SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

Size: px
Start display at page:

Download "SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze"

Transcription

1 SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

2 Agenda 12:45 - Welcome and Survey- Allen Van Deynze (UC Davis) 1:00 - Marker technologies Allen Van Deynze 1:50 - Analyzing quantitative trait loci Hamid Ashrafi (UC Davis) 2:40 - Break Marker assisted selection in tomato David Francis (The Ohio State University) 3:45 - Effects of population structure of genetic analysis Allen Van Deynze 4:35 - Survey

3 Marker types Allen Van Deynze

4 Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering, PCA, etc.) Breeding Alternative or support to selection for traits Increase rate of genetic gain: Selection during off-season cycles Selection of hybrid traits on inbred individuals Early selection (e.g. pre-flowering) Parental Selection Marker Based Parent Similarity Marker based estimated variance within a population Genetic distance between parents Trait Analysis Association of traits with genomic regions Understanding trait relationships (linkage vs. pleiotropy) Understanding causes of variation (aid in gene cloning) Marker Assisted Breeding Marker Assisted Backcrossing Quality Assurance Parent-offspring tests, Genetic purity tests, Event tests

5 Marker assisted selection DNA marker Fruit ripening

6 The # of Markers Needed Depends on Goals Protect varieties: 100s of markers Classify germplasm: 100s mapped ID tightly linked QTLs in linkage studies - 100s mapped ID candidate genes and association studies - saturated map. Depends on number of chromosomes Depends on size of genetic map (cm)

7 DNA RNA Protein Trait The Central Dogma of molecular biology is that the information in the DNA sequence is transcribed into mrna, which is then translated into proteins. Proteins are large molecules that are the enzymes and structural components of living cells = trait Image compliments of National Human Genome Research Institute

8 Marker types RFLPs RAPDs AFLPs SSRs SNPs SFPs Others

9 Restriction Fragment Length Polymorphism (RFLPs) cdna clones Genomic clones

10 RFLPs Co-dominant Detect all alleles simultaneously Good across related species Basis (anchors) of many species maps Too costly and labor intensive for breeding

11 Random Amplified Polymorphic DNA (RAPDs) University of Saskatchewan

12 RAPDs No sequence information needed Universal primer set Reproducibility problems

13 Amplified Fragment Length Polymorphism Restriction enzyme digestion genomic DNA Adaptor ligation Selective PCR amplification AFLP fingerprint

14 AFLP characteristics multiplex PCR Competition PCR : quantitative detection No sequence information required Size-based fragment discrimination Transcript and marker discovery Transcript and marker detection Universal technology (proprietary)

15 Marker types Inter MITE Polymorphism (IMP), interssr, Inter RGA Amplifies DNA between MITEs (miniature inverted-repeat transposable elements) MITEs PCR Amplification Template DNA Terminal inverted repeats Inter The MITEs Each numerous end are DNA well of the is polymorphic distributed amplified MITE by characterized throughout bands create PCR most by a an genomes distinct inverted fingerprint repeat sequence for each line

16 IMP and other Inter markers High multiplexing value 15 to 75 loci per reaction High throughput Cost-effective Tomato Distributed throughout the genome in gene rich regions Good level of intra-species variation High level of cross applicability Dominant markers May not be in coding regions

17 Simple Sequence Repeat (microsatellites) tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag PCR

18 Simple Sequence Repeats Medium abundance Medium throughput Available in many crops Need sequence information May or may not be associated with genes

19 Single-nucleotide polymorphisms (SNPs) cgtgtactgacctgcatgctatgaatcagtacatcgactagctt cgtgtactgacctgcatgctaggaatcagtacatcgactagctt Highly abundant roughly 1 per base pairs Distributed throughout genome including genes Genetically stable Typically biallelic Can be scored as a +/- marker Mutation may be diagnostic

20 SNPs Limited information per locus Need sequence information

21 Single Feature Polymorphisms Genotype 1 Genotype 2 Genotype 3 A B C D G H I M N E F J K L Probe Intensity A B C D E F G H I J K L M N SFP

22 SFPs Based on SNPs and Insertion/deletions Abundant Distributed throughout genome including genes Genetically stable Highly multiplexable Dominant Need sequence information

23 Why move to SNP maps? Microsatellite markers create maps with large gaps- appropriate for within family studies SNPs SNPs create dense maps to pinpoint regions across the population

24 Marker Detection Hybridization Amplification Electrophoresis Fluorescence

25 Polymerase Chain Reaction Taken from the National Health Museum gallery

26 SNP technologies Hybridization Single base pair extension Allele-specific PCR

27 Agarose Gel Electrophoresis Easy Universal Expensive Low throughput Use RAPDs SSRs SNPs RFLPs AFLPs

28 Automated Gel Electrophoresis Easy High resolution Automated High throughput Expensive equip Use SSRs AFLPs SNPs IMPs

29 Real Time PCR

30 Real-Time PCR cont d Easy Automated High throughput Expensive equip Use SNPs

31 96 samples x 96 assays Fluidigm

32 Pyrosequencing Automated Medium throughput Expensive equip Use SNPs

33 Invader Assay for SNP Detection Biplex FRET Format Cleavage Site Cleavage Site Invader Oligo A WT Probe Invader Oligo C Mut Probe Target T Released 5 Flap A Cleavage Site F1 Q F2 Q G Released 5 Flap C Cleavage Site Target A C FRET Cassette 1 FRET Cassette 2 F1 F2

34 Invader Automated High throughput Highly sensitive Flexible Quantitative Minimum amount reagents required Use SNPs

35 Mass Spec

36 Mass Spec Medium throughput Multiplex Inexpensive reagents Automated Need amplification Expensive equipment

37 Microarrays Automated High throughput Highly sensitive Multiplex Expensive equip Semi-Fixed assays Use SNPs

38 Liquid Arrays Automated High throughput Highly sensitive Multiplex Flexible Expensive equip Use SNPs

39 Illumina 2-60,000 SNPs x 96 samples $< /dp

40 Experimental Procedure

41 Marker Attributes Marker RFLPs RAPDs SSRs AFLPs/ IMPs SFPs SNPs Development costs high low high low high med-high Technical complexity high low low med med low Automated no no med med semi yes Reproducibility high low high med med high Cross species yes no yes no yes no Segregation co-dom dom co-dom dom dom co-dom Information content genomic/ gene none genomic none genomic / genes genomic/ genes Cost/datapoint high low med low low For Breeding no no yes yes no yes $ $<

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

PCB Fa Falll l2012

PCB Fa Falll l2012 PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México Choice of Marker Systems and Genotyping Platforms Yunbi Xu International Maize and Wheat Improvement

More information

Existing potato markers and marker conversions. Walter De Jong PAA Workshop August 2009

Existing potato markers and marker conversions. Walter De Jong PAA Workshop August 2009 Existing potato markers and marker conversions Walter De Jong PAA Workshop August 2009 1 What makes for a good marker? diagnostic for trait of interest robust works even with DNA of poor quality or low

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

Using molecular marker technology in studies on plant genetic diversity Final considerations

Using molecular marker technology in studies on plant genetic diversity Final considerations Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

Course Syllabus for FISH/CMBL 7660 Fall 2008

Course Syllabus for FISH/CMBL 7660 Fall 2008 Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS ORIGINAL: English DATE: October 21, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND DATABASE CONSTRUCTION (

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean EUROPEAN ACADEMIC RESEARCH Vol. IV, Issue 2/ May 2016 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E BMT Guidelines (proj.4) ORIGINAL: English DATE: December 21, 2005 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Human genetic variation

Human genetic variation Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

GDMS Templates Documentation GDMS Templates Release 1.0

GDMS Templates Documentation GDMS Templates Release 1.0 GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

Index. Index 377. ASH, see Allele-specific hybridization

Index. Index 377. ASH, see Allele-specific hybridization Index 377 Index A Allele-specific hybridization (ASH), genotyping principles, 14, 15 Amplification refractory mutation system-polymerase chain reaction (ARMS-PCR), cystic fibrosis diagnosis, amplification,

More information

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Twelfth Session Ottawa, Canada, May 11 to 13, 2010

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Twelfth Session Ottawa, Canada, May 11 to 13, 2010 E BMT/12/9 ORIGINAL: English DATE: April 9, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR

More information

Overview. Introduction

Overview. Introduction Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection

More information

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health 3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Restriction Enzymes (endonucleases)

Restriction Enzymes (endonucleases) In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing

Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Hamid Ashrafi Amanda M. Hulse, Kevin Hoegenauer, Fei Wang,

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

MOLECULAR TYPING TECHNIQUES

MOLECULAR TYPING TECHNIQUES MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy Department of Biotechnology Molecular Markers Nitin Swamy In plant breeding 17 1. Introduction Molecular breeding (MB) may be defined in a broad-sense as the use of genetic manipulation performed at DNA

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Microsatellite markers

Microsatellite markers Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Gene Mapping in Natural Plant Populations Guilt by Association

Gene Mapping in Natural Plant Populations Guilt by Association Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants Critical Reviews in Plant Sciences, 20(3):251 275 (2001) Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants S. A. Ranade, * Nuzhat Farooqui, Esha Bhattacharya,

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase? What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by

More information

RFLP: Restriction Fragment Length Polymorphism

RFLP: Restriction Fragment Length Polymorphism RFLP: Restriction Fragment Length Polymorphism RFLP (Restriction Fragment Length Polymorphism) In molecular biology, the term restriction fragment length polymorphism, or RFLP, (commonly pronounced rif-lip

More information

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray

More information

Molecular Markers CRITFC Genetics Workshop December 9, 2014

Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating

More information

Research techniques in genetics. Medical genetics, 2017.

Research techniques in genetics. Medical genetics, 2017. Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers.

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers. HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers. DNA, the stuff of life. We can think of DNA as a biochemical entity or as a data string. With the advent of high throughput

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

DNA Analysis Students will learn:

DNA Analysis Students will learn: DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How

More information

Bio Rad PCR Song Lyrics

Bio Rad PCR Song Lyrics Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.

More information

Combining Techniques to Answer Molecular Questions

Combining Techniques to Answer Molecular Questions Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is

More information

Plant breeding QTL (Quantitative Trait Loci)

Plant breeding QTL (Quantitative Trait Loci) Plant breeding Methods and use of classical plant breeding. Molecular marker technology, Marker assisted selection in plant breeding. QTL (Quantitative Trait Loci), Genetic analysis and characterization

More information

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

PCR-based technologies Latest strategies

PCR-based technologies Latest strategies Using molecular marker technology in studies on plant genetic diversity DNA-based technologies PCR-based technologies Latest strategies (DNA sequencing, ESTs, microarrays, DArT, SNPs) Copyright: IPGRI

More information

ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS

ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS David Canter, Di Wu, Tamara Summers, Jeff Rogers, Karen Menge, Ray Radtkey, and Ron Sosnowski Nanogen,

More information

PCR Techniques. By Ahmad Mansour Mohamed Alzohairy. Department of Genetics, Zagazig University,Zagazig, Egypt

PCR Techniques. By Ahmad Mansour Mohamed Alzohairy. Department of Genetics, Zagazig University,Zagazig, Egypt PCR Techniques By Ahmad Mansour Mohamed Alzohairy Department of Genetics, Zagazig University,Zagazig, Egypt 2005 PCR Techniques ISSR PCR Inter-Simple Sequence Repeats (ISSRs) By Ahmad Mansour Mohamed Alzohairy

More information

A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:

A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because: Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence

POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

RFLP: Restriction Fragment Length Polymorphism

RFLP: Restriction Fragment Length Polymorphism RFLP: Restriction Fragment Length Polymorphism Various endonucleases: 6 cutters and 4 cutters Enzyme Source Recognition Sequence Cut EcoRI Escherichia coli 5'GAATTC 5'---G/AATTC---3' EcoRII Escherichia

More information

Insight into microbial world molecular biology research in environmental microbiology

Insight into microbial world molecular biology research in environmental microbiology Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98

Molecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010

More information

B.D. Singh. A.K. Singh. Marker-Assisted Plant. Breeding: Principles. and Practices. ^ Springer

B.D. Singh. A.K. Singh. Marker-Assisted Plant. Breeding: Principles. and Practices. ^ Springer BD Singh AK Singh Marker-Assisted Plant Breeding: Principles and Practices ^ Springer Contents Part I General 1 Introduction to Marker-Assisted Crop Improvement 3 11 Introduction 3 12 Domestication: The

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information