deng Q (2004). QTL detection for rice grain quality traits using an interspecific backcross population derived from cultivated Asian (O. sativa L.) and African (O. glaberrima S.) rice. Genome 47, Li JM, Thomason M, McCouch SR (2004). Fine mapping of a grain-weight quantitative trait locus in the pericentromeric region of rice chromosome 3. Genetics 168, Li XY, Qian Q, Fu Z, Wang YH, Xiong GS, Zeng DL et al. (2003). Control of tillering in rice. Nature 422, Li Yunhai, Qian Qian, Zhou Yihua, Yan Meixian, Sun Lei, Zhang Mu, et al. (2003). BRITTLE CULM1, which encodes a COBRA-like protein, affects the mechanical properties of rice plants. Plant Cell 15, Li ZK, Pinson SR, Park WD, Paterson AH, Stansel JW (1997). Epistasis for three grain yield components in rice. Genetics 145,

11 Lin LH, Wu WR (2003). Mapping of QTLs underlying grain shape and grain weight in rice. Molecular Plant Breeding 1, Lu CF, Shen LS, Tan ZB, Xu YB, He P, Chen Y et al. (2007). Comparative mapping of QTLs for agronomic traits of rice across environments by using a doubled-haploid population. Theor Appl Genet 94, Ma LL, Guo LB, Qian Q (2006). Germplasm resources and genetic analysis of large grain in rice. Chinese Bulletin of Botany 23, (in Chinese with an English abstract). Moncada P, Martinez CP, Borrero J, Chatel M, Gauch H Jr, Guimaraes E ( 2001). Quantitative trait loci for yield and yield components in an Oryza sativa /Oryza rufipogon BC 2 F 2 population evaluated in an upland environment. Theor Appl Genet 102, Murray MG, Thompson WF (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8, Panwar DVS, Paroda RS (1983). Combining ability for grain character in rice. India Journal of Agricultural Science 53, Redon a ED, Mackill DJ (1998). Quantitative trait locus analysis for rice panicle and grain characteristics. Theor Appl Genet 96, Shi CH (1994). Seed shape and breeding for good quality in rice. Chinese Agricultural Science Bulletin 10, Shomura A, Izawa T, Ebana K, Ebitani T, Kanegae H, Konishi S, Yano M (2008). Deletion in a gene associated with grain size increased yields during rice domestication. Nature Genet. 2008, online. Song XJ, Huang W, Shi M, Zhu MZ Lin HX (2007). A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nature Genet 39(5), Thomson MJ, Tai TH, McClung AM, Lai X H, Hinga ME, Lobos KB (2003). Mapping quantitative trait loci for yield, yield components and morphological traits in an advanced backcross population between Oryza rufipogon and the Oryza sativa cultivar Jefferson. Theor Appl Genet 107, Xiao JH, Li J, Grandillo S, Ahn SN, Yuan LP, Tanksley SD (1998). Identification of trait-improving quantitative trait loci alleles from a wild rice relative, Oryza rufipogon. Genetics 150, Xing YZ, Tan Y F, Hua JP, Sun XL, Xu CG, Zhang Q (2002). Characterization of the main effects, epistatic effects and their environmental interactions of QTLs on the genetic basis of yield traits in rice. Theor Appl Genet 105, Xing YZ, Tan Y F, Xu CG, Hua JP, Sun XL (2001). Mapping quantitative trait loci for grain appearance traits of using a recombinant inbred line population. Acta Bot Si. 43, Xue WY, Xing YZ, Weng XY, Yu Z, Tang WJ, Wang L, et al. (2008). Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nature Genetics 40, Yu SB, Li JX, Xu CG, Tan Y F, Gao YJ, Li XH (1997). Importance of epistasis as the genetic basis of heterosis in an elite rice hybrid. Proc. Natl Acad Sci USA 94,

12 Table 1. Phenotypes of the two rice parents Baodali and Zhonghua11 Grain weight Grain length Grain width Plant height (g/1000 grains) (cm) (cm) (cm) Baodali Zhonghua F

13 Table 2. Sequences of newly developed STS primers Name Forward(5-3 ) Reverse(5-3 ) wgw1 CCATAAGATGCAGGCCGTTGT CAGCTTTGGTCAGATGGTCAC wgw2 TGGTCGTGTCATGTCGTTCTT AGGTAAAGGGATGAGGCTGTT wgw3 GTCACAAATAGTACTGCAACA CTTTCCTCACCTACATCCCTC wgw4 GAGATTGATGCTTGTTGATAG ATGCCTGAAAAGTAAGAAGTT wgw5 GCGCGCCGTAATATAAGAGC AGAGGGGGCACGTGAAGCAG wgw9 TCATATTATTATTGCTGAGTAGGT ACACACATAGTGGGCATTTT wgw16 ACTTGACGAATCTTTATTTGCT TGTGTTTCTTGGAATTTAGACTTA wgw17 TGCTCTAGTTTTAATAGTTGGA CAACGAGCAAAAATGAATAA wgw19 ACCAAAATGGAATACCGAACG TAACAACACGCAATAGAAGG

14 a b Baodali Zhonghua11 c Baodali Zhonghua11 Figure 1. Phenotypes of the two parent rice varieties. a. Grain phenotypes. 1 Zhonghua11; 7- Baodali; 2-6: the segregating population; 8 - round large-grain; 9 - long large-grain; b. Panicles; c. Mature plants. Bar, 1 cm.

15 Figure 2. Linkage analysis of grain-weight QTL and SSR markers. Segregation of the SSR marker RM282 in the F 2 population of Baodali/Zhonghua11. P1: Baodali; P2: Zhonghua11; F 1 : Baodali/ Zhonghua11; 24: Recessive individuals in F 2 population.

16 CHR6 cm Marker cm Marker 10.8 RM225 RM584 RM RM6836 RM a RM193 RM7179 gw6 RM b c d RM1340 RM7579 RM7434 RM RM4447 RM1340 RM6734 Figure 3. Linkage map of gw6 on rice chromosome 6. a. The locus mapped by Guo et al (2003). b. The locus mapped by Xing et al (2002). c. The locus mapped by Li et al (1997). d. The locus mapped by Ishimaru et al (2003).

17 Figure 4. Rough-scale, high-resolution genetic and physical map of gw3 on chromosome 3. a. Primary mapping of the gw3 allele region. Numbers between the SSR markers indicate genetic distance (cm). b. High-resolution genetic map of the gw3 allele region based on recombination events between the markers and the gw3 locus (the number in parenthesis indicates recombinants and serial number under the horizontal line represents BAC register number). c. Candidate region of the gw3 locus and the presumed ORFs predicated by TIGR.

18 Figure 5. Construction of the genetic populations derived from the parents Baodali/Zhonghua11.