SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
|
|
- Prudence McCarthy
- 5 years ago
- Views:
Transcription
1 SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
2 Agenda 12:45 - Welcome and Survey- Allen Van Deynze (UC Davis) 1:00 - Marker technologies Allen Van Deynze 1:50 - Analyzing quantitative trait loci Hamid Ashrafi (UC Davis) 2:40 - Break Marker assisted selection in tomato David Francis (The Ohio State University) 3:45 - Effects of population structure of genetic analysis Allen Van Deynze 4:35 - Survey
3 Marker types Allen Van Deynze
4 Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering, PCA, etc.) Breeding Alternative or support to selection for traits Increase rate of genetic gain: Selection during off-season cycles Selection of hybrid traits on inbred individuals Early selection (e.g. pre-flowering) Parental Selection Marker Based Parent Similarity Marker based estimated variance within a population Genetic distance between parents Trait Analysis Association of traits with genomic regions Understanding trait relationships (linkage vs. pleiotropy) Understanding causes of variation (aid in gene cloning) Marker Assisted Breeding Marker Assisted Backcrossing Quality Assurance Parent-offspring tests, Genetic purity tests, Event tests
5 Marker assisted selection DNA marker Fruit ripening
6 The # of Markers Needed Depends on Goals Protect varieties: 100s of markers Classify germplasm: 100s mapped ID tightly linked QTLs in linkage studies - 100s mapped ID candidate genes and association studies - saturated map. Depends on number of chromosomes Depends on size of genetic map (cm)
7 DNA RNA Protein Trait The Central Dogma of molecular biology is that the information in the DNA sequence is transcribed into mrna, which is then translated into proteins. Proteins are large molecules that are the enzymes and structural components of living cells = trait Image compliments of National Human Genome Research Institute
8 Marker types RFLPs RAPDs AFLPs SSRs SNPs SFPs Others
9 Restriction Fragment Length Polymorphism (RFLPs) cdna clones Genomic clones
10 RFLPs Co-dominant Detect all alleles simultaneously Good across related species Basis (anchors) of many species maps Too costly and labor intensive for breeding
11 Random Amplified Polymorphic DNA (RAPDs) University of Saskatchewan
12 RAPDs No sequence information needed Universal primer set Reproducibility problems
13 Amplified Fragment Length Polymorphism Restriction enzyme digestion genomic DNA Adaptor ligation Selective PCR amplification AFLP fingerprint
14 AFLP characteristics multiplex PCR Competition PCR : quantitative detection No sequence information required Size-based fragment discrimination Transcript and marker discovery Transcript and marker detection Universal technology (proprietary)
15 Marker types Inter MITE Polymorphism (IMP), interssr, Inter RGA Amplifies DNA between MITEs (miniature inverted-repeat transposable elements) MITEs PCR Amplification Template DNA Terminal inverted repeats Inter The MITEs Each numerous end are DNA well of the is polymorphic distributed amplified MITE by characterized throughout bands create PCR most by a an genomes distinct inverted fingerprint repeat sequence for each line
16 IMP and other Inter markers High multiplexing value 15 to 75 loci per reaction High throughput Cost-effective Tomato Distributed throughout the genome in gene rich regions Good level of intra-species variation High level of cross applicability Dominant markers May not be in coding regions
17 Simple Sequence Repeat (microsatellites) tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag PCR
18 Simple Sequence Repeats Medium abundance Medium throughput Available in many crops Need sequence information May or may not be associated with genes
19 Single-nucleotide polymorphisms (SNPs) cgtgtactgacctgcatgctatgaatcagtacatcgactagctt cgtgtactgacctgcatgctaggaatcagtacatcgactagctt Highly abundant roughly 1 per base pairs Distributed throughout genome including genes Genetically stable Typically biallelic Can be scored as a +/- marker Mutation may be diagnostic
20 SNPs Limited information per locus Need sequence information
21 Single Feature Polymorphisms Genotype 1 Genotype 2 Genotype 3 A B C D G H I M N E F J K L Probe Intensity A B C D E F G H I J K L M N SFP
22 SFPs Based on SNPs and Insertion/deletions Abundant Distributed throughout genome including genes Genetically stable Highly multiplexable Dominant Need sequence information
23 Why move to SNP maps? Microsatellite markers create maps with large gaps- appropriate for within family studies SNPs SNPs create dense maps to pinpoint regions across the population
24 Marker Detection Hybridization Amplification Electrophoresis Fluorescence
25 Polymerase Chain Reaction Taken from the National Health Museum gallery
26 SNP technologies Hybridization Single base pair extension Allele-specific PCR
27 Agarose Gel Electrophoresis Easy Universal Expensive Low throughput Use RAPDs SSRs SNPs RFLPs AFLPs
28 Automated Gel Electrophoresis Easy High resolution Automated High throughput Expensive equip Use SSRs AFLPs SNPs IMPs
29 Real Time PCR
30 Real-Time PCR cont d Easy Automated High throughput Expensive equip Use SNPs
31 96 samples x 96 assays Fluidigm
32 Pyrosequencing Automated Medium throughput Expensive equip Use SNPs
33 Invader Assay for SNP Detection Biplex FRET Format Cleavage Site Cleavage Site Invader Oligo A WT Probe Invader Oligo C Mut Probe Target T Released 5 Flap A Cleavage Site F1 Q F2 Q G Released 5 Flap C Cleavage Site Target A C FRET Cassette 1 FRET Cassette 2 F1 F2
34 Invader Automated High throughput Highly sensitive Flexible Quantitative Minimum amount reagents required Use SNPs
35 Mass Spec
36 Mass Spec Medium throughput Multiplex Inexpensive reagents Automated Need amplification Expensive equipment
37 Microarrays Automated High throughput Highly sensitive Multiplex Expensive equip Semi-Fixed assays Use SNPs
38 Liquid Arrays Automated High throughput Highly sensitive Multiplex Flexible Expensive equip Use SNPs
39 Illumina 2-60,000 SNPs x 96 samples $< /dp
40 Experimental Procedure
41 Marker Attributes Marker RFLPs RAPDs SSRs AFLPs/ IMPs SFPs SNPs Development costs high low high low high med-high Technical complexity high low low med med low Automated no no med med semi yes Reproducibility high low high med med high Cross species yes no yes no yes no Segregation co-dom dom co-dom dom dom co-dom Information content genomic/ gene none genomic none genomic / genes genomic/ genes Cost/datapoint high low med low low For Breeding no no yes yes no yes $ $<
Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationPCB Fa Falll l2012
PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High
More informationMICROSATELLITE MARKER AND ITS UTILITY
Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationInternational Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize
International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México Choice of Marker Systems and Genotyping Platforms Yunbi Xu International Maize and Wheat Improvement
More informationExisting potato markers and marker conversions. Walter De Jong PAA Workshop August 2009
Existing potato markers and marker conversions Walter De Jong PAA Workshop August 2009 1 What makes for a good marker? diagnostic for trait of interest robust works even with DNA of poor quality or low
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationUsing molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationINTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS
ORIGINAL: English DATE: October 21, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND DATABASE CONSTRUCTION (
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationComparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean
EUROPEAN ACADEMIC RESEARCH Vol. IV, Issue 2/ May 2016 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability
More informationINTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA
E BMT Guidelines (proj.4) ORIGINAL: English DATE: December 21, 2005 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationGDMS Templates Documentation GDMS Templates Release 1.0
GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationIndex. Index 377. ASH, see Allele-specific hybridization
Index 377 Index A Allele-specific hybridization (ASH), genotyping principles, 14, 15 Amplification refractory mutation system-polymerase chain reaction (ARMS-PCR), cystic fibrosis diagnosis, amplification,
More informationWORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Twelfth Session Ottawa, Canada, May 11 to 13, 2010
E BMT/12/9 ORIGINAL: English DATE: April 9, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR
More informationOverview. Introduction
Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection
More informationBioinformatics (Lec 19) Picture Copyright: the National Museum of Health
3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationComparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Hamid Ashrafi Amanda M. Hulse, Kevin Hoegenauer, Fei Wang,
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationMOLECULAR TYPING TECHNIQUES
MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationDepartment of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy
Department of Biotechnology Molecular Markers Nitin Swamy In plant breeding 17 1. Introduction Molecular breeding (MB) may be defined in a broad-sense as the use of genetic manipulation performed at DNA
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationGene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants
Critical Reviews in Plant Sciences, 20(3):251 275 (2001) Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants S. A. Ranade, * Nuzhat Farooqui, Esha Bhattacharya,
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationBefore starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationPCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?
What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by
More informationRFLP: Restriction Fragment Length Polymorphism
RFLP: Restriction Fragment Length Polymorphism RFLP (Restriction Fragment Length Polymorphism) In molecular biology, the term restriction fragment length polymorphism, or RFLP, (commonly pronounced rif-lip
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More informationMolecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers.
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers. DNA, the stuff of life. We can think of DNA as a biochemical entity or as a data string. With the advent of high throughput
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationDNA Analysis Students will learn:
DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationPlant breeding QTL (Quantitative Trait Loci)
Plant breeding Methods and use of classical plant breeding. Molecular marker technology, Marker assisted selection in plant breeding. QTL (Quantitative Trait Loci), Genetic analysis and characterization
More informationApplication of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato
Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationPCR-based technologies Latest strategies
Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies Latest strategies (DNA sequencing, ESTs, microarrays, DArT, SNPs) Copyright: IPGRI
More informationON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS
ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS David Canter, Di Wu, Tamara Summers, Jeff Rogers, Karen Menge, Ray Radtkey, and Ron Sosnowski Nanogen,
More informationPCR Techniques. By Ahmad Mansour Mohamed Alzohairy. Department of Genetics, Zagazig University,Zagazig, Egypt
PCR Techniques By Ahmad Mansour Mohamed Alzohairy Department of Genetics, Zagazig University,Zagazig, Egypt 2005 PCR Techniques ISSR PCR Inter-Simple Sequence Repeats (ISSRs) By Ahmad Mansour Mohamed Alzohairy
More informationA. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:
Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationPOLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence
POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationYour name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07
BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationRFLP: Restriction Fragment Length Polymorphism
RFLP: Restriction Fragment Length Polymorphism Various endonucleases: 6 cutters and 4 cutters Enzyme Source Recognition Sequence Cut EcoRI Escherichia coli 5'GAATTC 5'---G/AATTC---3' EcoRII Escherichia
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationSept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationMolecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98
Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010
More informationB.D. Singh. A.K. Singh. Marker-Assisted Plant. Breeding: Principles. and Practices. ^ Springer
BD Singh AK Singh Marker-Assisted Plant Breeding: Principles and Practices ^ Springer Contents Part I General 1 Introduction to Marker-Assisted Crop Improvement 3 11 Introduction 3 12 Domestication: The
More informationCHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More information