independent transposition to random sites

Transcription

1 JB Accepts, published online ahead of print on 29 January 2010 J. Bacteriol. doi: /jb Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 Tn502 and Tn512 are res site hunters that provide evidence of resolvase- independent transposition to random sites Steve Petrovski and Vilma A. Stanisich* Department of Microbiology, La Trobe University, Victoria 3086, Australia. Received./Accepted Running title: Mechanism of transposition of Tn502 and Tn512 Keywords: res site hunters, cointegrate resolution, integron transposition, transposon-mediated deletions, mer transposons *Corresponding author. Mailing address: Department of Microbiology, La Trobe University, Bundoora 3086, Australia. Phone: (613) Fax: (613) v.stanisich@latrobe.edu.au Present address: Biotechnology Research Centre, La Trobe University, PO Box 199, Victoria 3552, Australia. s.petrovski@latrobe.edu.au 1

2 In this study we report on the transposition behaviour of the mercury(ii)-resistance transposons Tn502 and Tn512 that are members of the Tn5053 family. These transposons exhibit targeted and oriented insertion in the par region of plasmid RP1 since par-encoded components, namely the ParA resolvase and its cognate res region, are essential for such transposition. Tn502, and under some circumstances, Tn512, can transpose when par is absent, providing evidence for an alternative, par-independent pathway of transposition. We show that the alternative pathway proceeds by a two-step replicative process involving random target selection and orientation of insertion, leading to the formation of cointegrates as the predominant product of the first stage of transposition. Cointegrates remain unresolved because the transposon-encoded (TniR) recombination system is relatively inefficient, as is the host-encoded (RecA) system. In the presence of the res-para recombination system, TniR- (and RecA-) mediated cointegrate resolution is highly efficient, enabling resolution both of cointegrates involving functional transposons (Tn502 and Tn512) as well as of defective elements (In0 and In2). These findings implicate the target-encoded accessory functions in the second stage of transposition as well as in the first. We also show that the par-independent pathway enables the formation of deletions in the target molecule. It is widely recognised that mobile genetic elements contribute to genome plasticity and have been a driving force in the emergence and spread of resistance determinants within and between bacterial species; their impact is ongoing (10, 50). Significant amongst these elements are various classes of plasmids, transposons and integrons which may lack resistance 2

3 determinants or carry one or multiple determinants. Resistance determinants that have become globally dispersed in environmental and clinically significant bacteria include mercury(ii)- resistance (2, 17), evident even in ancient bacteria (27), and antibiotic-resistance which has increased in dominance since the advent of the antibiotic era (23, 40). This paper concerns the mercury-resistance (mer) transposons Tn502 and Tn512 whose sequence organization and transpositional behaviour show that they are new members of a family of elements exemplified by the mer transposon Tn5053 (22). These elements are closely related to those in the Tn402 family which contain an integron recombination system (14, 36). Members of the two families differ in the positions of the mer or inti determinants (modules) near one end of the transposition (tni) module. The latter module contains four genes (tniabqr) and the entire transposon is bounded by 25 bp inverted repeat termini (IRi and IRt). TniA, TniB and TniQ are required to form the transpositional cointegrate which is then resolved by the action of TniR (a serine-resolvase) on a resolution (res) sequence located between tnir and tniq (22). The transposon in its new location is flanked by 5 bp direct repeats (DRs) (20, 22). TniA, which contains a D,D(35)E transposase catalytic motif, is thought to function cooperatively with TniB, a putative nucleotide-binding protein, as the active TniAB transposase (21, 36). Studies conducted on TniA in vitro show binding to the IRs and to additional 19 bp repeat sequences that make up the complex termini of the transposon (21). The precise role of TniQ is unknown. An unexpected and unique feature of Tn5053 and Tn402 is that they depend on externally-coded accessory functions for efficient transposition, namely, a res site served by a cognate resolvase (25). As a consequence, these transposons exhibit a strong transpositional bias for some target res sites (20, 25, 26) and have aptly been described as res site hunters (25). One such efficient interaction involves the res-para multimer resolution system of plasmid 3

4 RP1(IncPα); other plasmid- or transposon-encoded systems are less efficient or are refractory. Although the role of the external resolvase remains obscure, its capacity to bind to its cognate res is an essential requirement whereas its catalytic activity is not (20). For each interaction system, the target sites typically cluster in a single part of res but not necessarily within the same subregion and, on occasion, can lie in the vicinity of res. Typically the transposon is in a single orientation with IRi closest to the resolvase gene. In one study, Tn402 clustered at two target sites, one within res and one nearby, and the orientation was different at the two sites (20). The experimentally observed target preference described above also occurs in natural associations of Tn5053/Tn402-like elements and became evident on sequencing class 1 integrons which were often found positioned close to different res-resolvase gene regions (6, 20, 25). Most Tn402 family elements are comprised of an inti module that is flanked on the left by IRi and on the right by a 3 conserved sequence (3 -CS) (13). In others, a remnant tni gene cluster may be present instead of the 3 -CS, and IRt occurs at the right flank. The structure of the latter category of integrons strongly indicated that they are defective transposons that were presumably capable of relocation provided that tni functions were supplied in trans (6, 32). The movement of In33 (=Tn2521) from a chromosomal to a plasmid location appears to have been such an in trans event (30, 42), and others involving In0 and In2 are demonstrated in this study. In contrast, the integrons that lack the IRt end appear to be non-mobile remnants of Tn402-like transposons; they belong to several lineages including those in which the incurred deletions are attributable to acquired IS elements (6). More recently, intact Tn5053/Tn402-like transposons and class 1 integrons have increasingly been detected in the res-para region of IncP plasmids (39) which are arguably the most promiscuous of known plasmids (49). These various experimental and natural 4

5 interactions provide insight into the dispersal pathways possible for Tn5053/Tn402-like elements. The res-hunting attribute is a striking feature that is experimentally supported by studies on four family members [namely, Tn5053 (22, 25), Tn402 (20, 26), and in this study, Tn502 (48) and Tn512]. Another facet of the transposition of Tn502 is explored here. It concerns the observation that loss of the preferred par target region in RP1 does not abolish transposition of Tn502 (48), contrary to the finding with Tn5053 (25, 26) and, in this study, Tn512. The continued, low frequency, transposition of Tn502 involved at least three dispersed locations (48) however nothing is known of the nature of these sites or of the features and requirements of the transposition process. We here address these issues and uncover the existence of an alternative, par-independent, pathway that is employed by Tn502 and is available to Tn512 under some circumstances. The study also provides information on the roles of the TniR- and host(reca)- recombination systems in the resolution of transpositional cointegrates and on the ability of the par-independent transposition pathway to generate plasmid deletions. MATERIALS AND METHODS Bacterial strains, phage and growth media. The Escherichia coli K-12 derivatives used were DH5α (reca1 Res - Mod + Nal r ) (15), JC3272 (auxotroph Str r ) (1), and the spontaneous rifampicin-resistant mutants LT111 and LT112 obtained from UB281 (pro met Nal r ) (16) and its reca56 derivative, UB5201 (37), respectively. The auxotrophic rifampicin-resistant Pseudomonas aeruginosa strains PAO9501 (46), its derivative PAO9529 (which has Tn502 in the chromosome) (48), and PAO9505 (46) were also used, as was the IncP-specific phage PR4 (45). Nutrient agar (NA), Nutrient broth (NB) and Diagnostic sensitivity agar (DST) have been 5

6 described previously (28). For selection of E. coli strains (or of P. aeruginosa, as indicated) antimicrobials were used in NA at the following final concentrations (µg/ml): ampicillin (Ap) 100; carbenicillin (Cb) 250 (for P. aeruginosa); chloramphenicol (Cm) 10; kanamycin sulphate (Km) 10 or 350 (for P. aeruginosa); mercuric chloride (Hg) 10 (for both E. coli and P. aeruginosa); nalidixic acid (Nal) 8; rifampicin (Rif) 100 (for both E. coli and P. aeruginosa); streptomycin sulphate (Sm) 100 (for P. aeruginosa and for chromosomal-borne resistance in E. coli) or 5 (for plasmid-borne resistance in E. coli); tetracycline hydrochloride (Tc) 10 or 80 (for P. aeruginosa). Sulphonamide (Su) 80 or 350 (for P. aeruginosa) was used in DST also supplemented with lysed horse blood (2% (vol/vol)). Transposons, plasmids and plasmid constructions. The newly sequenced mer transposons used in this study are Tn502 (9647 bp) (48) and Tn512 (8450 bp) (34) both from clinical isolates of P. aeruginosa strains. Their database accession numbers are EU and EU respectively. The plasmids used are listed in Table 1 except for additional derivatives of pub307 and pub1601 that are described in Figures 1 and 3. The tniq allele in pvs1703 was generated by removing the ClaI site in tet of pvs983 (by AatII-EcoRV digestion and religation, to form pvs1702) and then treating the ClaI site in tniq of pvs1702 with mung bean nuclease. The religated plasmid, pvs1703, lacks a 12-nucleotide sequence at the ClaI site. The predicted TniQ protein is identical to wild type TniQ 502 (405 amino acids) except for the loss of amino acids The Tn21-associated tnpa gene in pub2401 was inactivated by KpnIdigestion of the plasmid, treatment with mung bean nuclease and religation to produce pvs1697. An amplicon of tnim (0.6 kb) was generated using the forward primers SP23 (5 - GCGGAATTCGGTATTCCTGCCTGCAAC) and the reverse primer, SP15 (5 - GAATTCGGGACGAAACTCTCAAC) and cloned into pdhc29 to produce pvs

7 DNA techniques and sequencing. Cloning and DNA manipulation were performed using standard methods (38). Plasmid DNA from various E. coli strains and derivatives of P. aeruginosa PAO9505 was isolated from 10 ml overnight NB cultures using an alkaline-lysis mini-prep method applied to 1.5 ml or 10 ml of culture, respectively. DH5α served as the recipient in transformation experiments designed to isolate or purify recombinant plasmids arising from in vitro or in vivo events. To map Tn502 and Tn512 insertion sites, DNA was amplified by PCR using tnia- and pare-specific primers SP11 (5 -GATGATTTCCGC CCGTTG) and SP12 (5 -CTCATGTCCTTAAACGGG), respectively, in reaction mixtures containing 10% (vol/vol) dimethyl sulphoxide and Taq DNA polymerase (Invitrogen). The mixtures were overlaid with sterile mineral oil and subjected to 36 thermal cycles as follows: 92 o C, 3 min (first cycle only); 92 o C, 1 min; 60 o C, 1 min; 72 o C, 2 min 72 o C, 5 min (last cycle only). The reaction products were detected using agarose gel electrophoresis and staining with ethidium bromide. DNA sequencing was performed at the VABC Aggenomics Sequencing Facility (La Trobe University) to precisely identify Tn502 and Tn512 insertion sites [using SP11 and merr-specific primer SP21 (5 -CACTGCGAGGAAGCCAGCAGCTTG)] and In2 insertion sites [using SP11 and the inti1-specific primer SP18 (5 -CCGGATCAGAACGTATAC)]. Transposition assays and analysis of transconjugants. All conjugation experiments, including transposition assays, were conducted by the quantitative filter method (48) and involved equal volumes (0.5 ml) of donor and recipient bacteria from NB-grown cultures. The donor strains (usually derivatives of DH5α) contained two or more compatible plasmids that were sequentially introduced by transformation (for non-conjugative plasmids) or conjugation (for self-transferable plasmids). In each step of the construction, selection was imposed for the distinctive resistance marker associated with the incoming plasmid, followed by purification of a 7

8 mixture of the colonies on NA selective for the incoming and resident plasmid(s). Nonconjugative plasmids were introduced first and the conjugative plasmid last. When the full complement of plasmids was present, a mixture of colonies was subcultured three times on the selective medium, and a donor culture prepared in 10 ml NB and grown to late exponential phase. P. aeruginosa PAO9505, grown overnight at 42 o C to induce a temporary restrictiondeficient phenotype (24), was used as the recipient. This strain is highly sensitive to Hg(II) and, unlike E. coli K-12, produces no background growth when high cell numbers are plated on Hg(II)-containing selective NA. The use of PAO9505 thus enabled the detection of low frequency Hg r -transfer events. All assays were performed on three independent occasions, and the average transfer or transposition frequency (transconjugants per donor cell) calculated. Transconjugants from all transposition assays involving pub307 were subjected to PCR analysis (using SP11 and SP12) to identify insertion (and orientation) of the elements within the res region. In addition, Hg r transconjugants from all transposition assays involving Tn502 were screened for resistance phenotype to determine plasmid content. Coinheritance of the distinctive Ap r marker of the transposon donor (pvs983) indicated the presence of a plasmid cointegrate (i.e. pub307- or pub1601-pvs983) whereas an Ap s phenotype indicated the presence of a resolved plasmid (i.e. pub307::tn502 or pub1601::tn502). Amongst the latter category, the occurrence of a Tc s phenotype indicated insertion of Tn502 into the tet gene of the target plasmid. In matings involving Tn512, the transposon donor (pvs1718) lacked a distinctive marker. Consequently, plasmid DNA was isolated from Hg r transconjugants and analysed following SalI-digestion (for pub307 derivatives) or SstII-digestion (for pub1601 derivatives). Thus, pub307::tn512 resolved plasmids yielded two large fragments ( 20 kb and 44 kb); pub307-pvs1718 cointegrates yielded two additional fragments of about 2 kb (from the 8

9 pbr322 component of pvs1718) and 12 kb (one of the Tn512-pUB307 junction fragments); only pub1601-pvs1718 cointegrates were detected and the restriction profile varied depending on which SstII fragment of pub1601 (i.e kb, 14.5 kb, 10.0 kb, 2.0 kb) had the Tn512 insert. Transposition of In2 from pvs1697 to the target plasmid involved the selection of Su r transconjugants of PAO9505 or Sm r transconjugants of LT111 or LT112. Transconjugants with resolved pub307::in2 plasmids were detectable based on resistance phenotype. Transconjugants that displayed the full complement of pub307- and pvs1697-resistance markers were outcrossed, by conjugation. Linkage analysis on the transconjugants from the outcross enabled the inheritance of pub307::in2 plasmids to be distinguished from that of pub307-pvs1697 cointegrates. The single pub1601::pvs1697 cointegrate that was detected in a transconjugant from PAO9505 (Table 2) was confirmed by transformational outcross experiments to DH5α and SalI restriction analysis of the recovered plasmid. The profile obtained (i.e. fragments of 8 kb, an 11.5 kb doublet and one of >23 kb) was consistent with the unique SalI sites in pub1601 and the components (pacyc184 and In2) of pvs1697, and with the expected duplication of In2 in the cointegrate. The exact location of In2 in pub1601 could not be established, however, the 8 kb fragment that was generated indicated that it is either 1.1 kb or 4 kb (depending on the orientation) from the SalI site in pub1601. RESULTS Tn502 can transpose by a par-independent process whereas Tn512 cannot. Based on the recovery of Hg r -transconjugants from matings involving E. coli donors and P. aeruginosa PAO9505 as recipient (see Materials and Methods), transposition of Tn502 and Tn512 occurred efficiently to the par + conjugative plasmid pub307 (3), although the frequency was typically 9

10 higher ( 10-fold) for Tn502 (Table 2, lines 2 and 4). All the pub307::tn512 and pub307::tn502 plasmids that were studied (10 from each of five experiments for the Tn502 + and the Tn512 + donor) generated an 800 bp PCR-product using tnia- and pare-specific primers (SP11 and SP12, respectively), with the exception of two pub307::tn502 plasmids which produced no PCR product. This outcome suggested that Tn502 and Tn512 have a preferred target site(s) within the res sequence of par, and that both transposons insert in a single orientation (i.e. with the tnia-end of the transposon closest to pard). Ten independently-derived plasmids were studied further to determine the exact insertion sites (Fig. 1B). In five Tn512 + plasmids and three Tn502 + plasmids the insertions were within an AATTT sequence in res (corresponding to nt of RP1); in the two exceptional Tn502 + plasmids mentioned above, the transposon was nearby (at nt 35030) in the non-preferred orientation, or in pare (at nt 35664). As expected for members of the Tn5053 family, Tn502 and Tn512 in each plasmid were flanked by 5 bp DRs of the target DNA sequence. In contrast, the outcome was significantly different when the par-deleted (par ) plasmid, pub1601 (54), served as the target plasmid (Table 2, lines 3 and 5); transposition of Tn512 was undetectable (< 2.0 x 10-9 ) and was markedly reduced (>10 4 -fold) in the case of Tn502. The latter confirmed our earlier observation (48) that Tn502 can transpose when par is absent, albeit inefficiently, an attribute that is not displayed by Tn512. To gain insight into the process of parindependent transposition of Tn502, we further analysed the Hg r transconjugants that were isolated from donors carrying pub1601(par ) (Tc r Km r ) and pvs983(tn502 + ) (Ap r Hg r ) (typically transconjugants per mating experiment). The vast majority contained pub1601-pvs983 cointegrate plasmids, as determined from their resistance phenotype and pattern of marker-coinheritance on outcrossing (see Materials and Methods). Some of the 10

11 transconjugants (12/488) had the phenotype expected of pub1601::tn502 resolved products (i.e. Tc r Km r Hg r Ap s ). When the respective plasmids were isolated and the sequence of the junction regions determined (using the tnia and merr 502 -specific primers SP11 and SP21, respectively), they were found to be bona fide transpositional derivatives in that each Tn502 insertion was flanked by 5 bp DRs of the target DNA sequence. Moreover, the transposon was inserted at different sites in pub1601, including widely separated sites, that shared no obvious sequence similarity suggestive of a preferred secondary site (Fig. 1A). In addition, the insertions occurred in the two possible orientations. These various findings showed that par-independent transposition involves random target selection and orientation of insertion, and generates unresolved cointegrates as the major product. The role of tniq in transposition was also assessed using a Tn502 mutant whose TniQ protein, TniQ, lacks a four-amino acid sequence close to the C-terminus (see Materials and Methods). The mutated allele caused a reduction of 100-fold in the efficiency of Tn502 transposition to the par + target plasmid (Table 2, lines 2 and 6), a finding consistent with the essential role ascribed to tniq in a study of a tniq-truncation mutant of Tn5053 (22). Only pub307::tn502tniq resolved products were obtained, and three that were sequenced had insertions in the par region (Fig. 1B). In contrast, the Tn502tniQ element continued to transpose to the par-deleted pub1601 (Table 2, lines 7) and, this time, unresolved plasmid cointegrates were recovered from the transconjugants (60 tested). These findings suggested that tniq is not required for par-independent transposition of Tn502 but has a role in the pardependent process. Tn502 can complement the transposition deficiency of In2 and In0. Tn402 is an exceptional class 1 integron (32, 36) since it is also a functional transposon (20, 26, 41) whose 11

12 tni module is similar to that of Tn502 and Tn512. A few other class 1 integrons, such as In0, In2 and In5 have IRi and IRt as well as tnia and part of tnib (6). Although these latter elements are not self mobile, we considered that they might transpose if tni 502 genes were provided in trans. We therefore tested the transposition of In2 from its native site in Tn21 by first blocking Tn21- transposition (via mutation of tnpa 21 in pub2401) and providing pvs1696 (tni ) in trans. Transposition occurred with high efficiency to pub307 (par + ) in E. coli and the plasmids were resolved cointegrates (Table 2, lines 8 and 9). Using a different experimental system, we also tested transposition of In0 (Su r ) from its native plasmid pvs1 (which also carries the functional Tn501 mer transposon) to pub307. When Tn502 was present in the P. aeruginosa donor, the majority (84%) of Su r transconjugants were Hg s, consistent with the transposition of In0 to pub307 to form resolved cointegrates (Table 3, column 4). Further analysis of three of the pub307::in plasmids from each experiment showed that In2 and In0 were present in the res region and were appropriately oriented and flanked by 5 bp DRs (Fig. 1B). These findings fulfilled our original expectations however on further refection they were surprising, since In2 and In0 lack the tni-encoded resolution system, that is, they have no res site at which TniR supplied from tni 502, can act. Consequently, unresolved cointegrates would have been expected. Only one such cointegrate was obtained, and it represented the sole example of In2 transposition to pub1601 (Table 2, line 11) (cointegrate structure was judged by SalIrestriction profile and linkage analysis on retransfer; see Materials and Methods). Overall, these findings demonstrated that tni-assisted transposition is possible for some class 1 integrons and that the products are either resolved or unresolved cointegrates depending on whether the target plasmid is par + (pub307) or par (pub1601), an outcome similar to that observed during transposition of the fully functional Tn

13 Resolution of transpositional cointegrates via TniR- or RecA-mediated events is efficient only in the presence of the par locus. Since In0 and In2 both lack the res sequence at which TniR can act, it was presumed that the resolution of In-containing cointegrates with pub307 had devolved to the host recombination (RecA)-system. This explanation is not entirely satisfactory, since the high incidence of unresolved pub1601-cointegrates involving Tn502 (Table 2, lines 3) suggested that RecA-mediated resolution and, more significantly, TniRmediated resolution are inefficient processes. To gain further insight into the cointegrateformation and cointegrate-resolution phases of transposition to pub307, we monitored the former via the incidence of conductional transfer events [by selecting transconjugants that inherited the donor plasmid: Cm r (pacyc184) or Ap r (pbr322)] and the latter via the incidence of transposition events [by selecting transconjugants that inherited the element: Hg r (Tn502) or Sm r (In2)]. The experiments were conducted in E. coli, and involved a RecA - donor mated with RecA + and RecA - recipients (Table 4). In the two matings involving Tn502, similar numbers of Hg r transconjugants were obtained and the transferred plasmids, based on phenotype (Km r Ap s ), were resolved products that had formed in the RecA - donor and been transferred as such to the recipients. The transfer of cointegrates (present in Ap r transconjugants that were also Km r Hg r ) was 100-fold less frequent, and the plasmids were rapidly resolved, irrespective of the RecA-status of the recipient [i.e. 12 transconjugants, when outcrossed, yielded pub307::tn502 plasmids]. This demonstrated that the TniR 502 -resolution system is efficient and operates independently of the host RecA-system. In contrast, the plasmids transferred from the In2 + donor were all cointegrates as indicated by the similar numbers, and full resistance profile, of transconjugants from the two recipients irrespective of the selection imposed (Sm r or Cm r ). This was as expected, since In2 is resolution- 13

14 deficient. The cointegrates in the RecA + recipient underwent rapid resolution (i.e. 12 Cm r transconjugants, when outcrossed, yielded pub307::in2 plasmids) whereas those in the RecA - recipient were stable until transferred to a RecA + host (12 Cm r transconjugants were outcrossed to RecA + and RecA - hosts). These findings showed that RecA-mediated recombination can efficiently resolve In2-containing cointegrates in the absence of the TniR-system. The single In2-cointegrate with pub1601 was also passaged in a RecA + strain (both P. aeruginosa and E. coli) without yielding resolution products detectable by outcross experiments (>1%); this behaviour was similar to that of the unresolved pub1601-cointegrate with Tn502. Taken together, these various comparisons clearly established that RecA- and TniRmediated resolution are each highly efficient when the par locus is present (pub307) but are not efficient in its absence (pub1601). We propose that resolution depends on the formation of a res/para complex, which can form on pub307, enabling the two In or Tn copies in the cointegrate to juxtapose (Fig. 2). Such alignment would facilitate RecA-mediated resolution (in the case of In2 and In0) and augment TniR-mediated resolution (in the case of Tn502). The RecA- and TniR-recombination systems are individually relatively inefficient since, in the absence of the proposed res/para complex (the situation that applies to pub1601) cointegrates remain stable. Transposition of Tn502 can generate deletions of adjoining DNA. The formation of 5 bp flanking DRs is a feature of the Tn and In elements studied here and of Tn5053 (22) and Tn402 (20). However, exceptions exist amongst naturally-occurring elements: for example, Tn402 in R751 (36) and Tn4672 in puo1 (43) (both IncPβ plasmids), and In5 in psch884 (6, 13) (Inc-type unknown). In the IncPβ plasmids, the transposon occurs in a region that corresponds to the par locus of RP1 (44), suggesting that insertion was originally via the par- 14

15 dependent process. Our observations that Tn502 can sometimes insert in the vicinity of the res target region in pub307, rather than within it (Fig. 1B) (a feature also noted with Tn5053 (22) and Tn402 (20)), and that it can also transpose to random target sites in pub1601 (Fig. 1A), raised the possibility that the absence of 5 bp DRs may be due to transposon-mediated deletion events such as might arise following intramolecular transposition (55) and subsequent loss of DNA via TniR- (or RecA-) mediated resolution. To test this possibility, we devised a screening procedure to detect rare Tn502-mediated deletion events that involved the par region and either the adjacent Tra 1 or Tra 2 regions which each encode genes required for sensitivity to PR4, a donor specific phage (29, 45). Cultures of PR4-sensitive P. aeruginosa PAO9505 strains carrying either pub1601traa::tn502 or pub307pare::tn502 were exposed to PR4 (10 10 p.f.u) on selective NA, and the colonies obtained (Hg r PR4 r ) tested for sensitivity to kanamycin. Km s -mutants arising from bacteria carrying pub1601traa::tn502 were expected to have deletions that encompassed the Km r locus, IS21 and some trb (Tra 2) genes (Fig. 3); two such mutants were isolated, ΩTn502trbL and ΩTn502trbF, which were shown by sequence analysis to have deletions that extend from the IRi-pUB1601 junction into the respective trb genes. In contrast, Km s -mutants arising from bacteria carrying pub307pare::tn502 included those with deletions that extend from the IRtpUB307 junction into trag or trai (mutants ΩTn502traG1, ΩTn502traG2 and ΩTn502traI; Fig. 3) or, alternatively, that extend from the IR border of IS21 into the tra genes. Three mutants of the latter type were detected (data not shown) and were similar to IS21-induced deletions described previously (11). All five of the Tn502-induced deletion mutants that were studied (Fig. 3) retain on one flank the 5 bp DR formed on initial insertion into traa or pare, whereas on the other flank they 15

16 have an unrelated 5 bp sequence (i.e. that formed during the subsequent transposition event). These findings provide the first experimental evidence of deletion-formation induced by a Tn5053/Tn402-like element and explain the absence of 5 bp DRs at some insertion sites detected in nature. They also provide further evidence that par-independent transposition involves random target selection since the sites in Tra 1 and Tra 2 are additional to those shown in Fig. 1A. tnim enhances par-independent transposition. The ability of Tn502 to transpose to pub1601(par ) is a distinctive ability not exhibited by Tn512 (Table 2) nor by Tn5053 when it was tested in a comparable experimental system (25, 26). Although these three transposons differ at the sequence level, their TniABQR products are identical or nearly so (95% identity) and hence are not likely to account for the exceptional behaviour of Tn502. We suspected that tnim may be involved in transposition to pub1601 since this gene is present in Tn502 and not in Tn512 (or Tn5053). It is located between the last gene of the mer module, mere, and the tnir gene, and is related to a transposition modulator gene, tnpm (83% identity), in Tn21 and Tn501 (18). We therefore studied the effects of a cloned tnim 502 gene on the transposition of Tn512 when the former was provided in trans. In the presence of pvs1715 (tnim ), transposition of Tn512 to pub307 (par + ) was increased about 10-fold (Table 2, lines 4 and 13). More significantly, transposition was detected to pub1601 (par ), although it was not as efficient as that observed with Tn502 (Table 2, lines 5 and 15). The transconjugants all carried pub1601- pvs1718 unresolved cointegrates (60 tested). SacII-restriction profiles on 15 of the plasmids showed that Tn512 could insert into any of the three large SacII fragments of pub1601, however, whether the two orientations were represented could not be determined (data not shown; see Materials and Methods). These findings implicated tnim in the par-independent transposition process and further reinforced the consistent observation that the products of this 16

17 process are unresolved cointegrates; tnim may also marginally influence par-dependent transposition DISCUSSION Tn5053/Tn402-like transposons, including Tn502 and Tn512 studied here, exhibit high frequency targeted insertion in the par locus of RP1 since the par-encoded components (res- ParA) are essential accessory functions in transposition (25). Tn502 is exceptional in that transposition continues when par is absent (Table 2). The data presented here establish the existence of a par-independent transposition pathway and define its features: First, parindependent transposition operates at low frequency and involves randomly selected target sites: 14 such dispersed sites were detected in the par-deletant, pub1601 (Fig. 1B and 3), and Tn502 occurred in either orientation. This contrasts with high frequency, targeted and oriented transposition in the case of par-dependent transposition. Second, the products of parindependent transposition are mainly (>95%) stable, unresolved cointegrates; the resolved cointegrates all contain Tn502 flanked by 5 bp DRs. In par-dependent transposition, resolved cointegrates predominate (Table 2). We attribute the ability of Tn502 to transpose to pub1601 to its carriage of tnim, since Tn512 also transposed to pub1601 when tnim 502 was provided in trans (Table 2). The latter events involved at least three target sites and produced unresolved cointegrates, consistent with the par-independent process. Apart from tnim, Tn502 and Tn512 encode near identical TniABQR products but have different mer modules; tnim 502 occurs between mere and tnir (separated by 633 and 11 bp, respectively) and is apparently part of the mer operon. The effect of TniM, a 12.5 kda cytoplasmic protein (34), is therefore intriguing and perhaps incidental. It 17

18 has no distinctive in silico features that might indicate its role, however, a homologue, TnpM (83% identity), has subtle effects (2.5- to 22-fold) on the transposition of Tn21 and Tn501 (18). These elements, like those of the Tn5053 and Tn402 families, move by a two-stage replicative process so that the observed effects of TniM and TnpM on transposition seem significant. Elucidation of their role(s) in transposition awaits further study. Of the tniabq genes that are essential for stage 1 of transposition (22), we tested only tniq, confirming its involvement in par-dependent transposition and showing that it is not essential for the par-independent process (Table 2). The role of TniQ is unknown. A significant finding of the study concerned cointegrate resolution (stage 2 of transposition) and its management in the two transposition pathways. In par-independent transposition of Tn502 and Tn512, unresolved cointegrates were the predominant product yet when the res-para system was present, they occurred in only <0.5% of transconjugants (Table 2 line 2 and 4 and Table 4). The implication of this finding is that the transposon-encoded resolution system (res-tnir), hitherto deemed highly efficient (22), is, in fact, only efficient when the plasmid-determined res-para targeting system is present. The epithet res site hunters aptly describes the transposons for two reasons: first, because the res-para accessory components are crucial in initiating transposition to res (22) and, second, because they also have a key role in efficient resolution. The host (RecA)-mediated recombination system also contributes to cointegrate resolution but is comparatively inefficient since, even with a functional res-tnir system, only 1% of transconjugants carried resolved pub1601::tn502 plasmids. In contrast, RecAmediated resolution was paramount when it operated in concert with res-para. This was evident in the efficient resolution of In0- and In2-cointegrates with pub307; both integrons lacks the 18

19 res-tnir system so that resolution, as shown with In2 (Table 4) is exclusively via RecA. We propose that the binding of ParA to its cognate res regions in the cointegrate is a critical event; it facilitates DNA synapsis thereby enhancing the likelihood of resolution via either the TniR- or RecA-mediated systems (Fig. 2). In the absence of the res/para complex (the situation in cointegrates involving pub1601) such resolution events occur, but with reduced efficiency. In light of the observations made in this study, a model for par-independent transposition, can be proposed. The TniAB transposase is presumably essential for the process and initiates transposition at a random target site, though with poor efficiency. TniM either enhances or is essential for transposition whereas TniQ is dispensable (Table 2). TniM may serve a general role such as a scaffold or stabilising protein in the transposition complex. The distinctive requirements of the par-independent (TniABM) and par-dependent (TniABQ) pathways are reminiscent of Tn7 transposition which involves essential components (TnsABC) and those dedicated to the targeted insertion (TnsD) and random insertion (TnsE) pathways (33). The striking orientation specificity observed in par-dependent, but not par-independent, transposition possibly implicates TniQ and/or ParA in the former process. TniQ and/or ParA in the transposition complex may occlude one of the possible ligation events thereby favouring insertion in a single orientation; a similar model has been proposed to account for the oriented insertion of Tn7 (33). In the absence of TniQ and/or ParA, the two possible ligation events can occur. Lastly, because of the inherent inefficiency of the transposon s resolution system, parindependent transposition results mainly in unresolved cointegrates. One of the further consequences of par-independent transposition was the ability of Tn502 to cause deletions in the carrier plasmid. Such deletions extended from the initial target site to random sites in the adjoining DNA so that the transposon lacks recognisable flanking 5 bp 19

20 DRs, a situation also found amongst Tn5053/Tn402-like elements located in the res-para region of most IncPβ plasmids (Fig. 4). Sequence comparisons with the intact res-para-backbone region of pbp136, which lacks any inserts (44), suggest that inheritance of the Tn5053/Tn402- like elements resulted in deletions in the IncPβ plasmids of kb (Fig. 4). These naturally arising deletions are small relative to those caused by Tn502 (all >11 kb because of the selection criteria employed), however, all presumably originate from intramolecular transposition or acquisition of a second element. Indeed, a surprising size-range of deletions ( kb) can be generated even in a small (13 kb) plasmid, as found during transposition of an engineered Tn1000 (γδ) (53). IncPβ plasmids with large deletions that extend into the Tra regions, like those induced by Tn502 (Fig. 3), most likely occur in nature; they are not represented amongst the studied plasmids because most of these were selected as conjugation-proficient plasmids (39). Finally, in addition to the par-independent transposition events observed to pub1601, other rare instances are known: Tn502 insertion into the tet gene of pbr322 (48) and into the P. aeruginosa PAO chromosome (48); also, Tn5053 insertion into the E. coli K-12 chromosome (25) and Tn402 insertion into phage λ (41). In the last case, Tn402 transposition may have been aided by a tnim homologue (orf2 of Tn4321) in the R751 carrier plasmid (31, 51). We envisage that tnim homologues in the widespread Tn21/Tn501-like transposons may facilitate nonconventional movement of Tn5053/Tn402-like elements during natural encounters. Such movements can generate variability at random loci or have multifactorial effects: DNA deletions and the formation of stable cointegrates. Such events are separate from the dissemination of Tn5053/Tn402-like elements afforded by their affinity for some res target regions, such as that in the par locus of the promiscuous IncP plasmids (12, 52). 20

21 ACKNOWLEDGMENTS We thank two anonymous reviewers for their generous and perspicacious comments on the manuscript, and Professor Ruth M. Hall for providing us with the plasmid pub2401. Steve Petrovski was the recipient of a La Trobe University Postgraduate Award. 21

22 REFERENCES 1. Achtman, M., N. Willetts, and A. J. Clark Beginning a genetic analysis of conjugational transfer determined by the F-factor in Escherichia coli by isolation and characterization of transfer-deficient mutants. J. Bacteriol. 106: Barkay, T., S. M. Miller, and A. O. Summers Bacterial mercury resistance from atom to ecosystems. FEMS Microbiol. Rev. 27: Bennett, P. M., J. Grinsted, and M. H. Richmond Transposition of TnA does not generate deletions. Mol. Gen. Genet. 154: Bissonnette, L., and P. H. Roy Characterization of In0 of Pseudomonas aeruginosa pvs1, an ancestor of integrons of multiresistance plasmids and transposons of Gram-negative bacteria. J. Bacteriol. 174: Bolivar, F., R. L. Rodriguez, P. J. Green, M. C. Betlach, H. L. Heyneker, and H. W. Boyer Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2: Brown, H. J., H. W. Stokes, and R. M. Hall The integrons In0, In2 and In5 are defective transposon derivatives. J. Bacteriol. 178: de la Cruz, F., and J. Grinsted Genetic and molecular characterization of Tn21, a multiple resistance transposon from R J. Bacteriol. 151: Eberl, L., C.S. Kristensen, M. Givskov, E. Grohmann, M. Gerlitz, and H. Schwab Analysis of the multimer resolution system encoded by the parcba operon of broadhost-range plasmid RP4. Mol. Microbiol. 12: Fong, S. T Ph.D thesis. La Trobe University, Australia. Genetic and molecular analysis of the Tra1 and FiwA regions of plasmid RP1. 22

23 Frost, L. S., R. Leplae, A. O. Summers, and A. Toussaint Mobile genetic elements: the agents of open source evolution. Nat. Rev. Microbiol. 3: Haas, D., and G. Riess Spontaneous deletions of the chromosome-mobilising plasmid R68.45 in Pseudomonas aeruginosa PAO. Plasmid 9: Haines, A. S., K. Jones, S. M. Batt, I. A. Kosheleva, and C. M. Thomas Sequence of plasmid pbs228 and reconstruction of the IncP-1α phylogeny. Plasmid 58: Hall, R. M., H. J. Brown, D. E. Brookes, and H. W. Stokes Integrons found in different locations have identical 5 ends but variable 3 ends. J. Bacteriol. 176: Hall, R. M. and C. M. Collis Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15, Hanahan, D Studies on transformation of Eschericia coli with plasmids. J. Mol. Biol. 136: Hedges, R. W., N. Datta, J. N. Coetzee, and S. Dennison R factors from Proteus morganii. J. Gen. Microbiol. 77: Hobman, J. L. and N. L. Brown in Metal Ions in Biological Systems (Sigel, A. and Sigel, H., eds), pp , Marcel Dekker, New York. 18. Hyde, D. R., and C. P. D. Tu tnpm: A novel regulatory gene that enhances transposition and suppresses cointegrate resolution. Cell 42: Itoh, Y., J. M. Watson, D. Haas, and Leisinger, T Genetic and molecular characterization of the Pseudomonas plasmid pvs1. Plasmid 11: Kamali-Moghaddam, M., and L, Sundström Transposon targeting determined by resolvase. FEMS Microbiol. Lett. 186:

24 Kamali-Moghaddam, M., and L, Sundström Arrayed transposase-binding sequences on the ends of transposon Tn5090/Tn402. Nucleic Acids Res. 29: Kholodii, G. Y., S. Z. Mindlin, I. A. Bass, O. V. Yurieva, S. V. Minakhina, and V. G. Nikiforov Four genes, two ends, and a res region are involved in transposition of Tn5053: a paradigm for a novel family of transposons carrying either a mer operon or an integron. Mol. Microbiol. 17: Lim, S. M., and S. A. Webb Nosocomial bacterial infections in intensive care units. I: organisms and mechanisms of antibiotic resistance. Anaesthesia 60: Lyras, D., E. A. Palombo, and V. A. Stanisich Characterization of the Tra2 function of RP1 that affects growth of Pseudomonas aeruginosa PAO and surface exclusion in Escherichia coli K12. Plasmid 27: Minakhina, S., G. Kholodii, S. Mindlin, O. Yurieva, and V. G. Nikiforov Tn5053 family transposons are res site hunters sensing plasmidal res sites occupied by cognate resolvases. Mol. Microbiol. 33: Mindlin, S. Z., S. V. Minakhina, G. Y. Kholodii, A. V. Kopteva, and V. G. Nikiforov Insertion of Tn5053 and Tn402 into different plasmids. Russian J. Genet. 32: Mindlin, S., L. Minakhin, M. Petrova, G. Kholodii, S. Minakhina, Z. Gorlenko, and V. Nikiforov Present-day mercury resistance transposons are common in bacteria preserved in permafrost ground since the Upper Pleistocene. Res. Microbiol. 156: Palombo, E.A., K. Yusoff, V. A. Stanisich, V. Krishnapillai, and N. S. Willetts Cloning and genetic analysis of tra cistrons of the Tra 2/Tra 3 region of plasmid RP1. Plasmid 22:

25 Pansegrau, W., E. Lanka, P. T. Barth, D. H. Figurski, V. A. Stanisich, and C. M. Thomas Complete nucleotide sequence of Birmingham IncP alpha plasmids: Compilation and comparative analysis. J. Mol. Biol. 239: Partridge, S. R., H. J. Brown, and R. M. Hall Characterization and movement of the class 1 integrons known as Tn2521 and Tn1405. Antimicrob. Agents Chemother. 46: Partridge, S. R., and R. M. Hall The IS1111 family members IS4321 and IS5075 have subterminal inverted repeats and target the terminal inverted repeats of Tn21 family transposons. J. Bacteriol. 185: Partridge, S. R., G. D. Recchia, H. W. Stokes, and R. M. Hall Family of class 1 integrons related to In4 from Tn1696. Antimicrob. Agents Chemother. 45, Peters, J. E., and N. L. Craig Tn7: Smarter than we thought. Nat. Rev. Mol. Cell Biol. 2: Petrovski, S Ph.D thesis. La Trobe University, Australia. Genetic diversity of transposable elements that interact with IncP plasmids. 35. Phillips, G. J., S. K. Park, and D. Huber High copy number plasmids compatible with commonly used vectors. Biotechniques 28: Rådström, P., O. Skold, G. Swedberg, J. Flensburg, P. Roy, and L. Sundström Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu and the retroelements. J. Bacteriol. 176: Sanchez, J., P. M. Bennett, and M. H. Richmond Expression of elt-b, the gene encoding the heat-liable enterotoxin of Escherichia coli, when cloned into pacyc184. FEMS Microbiol. Lett. 14:

26 Sambrook, J., E. F. Fritsch, and T. Maniatis Molecular cloning: a laboratory manual. 2nd ed., Cold Spring Harbor Laboratory Press, New York. 39. Schlüter, A., R. Szczepanowski, A. Pühler, and E. M. Top Genomics of IncP-1 antibiotic resistance plasmids isolated from wastewater treatment plants provides evidence for a widely accessible drug resistance gene pool. FEMS Microbiol. Rev. 31: Séveno, N. A., D. Kallifidas, K. Smalla, J. D. van Elsas, J. M. Collard, A. D. Karagouni, and E. M. H. Wellington Occurrence and reservoirs of antibiotic resistance in the environment. Rev. Med. Microbiol. 13: Shapiro, J. A., and P. Sporn Tn402: a new transposable element determining trimethoprim resistance that inserts in bacteriophage lambda. J. Bacteriol. 129: Sinclair, M. I., and B. W. Holloway A chromosomally located transposon in Pseudomonas aeruginosa. J. Bacteriol. 151: Sota, M., H. Kawasaki, and M. Tsuda Structure of the haloacetate-catabolic IncP-1 beta plasmid puo1 and genetic mobility of its residing haloacetate-catabolic transposon. J. Bacteriol. 22: Sota, M., M. Tsuda, H. Yano, H. Suzuki, L. J. Forney, and E. M. Top Regionspecific insertion of transposons in combination with selection for high plasmid transferability and stability accounts for the structural similarity of IncP-1 plasmids. J. Bacteriol. 189: Stanisich, V. A The properties and host range of male-specific bacteriophage of Pseudomonas aeruginosa. J. Gen. Microbiol. 81:

27 Stanisich, V. A., and P. M. Bennett Isolation and characterization of deletion mutants involving the transfer genes of P-group plasmids in Pseudomonas aeruginosa. Mol. Gen. Genet. 149: Stanisich, V. A., P. M. Bennett, and M. H. Richmond Characterization of a translocation unit encoding resistance to mercuric ions that occur on a non-conjugative plasmid in Pseudomonas aeruginosa. J. Bacteriol. 129: Stanisich, V. A., R. Arwas, P. M. Bennett, and F. de la Cruz Characterization of Pseudomonas mercury-resistance transposon Tn502, which has a preferred insertion site in RP1. J. Gen. Microbiol. 135: Thomas, C. M The Horizontal Gene Pool Bacterial Plasmids and Gene Spread. Harwood Academic Publishers, Amsterdam. 50. Thomas, C. M., and K. M. Nielsen Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nat. Revs. Microbiol. 3: Thorsted, P. B., D. P. Macartney, P. Akhtar, A. S. Haines, N. Ali, P. Davidson, T. Stafford, M. J. Pocklington, W. Pansegrau, B. M. Wilkins, E. Lanka, and C. M. Thomas Complete sequence of the IncPβ plasmid R751: Implications for evolution and organization of the IncP backbone. J. Mol. Biol. 282: Tennstedt, T., R. Szczepanowski, I. Krahn, A. Pühler, and A. Schlüter Sequence of the 68,869 bp IncP-1alpha plasmid ptb11 from a waste-water treatment plant reveals a highly conserved backbone, a Tn402-like integron and other transposable elements. Plasmid 53: Wang, G., X. Xu, J. Chen, D. E. Berg, and C. M. Berg Inversions and deletions generated by a mini-γδ (Tn1000) transposon. J. Bacteriol. 176: