Salmonella enterica serovar Enteritidis one of the main cause of food borne disease transmitted by eggs or eggcontaining

Size: px
Start display at page:

Download "Salmonella enterica serovar Enteritidis one of the main cause of food borne disease transmitted by eggs or eggcontaining"

Transcription

1

2 Salmonella enterica serovar Enteritidis one of the main cause of food borne disease transmitted by eggs or eggcontaining products Egg contamination by both horizontal and vertical transmission Even though the proportion of positive eggs is low both in experimental and natural conditions

3 To investigate the incidence of Salmonella Enteritidis (SE) on egg shells and in egg contents laid by experimentally infected laying hens during the period of 40 days To detect the lenght of period between experimental SE inoculation and egg contamination To compare standard bacteriological method (ISO) and molecular method (Real-Time PCR)

4 TRIAL 1 40 Hyssex brown laying hens TRIAL 2 40 Lohmann brown laying hens 18 weeks old Not immunized against Salmonella Group A Group B Number of the Salmonella enterica subsp. enterica serovar animals per group Enteritidis 1.2 x 10 9 / p.o. 1 ml LENGHT OF BOTH TRIALS 40 DAYS

5 TRIALS 1 and 2 Animals kept in cages (0.5 x 0.5 m) in separated rooms Fed ad libitum with commercial feed for laying hens Housed under standard temperature/light conditions for commercial laying hens BEFORE INOCULATION: Aclimatization for 7 days in experimental environment Fecal samples and cloacal swabs taken to determine the health status and possible previous contamination with Salmonella Birds examined clinically on daily basis

6 EXPERIMENTAL INOCULATION o Single oral dose of 1.2 X 10 9 CFU Salmonella enterica subsp. enterica serovar Enteritidis (SE) o Farm strain, fagotipe 7, isolated from the liver of laying hen during an outbreak in Croatia o Having all genes encoding pathogenicity islands SPI-1 through SPI-5 (Federal Institute for Risk Assessment, Berlin). o Inoculated with the blunt metal probe, directly into the crop of each animal

7 TRIALS 1 AND 2 Experimental group every single egg during 40 days Egg shell and egg content of each egg were examined separately Control group pooled samples (one day - one sample) during 40 days Egg shells and egg contents were examined separately TRIAL 1 SE on egg shells and in egg contens was determined by: HR EN ISO 5679:2003 method Real-Time PCR method TRIAL 2 SE on egg shells and in egg contens were determined by: HR EN ISO 5679:2003 method

8 The samples of the egg shells were taken with the sterile swabs After the egg shells samples were taken, intact shells were cleaned with 70 % etanol and cracked with sterile instrument for sampling of the contents Both samples were then proceed as described by HR EN ISO 6579:2003

9 METHODS (Molecular Real time PCR) For Real-Time PCR detection, both samples in Buffered Peptone water were frozen after 24 hours of incubation (after first step of ISO method) After DNA isolation the following primers and probes were used: Primers 5-3 pmol/µl Forward primer CTC ACC AGG AGA TTA CAA CAT GG 10 Reverse primer AGC TCA GAC CAA AAG TGA CCA TC 10 Probes 5-3 pmol/µl Salmonella LNA (6FAM) CG+ACGGCG+AG+ACCG (BHQ1) 10 (Target probe) IAC probe (JOE) CAC ACG GCG ACG CGA ACG CTT (BHQ1) 10 THERMAL PROFILE: 1 cycle: 95 0 C for 3 minutes 40 cycles: 95 0 C for 30 s, 65 0 C for 60 s (annealing step), 72 0 C for 30 s Described by National Food Institute Technical University of Denmark, Malorney et al., 2004, and Kramer et al., 2011.

10 Days post-inoculation with at least one positive finding Trial 1 ISO method Trial 1 Real-Time PCR Trial 2 ISO method Egg shell Egg content Egg shell Egg content Egg shell Egg content Total* 8/262 0/262 7/262 0/262 0/258 1/258 (3.0%) (0,0%) (2.7%) (0.0%) (0.0%) (0.4%) *Number of positive/total number of eggs TRIAL 1: SE was found on: 6 egg shells on Day 10 One egg shell on Days 11 and 14 Altogether 8 egg shells of a total of 262 laid eggs TRIAL 2: SE was found in: One egg content on Day 7 of a total of 258 laid eggs All eggs from control groups were negative

11 (Molecular Real time PCR) Seven out of eight egg shells positive by ISO method were also positive by Real-Time PCR One sample collected on Day 14 positive by ISO method was negative by Real-Time PCR, probably due to the presence of inhibitors that may negatively affect the isolation of bacterial DNA All samples negative by ISO method were also negative by Real-Time PCR PROBE RESULT Ct VALUE positive 36 LNA negative > 40 IAC positive negative < 40

12 In two equal trials carried out with two different commercial lines of laying hens inoculated orally by highly pathogenic Salmonella Enteritidis (SE), SE was found both on egg shells and in egg content Positive egg shells in Trial 1 and positive content in Trial 2 suggest that eggs can be contaminated by both horizontal and vertical SE transmission Low proportion of positive eggs in both trials is in line with already published findings. The time period between SE inoculation and the first egg contamination seems to be the same in both trials (10 vs.7 days) Positive eggs were laid only in a short period of time, from day 7 to day 14 post infection Almost identical results were obtained by both ISO and molecular methods

13

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplemental material

Supplemental material Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize Line MIR604 Using Real-time PCR Protocol 03 April 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology

More information

Introduction Use of quality planting materials - prerequisite for increasing production and productivity of banana

Introduction Use of quality planting materials - prerequisite for increasing production and productivity of banana A novel molecular technique for mass indexing of tissue cultured banana plants for Banana Bunchy Top Virus (BBTV) W.A.R.T. Wickramaarachchi, K.T. Ragnaswamy and K.S. Shankaraappa Horticultural Crops Research

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Legends for supplementary figures 1-3

Legends for supplementary figures 1-3 High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

Salmonella Enteritidis vaccine strain SM24/Rif12/Ssq

Salmonella Enteritidis vaccine strain SM24/Rif12/Ssq For in vitro Veterinary Diagnostics only. DNA Extraction and Real-Time PCR for differentiation of Salmonella Enteritidis vaccine strain SM24/Rif12/Ssq from field strains www.kylt.eu DIRECTION FOR USE Art.

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY MATERIALS Supplementary Table S1: Water sampling sites in Brisbane River and their characteristics Sampling sites GPS coordinates Site characteristics Suspected source of fecal pollution

More information

Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR Protocol 30 March 2010 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

NordVal International / NMKL c/o Danish Technical University Mørkhøj Bygade 19, DK-2060 Søborg, DK Salmonella Velox

NordVal International / NMKL c/o Danish Technical University Mørkhøj Bygade 19, DK-2060 Søborg, DK   Salmonella Velox NordVal International / NMKL c/o Danish Technical University Mørkhøj Bygade 19, DK-2060 Søborg, DK www.nmkl.org Issued for: Salmonella Velox NordVal No: 046 First approval date: 7 June 2016 Renewal date:

More information

Official Journal of the European Union L 73/5

Official Journal of the European Union L 73/5 19.3.2009 Official Journal of the European Union L 73/5 COMMISSION REGULATION (EC) No 213/2009 of 18 March 2009 amending Regulation (EC) No 2160/2003 of the European Parliament and of the Council and Regulation

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

Y-chromosomal haplogroup typing Using SBE reaction

Y-chromosomal haplogroup typing Using SBE reaction Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G

More information

NordVal International / NMKL c/o Norwegian Veterinary Institute PB 750 Sentrum, N-0106 Oslo, Norwa Salmonella Velox

NordVal International / NMKL c/o Norwegian Veterinary Institute PB 750 Sentrum, N-0106 Oslo, Norwa   Salmonella Velox NordVal International / NMKL c/o Norwegian Veterinary Institute PB 750 Sentrum, N-0106 Oslo, Norwa www.nmkl.org Issued for: NordVal No: 046 First approval date: 7 June 2016 Valid until: 7 June 2018 Manufactured

More information

Detection and quantification of bovine polyomavirus by real-time PCR

Detection and quantification of bovine polyomavirus by real-time PCR Page 1 of 5 EU FP VII PROJECT VITAL STANDARD OPERATING CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 18-02-2010 FERA: 28-03-2010 Wim Van der Poel: 31-03-2010 Page 2 of 5 WARNING All samples and controls

More information

Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Ref. Ares(2013)1103954-15/05/2013 Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

More information

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

Event-specific Method for the Quantification of maize MON by Real-time PCR. Validated Method

Event-specific Method for the Quantification of maize MON by Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Health, Consumers & Reference Materials Food & Feed Compliance Unit Event-specific Method for the Quantification of maize MON 87403 by Real-time PCR Validated

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

Supplemental Table 1. Primers used for PCR.

Supplemental Table 1. Primers used for PCR. Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Protocol 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology

More information

Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Supporting Information

Supporting Information Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*

More information

ORFs and genes. Please sit in row K or forward

ORFs and genes. Please sit in row K or forward ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

More information

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

More information

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013 Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription

More information

Solid-phase PCR in a picowell array for immobilizing and arraying 100,000 PCR products to a microscope slide

Solid-phase PCR in a picowell array for immobilizing and arraying 100,000 PCR products to a microscope slide Solid-phase PCR in a picowell array for immobilizing and arraying 100,000 PCR products to a microscope slide Jochen Hoffmann a,b, Martin Trotter a, Felix von Stetten a,b, Roland Zengerle, a,b,c Günter

More information

b. 8 or 10 trays and domes are required for testing 10,000 small or large seeds, respectively.

b. 8 or 10 trays and domes are required for testing 10,000 small or large seeds, respectively. VERSION: 1.0 DATE: 12/2012 PATHOGEN: Acidovorax avenae ssp. citrulli (syn: A. citrulli) HOST: Cucurbits COMMON NAME: bacterial fruit blotch (BFB) METHOD: Cb 1.5 CSP Labs Seedling PCR METHOD CLASS: TEMPORARY

More information

L 170/12 Official Journal of the European Union

L 170/12 Official Journal of the European Union L 170/12 Official Journal of the European Union 1.7.2005 COMMISSION REGULATION (EC) No 1003/2005 of 30 June 2005 implementing Regulation (EC) No 2160/2003 as regards a Community target for the reduction

More information

SUPPORTING INFORMATION FILE

SUPPORTING INFORMATION FILE Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of

More information

Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region)

Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region) Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Xie YL, Chakravorty S, Armstrong DT, et al. Evaluation of a

More information

Annex 6.5 CDC real-time rubella RT-PCR protocol targeting rubella p150 gene (154 nt region)

Annex 6.5 CDC real-time rubella RT-PCR protocol targeting rubella p150 gene (154 nt region) Annex 6.5 CDC real-time rubella RT-PCR protocol targeting rubella p150 gene (154 nt region) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to

More information

New Test Validation for Detection of S. Enteritidis in Poultry

New Test Validation for Detection of S. Enteritidis in Poultry New Test Validation for Detection of S. Enteritidis in Poultry Kim Lam Chiok Salmonella and public health S. Enteritidis is associated with eggs due to vertical transmission; although around 2000 serotypes

More information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification. RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11 11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer

More information

PCR-based Markers and Cut Flower Longevity in Carnation

PCR-based Markers and Cut Flower Longevity in Carnation PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso

More information

Event-specific Method for the Quantification of Cotton Event MON Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Cotton Event MON Using Real-time PCR. Protocol Event-specific Method for the Quantification of Cotton Event MON 88913 Using Real-time PCR Protocol 5 May 2009 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time

More information

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

More information

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905) 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Salmonella enterica TaqMan PCR Kit Product# TM32100 Product Insert

More information

Protocol Rf3 Community Reference Laboratory for GM Food and Feed

Protocol Rf3 Community Reference Laboratory for GM Food and Feed EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp

More information

Event-specific Method for the Quantification of Soybean Event DP Using Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean Event DP Using Real-time PCR. Validated Method Event-specific Method for the Quantification of Soybean Event DP-356043-5 Using Real-time PCR Validated Method 29 March 2010 Joint Research Centre Institute for Health and Consumer Protection Molecular

More information

2

2 1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

More information

Event-specific Method for the Quantification of. Oilseed Rape Line RT73 Using Real-time PCR. Protocol. 07 February 2007

Event-specific Method for the Quantification of. Oilseed Rape Line RT73 Using Real-time PCR. Protocol. 07 February 2007 EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification

More information

Copy number estimation of P. falciparum pfmdr1 v1.1

Copy number estimation of P. falciparum pfmdr1 v1.1 Copy number estimation of P. falciparum pfmdr1 v1.1 Procedure Molecular Module WorldWide Antimalarial Resistance Network (WWARN) Suggested citation: Molecular Module. 2011. Copy number estimation of P.

More information

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse

More information

SELECTION OF MOLECULAR APTAMERS FOR

SELECTION OF MOLECULAR APTAMERS FOR SELECTION OF MOLECULAR APTAMERS FOR IDENTIFICATION OF LIVE CELLS OF RALSTONIA SOLANACEARUM: A NEW POTENTIAL METHOD IN PLANT PATHOLOGY Patrice Champoiseau, University of Florida 2009 APS ANNUAL MEETING

More information

Occurrence of viruses in apple and pear orchards in Latvia.

Occurrence of viruses in apple and pear orchards in Latvia. INTERNATIONAL SCIENTIFIC CONFERENCE Sustainable Fruit Growing: From Plant to Product Occurrence of viruses in apple and pear orchards in Latvia. Neda P pola, Anna K le, Inga Moro ko Bi evska. The economically

More information

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells

More information

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+ ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5

More information

Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean CV127 Using Real-time PCR Protocol 20 September 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium.

Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium. Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium. PCR of representative tissues with oligonucleotides to identify recombination of the Nkx2.2flox allele. Nkx2.2 is specifically deleted

More information

Supporting Information

Supporting Information Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT

More information

Enumeration of Salmonella in eggs and egg products by quantitative PCR

Enumeration of Salmonella in eggs and egg products by quantitative PCR www.baselineeurope.eu Enumeration of Salmonella in eggs and egg products by quantitative PCR D. JAKOČIŪNö 1, F. PASQUALI 2, C. SOARES DA SILVA 3, A. LUCCHI 1, A. DE CESARE 1, G. KLEIN 3, G. MANFREDA 2

More information

Event-specific Method for the Quantification of Soybean MON Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean MON Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean MON 87705 Using Real-time PCR Protocol 17 January 2012 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

Supplementary Information

Supplementary Information Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials

More information

For in vitro Veterinary Diagnostics only. Kylt Brachyspira spp. Real-Time PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Brachyspira spp. Real-Time PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Brachyspira spp. Real-Time PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Brachyspira spp. Real-Time PCR Detection A. General Kylt Brachyspira spp. products

More information

S4B fluorescence (AU)

S4B fluorescence (AU) A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

For in vitro Veterinary Diagnostics only. Kylt Chlamydiaceae Screening. Real-Time PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Chlamydiaceae Screening. Real-Time PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Chlamydiaceae Screening Real-Time PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Chlamydiaceae Screening Real-Time PCR Detection A. General Kylt Chlamydiaceae

More information

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening

More information

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C. arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein

More information

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner*

More information