Herramientas para el diseño y el análisis de datos de paneles de genes
|
|
- Rodger Cannon
- 5 years ago
- Views:
Transcription
1 Herramientas para el diseño y el análisis de datos de paneles de genes Hospital Sant Pau Barcelona, 16 Jun 2016 BIER Francisco García fgarcia@cipf.es Departamento de Genómica Computacional. CIPF
2 Príncipe Felipe Research Center Goal: biomedical research Basic research in genes, targets, molecular and cellular processes, Nanomedicine and Computational Medicine Translation into clinical practice: personalized medicine, cancer, rare diseases, metabolic and functional impairment Introduction Príncipe Felipe Research Center (CIPF)
3 Who are we? The Computational Genomics Department, in Research Center Prince Felipe Team: multidisciplinary group of 14 researchers and technicians led by Joaquín Dopazo Introduction Genomic Computational Department
4 Who are we? Introduction Genomic Computational Department
5 Why are we interested in Computational Genomics? The overall goal of the department: Apply computational methods biotechnological problems to biomedical and Research interests: The development and application of novel bioinformatics methods aimed at discovering new drugs Identification of genes or proteins may be considered therapeutic targets Personalized medicine: tools for discovering and diagnostic Introduction Genomic Computational Department
6 Why are we interested in Computational Genomics? Introduction Personalized Medicine
7 Why are we interested in Computational Genomics? + Introduction Personalized Medicine and Mendelian Diseases
8 Big Data Genomics Transcriptomics Metabolomics Lipidomics Proteomics Introduction Omics sciences Epigenomics
9 Big Data Biological knowledge Clinical knowledge Gene Ontology KEGG pathways MiRNA, CisRed Biocarta pathways InterPro Motifs HUMSAVAR Gene Expression in tissues Transcription Factor Binding Sites Bioentities from literature ClinVar HGMD COSMIC Introduction Regulatory elements Clinical and biological databases
10 How do we work? Our department collaborates in different research projects and converts researcher needs into bioinformatics solutions Free software for several reasons: Any customer can try our tools The scientific community can test our software This is the current trend in Computational Genomics Introduction Genomic Computational Department
11 How do we work? Introduction Genomic Computational Department
12 How do we work? El CIBER en su Área Temática de Enfermedades Raras (CIBERER) es el centro de referencia en España en investigación sobre enfermedades raras: Objetivo: coordinar y favorecer la investigación básica, clínica y epidemiológica, así como potenciar que la investigación que se desarrolla en los laboratorios llegue al paciente, y dé respuestas científicas a las preguntas nacidas de la interacción entre médicos y enfermos. El CIBERER se compone de un equipo humano de más de 700 profesionales e integra a 62 grupos de investigación. Introduction Genomic Computational Department BIER
13 How do we work? Curso CIBERER de análisis de datos genómicos, 2830 Sep 2016 en Valencia: International course of Genomic Data Analysis, Mar 2017, Valencia: Introduction Genomic Data Analysis courses
14 Web tools to analyze gene panel data BIER CIPF Genomic Computational Department
15 Outline 1) Introduction to NGS Data Analysis 2) TEAM 3) PanelMaps Web Tools Introduction to NGS data analysis
16 NGS technologies How do these technologies work? Reference genome Introduction NGS data analysis
17 Genomics Data Analysis Pipeline Primary Analysis Secondary Introduction 1. Sequence preprocessing Fastq 2. Mapping BAM 3. Variant calling VCF 4. Variant annotation VCF 5. Variant prioritization Studies of genomic variation
18 Fastq format We could say it is a fasta with qualities : Header (like the fasta but starting ) Sequence (string of nt) + and sequence ID (optional) Encoded quality of the GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Introduction NGS data analysis: files format
19 ID:HPG-Aligner VN:1.0 SN:20 LN: = * 0 0 GTTTAGATACTGAAAGGTACATACTTCTTTGTAGGAACAAGCTATCATGCTGCATTTCTATAATATCACATGAATA GIJGJLGGFLILGGIEIFEKEDELIGLJIHJFIKKFELFIKLFFGLGHKKGJLFIIGKFFEFFEFGKCKFHHCCCF AS:i:254 NH:i:1 NM:i:0 HWI-ST700660_138:2:2208:6911:12246#2@0/ = * 0 0 GTTTAGATACTGAAAGGTACATACTTCTTTGTAGGAACAAGCTATCATGCTGCATTTCTATAATATCACATGAATA HHJFHLGFFLILEGIKIEEMGEDLIGLHIHJFIKKFELFIKLEFGKGHEKHJLFHIGKFFDFFEFGKDKFHHCCCF AS:i:254 HWI-ST700660_138:2:1201:2973:62218#2@0/ M * 0 0 AACCCCAAAAATGTTGGAAGAATAATGTAGGACATTGCAGAAGACGATGTTTAGATACTGAAAGGGACATACTTCT FEFFGHHHGGHFKCCJKFHIGIFFIFLDEJKGJGGFKIHLFIJGIEGFLDEDFLFGEIIMHHIKL$BBGFFJIEHE AS:i:254 NH:i:1 NM:i:0 NH:i:1 NM:i:1 HWI-ST700660_138:2:1203:21395:164917#2@0/ M1D72M * 0 0 NCACCCATGATAGACCAGTAAAGGTGACCACTTAAATTCCTTGCTGTGCAGTGTTCTGTATTCCTCAGGACACAGA #4@ADEHFJFFEJDHJGKEFIHGHBGFHHFIICEIIFFKKIFHEGJEHHGLELEGKJMFGGGLEIKHLFGKIKHDG AS:i:254 NH:i:3 NM:i:1 HWI-ST700660_138:2:1105:16101:50526#6@0/ M4D23M * 0 0 AAGAAGTGCAAACCTGAAGAGATGCATGTAAAGAATGGTTGGGCAATGTGCGGCAAAGGGACTGCTGTGTTCCAGC FEHIGGHIGIGJI6FCFHJIFFLJJCJGJHGFKKKKGIJKHFFKIFFFKHFLKHGKJLJGKILLEFFLIHJIEIIB AS:i:368 NH:i:1 NM:i:4 SAM Specification: Introduction NGS data analysis: files format
20 VCF format Introduction NGS data analysis: files format
21 BED format Introduction NGS data analysis: files format
22 Genomics Data Analysis Pipeline Primary Analysis Secondary Introduction 1. Sequence preprocessing Fastq 2. Mapping BAM 3. Variant calling VCF 4. Variant annotation VCF PanelMaps BiERapp 5. Variant prioritization TEAM Studies of genomic variation CSVS
23 Outline 1) Introduction to NGS Data Analysis 2) TEAM 3) PanelMaps Web Tools Targeted Enrichment Analysis and Management
24 Can I interpret sequencing data for diagnostic? BIER TEAM Targeted Enrichment Analysis and Management
25 Introduction Sequencing data Biological knowledge TEAM ClinVar HGMD HUMSAVAR COSMIC Diagnostic TEAM Targeted Enrichment Analysis and Management
26 How does TEAM work? 1. VCF files 2. Gene panel TEAM ClinVar HUMSAVAR TEAM HGMD COSMIC Targeted Enrichment Analysis and Management
27 Getting information SIFT SIFT predicts whether an amino acid substitution affects protein function Interpretation: 1 (tolerated) to 0 (not tolerated) PolyPhen Polymorphism Phenotyping is a tool which predicts possible impact of an amino acid substitution on the structure and function of a human protein Interpretation: 1 (probably damage) to 0 (benign) TEAM Targeted Enrichment Analysis and Management
28 Getting information Consequence type or effect TEAM Targeted Enrichment Analysis and Management
29 How does TEAM work? 1. Defining panel 2. Uploading input data 3. Getting results TEAM Targeted Enrichment Analysis and Management
30 How to define a panel? 1. Name of panel 3. Adding: 2. Diseases - more genes - mutations 4. Save panel TEAM Targeted Enrichment Analysis and Management
31 How to define a panel? Adding new mutations Checking mutations from Genome Viewer TEAM Targeted Enrichment Analysis and Management
32 Web results 1. OVERVIEW TEAM 2. DIAGNOSTIC Targeted Enrichment Analysis and Management
33 Web results 3. SECONDARY FINDINGS TEAM Targeted Enrichment Analysis and Management
34 Reporting results 4. REPORT PDF TEAM Targeted Enrichment Analysis and Management
35 Remarks TEAM is a free web tool Easy-to-use and powerful TEAM helps you for diagnostic TEAM Targeted Enrichment Analysis and Management
36 More information TEAM Tutorial: BIER TEAM Targeted Enrichment Analysis and Management
37 Outline 1) Introduction to NGS Data Analysis 2) TEAM 3) PanelMaps Web Tools Introduction to NGS data analysis
38 Can I visualize and detect deletions for gene panel? BIER PanelMaps A web tool to analyze gene panel data
39 How does PanelMaps work? 1. BAM files 2. BED file PanelMaps PanelMaps Detecting altered regions for targeted sequencing
40 How does PanelMaps work? PanelMaps Coverage description
41 How does PanelMaps work? PanelMaps Detection of altered regions
42 How does PanelMaps work? PanelMaps Detecting altered regions for targeted sequencing
43 Any comment or question? Web tools for gene panel data
Introduction to human genomics and genome informatics
Introduction to human genomics and genome informatics Session 1 Prince of Wales Clinical School Dr Jason Wong ARC Future Fellow Head, Bioinformatics & Integrative Genomics Adult Cancer Program, Lowy Cancer
More informationBABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
More informationThe experience of Andalusia in ehealth and big data --- Big data in health - IMI s HARMONY project, European Parliament, Brussels, 19 June 2018
The experience of Andalusia in ehealth and big data --- Big data in health - IMI s HARMONY project, European Parliament, Brussels, 19 June 2018 Joaquín Dopazo Área de Bioinformática, Fundación Progreso
More informationPrioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationFrancisco García Quality Control for NGS Raw Data
Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationA NGS data analysis course
A NGS data analysis course Introduction Computational Genomics Department, Centro de Investigación Príncipe Felipe (CIPF), Functional Genomics Node, (INB), Bioinformatics Group (CIBERER) Spain. http://bioinfo.cipf.es
More informationCentro Nacional de Análisis Genómico. Where are the Bottlenecks of Genome Analysis Today? Teratec. Ecole Polytechnique, Palaiseau, F.
Centro Nacional de Análisis Genómico Where are the Bottlenecks of Genome Analysis Today? Teratec Ecole Polytechnique, Palaiseau, F Ivo Glynne Gut 29.06.2016 The genomehenge Sequencing capacity >1000 Gbases/day
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationReads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.
Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche
More informationAnnotating your variants: Ensembl Variant Effect Predictor (VEP) Helen Sparrow Ensembl EMBL-EBI 2nd November 2016
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationVariant prioritization in NGS studies: Annotation and Filtering "
Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationResearch Powered by Agilent s GeneSpring
Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What
More informationCory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.
Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range
More informationBICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte
BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationGathering of pathogenicity evidence for novel variants. By Lewis Pang
Gathering of pathogenicity evidence for novel variants By Lewis Pang Novel variants A newly discovered, distinct genetic alteration Within our lab a variant is deemed novel if we haven t seen it before.
More informationOncoMD User Manual Version 2.6. OncoMD: Cancer Analytics Platform
OncoMD: Cancer Analytics Platform 1 Table of Contents 1. INTRODUCTION... 3 2. OVERVIEW OF ONCOMD... 3 3. ORGANIZATION OF INFORMATION IN ONCOMD... 3 4. GETTING STARTED... 6 4.1 USER AUTHENTICATION... 6
More informationProcessing Ion AmpliSeq Data using NextGENe Software v2.3.0
Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order
More informationHigh performance sequencing and gene expression quantification
High performance sequencing and gene expression quantification Ana Conesa Genomics of Gene Expression Lab Centro de Investigaciones Príncipe Felipe Valencia aconesa@cipf.es Next Generation Sequencing NGS
More informationDNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials
Tumor Genomic Profiling Services for Clinical Trials Custom Reports DNA RNA Focused Gene Sets Clinical Trials Accuracy and Content Enhanced NGS Sequencing Extended Panel, Exomes, Transcriptomes Research
More informationIdentification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of. Autosomal Recessive Retinitis Pigmentosa
Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of Autosomal Recessive Retinitis Pigmentosa Corton M 1,2 *, Avila-Fernández A 1,2, Campello L 3, Sánchez M 1,2, Benavides
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationAlissa Interpret The next evolution of Cartagenia Bench
Alissa Interpret The next evolution of Cartagenia Bench Case Study: An Efficient Clinical Pipeline for Microcephaly, RASopathy and Leukodystrophy Gene Panels Using Alissa Interpret s Flexible Classification
More informationBGGN 213: Foundations of Bioinformatics (Fall 2017)
BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More informationBiomedical Network Research Centre on Rare Diseases
Biomedical Network Research Centre on Rare Diseases A model of cooperative research on Rare Diseases ICORD 2010 Prof. Francesc Palau Scientific Director of CIBERER Instituto de Biomedicina, CSIC, Valencia,
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationIntroduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationDNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationBiomarker discovery. Enabling pharmaceutical and biotech partners to discover relevant biomarkers in diseases of interest
Biomarker discovery Enabling pharmaceutical and biotech partners to discover relevant biomarkers in diseases of interest Biomarker discovery A biomarker is a measurable indicator of the severity or presence
More informationPeCan Data Portal. rnal/v48/n1/full/ng.3466.html
PeCan Data Portal https://pecan.stjude.org/ http://www.nature.com/ng/jou rnal/v48/n1/full/ng.3466.html Home Page Pie chart of samples representing cancer types in Data Portal cohorts Top genes for diagnosis
More informationAn Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case
Cartagenia Bench Lab Case Study An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case At a Glance In this case study, you will learn: How the Molecular
More informationImplementing ACMG guidelines on sequence variant interpretation: software-assisted variant curation and filtering
Cartagenia Bench Lab CASE STUDY Implementing ACMG guidelines on sequence variant interpretation: software-assisted variant curation and filtering Authors: Berivan Baskin 1, PhD, FACMG, FCCMG; Tina Smets
More informationData representation for clinical data and metadata
Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate
More informationThe most trusted information for research and clinical genomics
Brochure The QIAGEN Knowledge Base The most trusted information for research and clinical genomics Sample to Insight The most comprehensive Knowledge Base, founded on curation >4,000 Articles / mo >300,000
More informationBioinformatics Core Facility IDENTIFYING A DISEASE CAUSING MUTATION
IDENTIFYING A DISEASE CAUSING MUTATION MARCELA DAVILA 2/03/2017 Core Facilities at Sahlgrenska Academy www.cf.gu.se 5 statisticians, 3 bioinformaticians Consultation 7-8 Courses / year Contact information
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationMRC Stratified Medicine Initiative
MRC Stratified Medicine Initiative Jonathan Pearce Medical Research Council, Translational Programme Manager Pharmacogenetics and Stratified Medicine Network Conference : 14 th January 2015 Stratified
More informationThe HL7 Clinical Genomics Work Group
HL7 Clinical Genomics Domain Information Model The HL7 Clinical Genomics Work Group Prepared by Amnon Shabo (Shvo), PhD HL7 Clinical Genomics WG Co-chair and Modeling Facilitator Pedigree (family health
More informationHow to use Variant Effects Report
How to use Variant Effects Report A. Introduction to Ensembl Variant Effect Predictor B. Using RefSeq_v1 C. Using TGACv1 A. Introduction The Ensembl Variant Effect Predictor is a toolset for the analysis,
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationClinician s Guide to Actionable Genes and Genome Interpretation
Clinician s Guide to Actionable Genes and Genome Interpretation Brandy Bernard PhD Senior Research Scientist Institute for Systems Biology Seattle, WA Dr. Bernard s research interests are in cancer drug
More informationGenomics: Human variation
Genomics: Human variation Lecture 1 Introduction to Human Variation Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development, University
More informationres2)=)colocalisation(eqtl_file="icoslg_eqtl.txt",) gwas_file="uc_gwas_icoslg_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$
Homework 7 res1)=)colocalisation(eqtl_file="ptk2b_eqtl.txt",) gwas_file="ad_gwas_ptk2b_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$ ##))1.02e+06))2.43e+05))6.80e+04))1.51e+02))9.84e+01)$
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationIdentification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources
Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationIn silico variant analysis: Challenges and Pitfalls
In silico variant analysis: Challenges and Pitfalls Fiona Cunningham Variation annotation coordinator EMBL-EBI www.ensembl.org Sequencing -> Variants -> Interpretation Structural variants SNP? In-dels
More informationDrug target identification. Enabling our pharmaceutical and biotech partners to effectively discover proteins or genes as novel targets
Drug target identification Enabling our pharmaceutical and biotech partners to effectively discover proteins or genes as novel targets Drug target identification Target identification and validation are
More informationIDENTIFYING A DISEASE CAUSING MUTATION
IDENTIFYING A DISEASE CAUSING MUTATION Targeted resequencing MARCELA DAVILA 3/MZO/2016 Core Facilities at Sahlgrenska Academy Statistics Software bioinformatics@gu.se www.cf.gu.se/english// Increasing
More informationImplementing ACMG guidelines on sequence variant interpretation: software-assisted variant curation and filtering
Cartagenia Bench Lab Case Study Implementing ACMG guidelines on sequence variant interpretation: software-assisted variant curation and filtering At a Glance In this case study, you will learn: How Uppsala
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationCITATION FILE CONTENT / FORMAT
CITATION 1) For any resultant publications using single samples please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants
More informationGalaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationAn Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case
Bench Lab CASE STUDY An Automated Pipeline for NGS Testing and Reporting in a Commercial Molecular Pathology Lab: The Genoptix Case Authors: Matthew J. McGinniss 1, PhD FACMG, Executive Director, Molecular
More informationSmart India Hackathon
TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential
More information2017 HTS-CSRS COMMUNITY PUBLIC WORKSHOP
2017 HTS-CSRS COMMUNITY PUBLIC WORKSHOP GenomeNext Overview Olympus Platform The Olympus Platform provides a continuous workflow and data management solution from the sequencing instrument through analysis,
More informationFunctional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants. Mulin Jun Li
Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants Mulin Jun Li 2017.04.19 Content Genetic variant, potential function impact and general annotation Regulatory
More informationDeleterious mutations
Deleterious mutations Mutation is the basic evolutionary factor which generates new versions of sequences. Some versions (e.g. those concerning genes, lets call them here alleles) can be advantageous,
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationTerminology for personalized medicine
Terminology for personalized medicine Sarah Ali-Khan 1 PhD, Stephanie Kowal 2, Westerly Luth 2, Richard Gold 1 SJD, and Tania Bubela 2 PhD JD 1. Centre for Intellectual Property Policy (CIPP), Faculty
More informationPathway Analysis. Min Kim Bioinformatics Core Facility 2/28/2018
Pathway Analysis Min Kim Bioinformatics Core Facility 2/28/2018 Outline 1. Background 2. Databases: KEGG, Reactome, Biocarta, Gene Ontology, MSigDB, MetaCyc, SMPDB, IPA. 3. Statistical Methods: Overlap
More informationSuberoylanilide Hydroxamic Acid Treatment Reveals. Crosstalks among Proteome, Ubiquitylome and Acetylome
Suberoylanilide Hydroxamic Acid Treatment Reveals Crosstalks among Proteome, Ubiquitylome and Acetylome in Non-Small Cell Lung Cancer A549 Cell Line Quan Wu 1, Zhongyi Cheng 2, Jun Zhu 3, Weiqing Xu 1,
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationUniversity of Athens - Medical School. pmedgr. The Greek Research Infrastructure for Personalized Medicine
University of Athens - Medical School pmedgr The Greek Research Infrastructure for Personalized Medicine - George Kollias - Professor of Experimental Physiology, Medical School, University of Athens President
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationPersonalized. Health in Canada
Personalized Health in Canada Canadian Institutes of Health Research Personalized Medicine Signature Initiative 2010-2013 0 Dr. Morag Park CIHR Institute of Cancer Research Dr. Paul Lasko CIHR Institute
More informationFrumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health
Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the
More informationNGS sequence preprocessing. José Carbonell Caballero
NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality
More informationearray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
More informationFinal exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular
More information- OMICS IN PERSONALISED MEDICINE
SUMMARY REPORT - OMICS IN PERSONALISED MEDICINE Workshop to explore the role of -omics in the development of personalised medicine European Commission, DG Research - Brussels, 29-30 April 2010 Page 2 Summary
More informationbuilding better science
integrated biology at agilent building better science Integrated Biology: The Quest The complexity of real biology continues to present enormous challenges to researchers seeking answers that can improve
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationAll research lines at the LMU have a strong methodological focus
Content: Genetic Epidemiology and Statistical Genetics in Complex Diseases... 2 Molecular Epidemiology of Complex Phenotypes... 2 Clinical Trials and Translational Medicine... 3 Clinical Epidemiology and
More informationCity University of Hong Kong Course Syllabus. offered by Department of Biomedical Sciences with effect from Semester B 2015 /16
City University of Hong Kong Course Syllabus offered by Department of Biomedical Sciences with effect from Semester B 2015 /16 Part I Course Overview Course Title: Course Code: Course Duration: Credit
More informationGeneWEB Tutorial. Enhancing Biological Research with Gene Networks Bioinformatics Department
GeneWEB Tutorial Enhancing Biological Research with Gene Networks Bioinformatics Department 1 Topics to be Discussed What is GeneWEB and what can it do for me? Gene Network Versus Canonical Pathway Entering
More information