SELECTION OF MOLECULAR APTAMERS FOR
|
|
|
- James Collins
- 6 years ago
- Views:
Transcription
1 SELECTION OF MOLECULAR APTAMERS FOR IDENTIFICATION OF LIVE CELLS OF RALSTONIA SOLANACEARUM: A NEW POTENTIAL METHOD IN PLANT PATHOLOGY Patrice Champoiseau, University of Florida 2009 APS ANNUAL MEETING August 1-5, 2009 Portland, Oregon
2 Outlines Introduction Objective Method & protocols Results Conclusion & perspectives Acknowledgements
3 Introduction R. solanacearum causes bacterial wilts on a wide range of planted crops, ornamentals and weeds worldwide. Species complex. 5 races 5 biovars 4 phylotypes Race 3 biovar 2 (R3bv2). World wide distribution except US and Canada Major disease of potato Introduction in the US in latently infected geranium cuttings Strictest biosecurity regulations Critical need for unambiguous identification of R3bv2. Development of fast, sensitive, and specific detection methods.
4 Objective Evaluate the effectiveness of cell-selex* to produce molecular aptamers for differentiation of strains of R. solanacearum (detection of live cells). *System Evolution of Ligands by EXponential enrichment
5 Method & protocols Molecular aptamers. - Single-stranded oligonucleotides. - Bind with high affinity to their target. - Detection of whole cells. - Small molecules, chemically stable. - Molecular probes for cancer studies. - Blocking molecules: reduced virulence in M. tuberculosis. Example of an RNA Aptamer Cell-SELEX. Repeated competitive binding from an initial DNA or RNA library (random sequences) to the target molecules.
6 Method & protocols Schematic representation of cell-selex. 1Positive selection 3 Sequencing From Shangguan D. et al. PNAS, Counter selection Selection monitored with flow cytometry
7 Method & protocols Principles of flow-cytometry Bacterial suspension Laser detection system Side Scattered light (SSC) Forward Scattered light (FSC) Fluorescent light (FL) FSC = Indication of particle s size. SSC = Information about the outer composition of a cell. FL = Fluorescence detector (1 to 4). Hydrodynamic fluid of single cells
8 Method & protocols Flow-cytometry data for cell-selex Shift Histogram ssdna Library (before selection) Total number of cells Evolved DNA pool (after N rounds of selection) A shift of the fluorescence intensity pick is an indication of enrichment of single DNA sequences with high affinity to the target cells (potential aptamers). Fluorescence Sequencing and analysis
9 Method & protocols Sequence analysis From around unique random sequences Random sequences Homologous family 1 Homologous family 2
10 Method & protocols Bacterial strains (cells) UW485: Race 3 biovar 2T Rs5: Race 1 biovar 1 (Florida) Cell growth conditions Liquid medium: MMP Phosphate-based buffer 36 hours growth ssdna Library (78 nucleotides) Library 5 - ACG ACA CAC AGC ACA CTC A - (NNNNNNNN ) - TC TTC TCC CTC GTC CTA CCT Carboxyfluorescein Forward Primer Reverse Primer 5 - ACG ACA CAC AGC ACA CTC A AGG TAG GAC GAG GGA GAA GA -3 Fluorescence dsdna (PCR product) ssdna Biotin
11 Results Flow-cytometry histograms (10 rounds) 20,000 cells Shift Library 8 th 10 th B Target cells (UW485) Negative cells (Rs5)
12 Results Flow-cytometry histograms (14 rounds) 20,000 cells Shift Library 11 th 12 th 14 th Target cells (UW485) Negative cells (Rs5)
13 Results Flow-cytometry histograms (17 rounds) 20,000 cells Library 16 th 17 th Target cells (UW485) Negative cells (Rs5)
14 Results Sequencing of evolved DNA pools (454) SP repeated sequences (out of 3263) One homologous family : 12 repeated sequences (0.4% total) SP repeated sequences (out of 8044) Several homologous family : 22 repeated sequences (0.3% total) Only one conserved DNA family For Primer cagggctcgagatgtttgcgatctgttgtccgttggga- Rev Primer
15 Conclusion and perspectives Conclusion - Efficiency of flow-cytometry to differentiate cells of R. solanacearum after 10 rounds of selection. - Enrichment of DNA sequences with cell-selex. - Low enrichment due to variability in target molecules (could be EPS?). - Amplification of potential aptamers not shown. Perspective - Increase the number of repeated sequences. More rounds of selection. - Test the affinity of the repeated sequences. Amplification and testing these sequences as potential aptamers. - Control the specificity of the repeated sequences. Test with target cells and heterologous bacteria.
16 Acknowledgements Team members. Caitilyn Allen, Department of Plant Pathology, University of Madison-Wisconsin. Jeffrey B. Jones, Department of Plant Pathology, University of Florida. Team collaborators. Weihong Tan, Department of Chemistry, University of Florida. Kwame Sefah, Department of Chemistry, University of Florida. Financial support. National Research Initiative (NRI) program of the USDA Cooperative State Research, Education, and Extension Services (CSREES).
Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
Table S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
COMPAS for the Analysis of SELEX Experiments
COMPAS for the Analysis of SELEX Experiments COMPAS (COMmon PAtternS) is a software tool that was especially developed to harness the technology of next generation sequencing (NGS) to bring light into
Sequence Design for DNA Computing
Sequence Design for DNA Computing 2004. 10. 16 Advanced AI Soo-Yong Shin and Byoung-Tak Zhang Biointelligence Laboratory DNA Hydrogen bonds Hybridization Watson-Crick Complement A single-stranded DNA molecule
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
Supplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
Characterization of Aptamer Binding using SensíQ SPR Platforms
Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional
strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
![strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular](/thumbs/72/66361212.jpg "strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular")
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Programmed Ribosomal Frameshifts as Synthetic Biology Tools. University of Lethbridge Lethbridge, AB, Canada November 2, 2013.
c F h R a A n M g E er Programmed Ribosomal Frameshifts as Synthetic Biology Tools University of Lethbridge Lethbridge, AB, Canada November 2, 2013 FRAMEchanger Project Goals Design a new class of regulatory
Lecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
Supporting Information
Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Site-Specific Control of Distances between Gold Nanoparticles using Phosphorothioate Anchors on DNA and a Short Bifunctional Molecular Fastener
DNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for
Supporting Information for A high efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of microrna in cancer cells Zhaoyang
PROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
Combinatorial RNA libraries
SELEX and Artificial Ribozymes Some definitions SELEX: Systematic Evolution of Ligands by EXponential Enrichment (alternatively: in vitro selection, in vitro evolution) Aptamer: nucleic acid ligand (from
Fluorescent in-situ Hybridization
Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved
Electronic Supplementary Information
Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,
Supplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
II 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
Wet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics
TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics INTRODUCTION The development of renewable capture reagents
A Microfluidic Approach to Selection and Enrichment. of Aptamers for Biomolecules and Cells. Jin Ho Kim
A Microfluidic Approach to Selection and Enrichment of Aptamers for Biomolecules and Cells Jin Ho Kim Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the
Chapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting materials Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
NEBNext Multiplex Oligos for Illumina (Index Primers Set 2)
LIBRARY PREPARATION NEBNext Multiplex Oligos for Illumina (Index Primers Set 2) Instruction Manual NEB #E7500S/L 24/96 reactions Version 4.0 1/18 be INSPIRED drive DISCOVERY stay GENUINE This product is
RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
MIDTERM EXAMINATION (March 22, 2012) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Spring Semester, 2012
MIDTERM EXAMINATION (March 22, 2012) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Spring Semester, 2012 0. Write down your name and the last 4 digits of your SIN in all the pages (1) 1.
Introduction. Technical Note
DNA and RNA quantification: fast and simple with PicoGreen dsdna and RiboGreen RNA quantification reagents Fluorescence intensity on Infinite F2 and Infinite M2 Introduction DNA quantification Detection
Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
Systematic Evolution of Ligands by Exponential Enrichment SELEX
Systematic Evolution of Ligands by Exponential Enrichment SELEX SELEX Systematic evolution of ligands by exponential amplification * Isolation of new RNs with novel properties * New therapeutics, New diagnostics
UNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Interpretation of sequence results
Interpretation of sequence results An overview on DNA sequencing: DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It use a modified PCR reaction where both
Development of DNA aptamers using Cell-SELEX
Development of DNA aptamers using Cell-SELEX Kwame Sefah 1,4, Dihua Shangguan 1,3, Xiangling Xiong 1, Meghan B O Donoghue 1 & Weihong Tan 1,2,4 protocol 1 Center for Research at Bio/Nano Interface, Department
Smart release technology for improving fertilizer efficiency
Smart release technology for improving fertilizer efficiency Emily Mastronardi, Dr. Carlos Monreal, Dr. Maria C. DeRosa AAFC-ECORC and Carleton University Why create nanofertilizers in Canada? Canada has
Genomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Session 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
Flow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
Codon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
Supplementary Material and Methods
Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
QuickExtract FFPE RNA Extraction Kit
QuickExtract FFPE RNA Extraction Kit Cat. Nos. QFR82805 and QFR82050 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
Molecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
QuickExtract RNA Extraction Kit
Cat. Nos. QER09015 and QER090150 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 299 12/2012 1
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
A double-stranded molecular probe for homogeneous nucleic acid analysis
PAPER www.rsc.org/analyst The Analyst A double-stranded molecular probe for homogeneous nucleic acid analysis Daniel Meserve, a Zhaohui Wang, a Donna D. Zhang b and Pak Kin Wong* a,c,d Received 20th March
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
arc lamp is substituted. Before
CE update [cytology hematology generalist] The Principles of Flow Cytometry Antony C. Bakke, PhD From the Department of Pathology, Oregon Health Sciences University, Portland, OR On completion of this
MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46
MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 INTRODUCTION The mammalian MPR 46 (human, mouse, bovine) sequences show extensive homologies. Among the non-mammalian vertebrates, only a partial sequence
Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
Stretching DNA as a template for molecular construction
title Workshop " DNA-Based Molecular Electronics" Jena, May 13-15, 2004 Stretching DNA as a template for molecular construction Masao Washizu 1, Yuji Kimura 1, Takuya Kobayashi 1, Osamu Kurosawa 1,2 Sayoko
LATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
Supplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Blanken MO, Rovers MM, Molenaar JM, et al. Respiratory syncytial
APTAMER SELECTION FOR JX-594. Andrea Robinson
APTAMER SELECTION FOR JX-594 Andrea Robinson Research report submitted to the Department of Biochemistry, Microbiology and Immunology in partial fulfillment of the requirements for the course BCH4040 University
Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Supplementary Information In Vitro Selection of DNA-based Aptamers that Exhibit RNA-like
Rapid Acquisition of High-Affinity DNA Aptamer Motifs Recognizing Microbial Cell Surfaces Using Polymer- Enhanced Capillary Transient Isotachophoresis
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 Supplemental Information Rapid Acquisition of High-Affinity DNA Aptamer Motifs Recognizing
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
Protocol T45 Community Reference Laboratory for GM Food and Feed
EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
Fundamentals of Real Time PCR
Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
![Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]](/thumbs/77/74807071.jpg "Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]")
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
and Higher-Order Cellular Information Processing
Engineering RNA Devices for Gene Regulation, Biosensing, and Higher-Order Cellular Information Processing Thesis by Maung Nyan Win In Partial Fulfillment of the Requirements for the Degree of Doctor of
Bio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
Name: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014
MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 0. Write down your name and the last 4 digits of your SID on all the pages (1) 1.
NEBNext Multiplex Oligos for Illumina (Index Primers Set 3)
LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 3) Instruction Manual NEB #E7710S/L 24/96 reactions This product is intended for research purposes only. This product is not intended
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Int J Clin Exp Med 2014;7(9): /ISSN: /IJCEM Jin Ah Ryuk *, Young Seon Kim *, Hye Won Lee, Byoung Seob Ko
Int J Clin Exp Med 2014;7(9):2488-2496 www.ijcem.com /ISSN:1940-5901/IJCEM0001438 Original Article Identification of Acorus gramineus, A. calamus, and A. tatarinowii using sequence characterized amplified
Just one nucleotide! Exploring the effects of random single nucleotide mutations
Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based
NEBNext Multiplex Oligos for Illumina (Index Primers Set 4)
LIBRARY PREPARATION NEBNext Multiplex Oligos for (Index Primers Set 4) Instruction Manual NEB #E7730S/L 24/96 reactions Version 2.0 12/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6.
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae contains the vector plexsy_invitro-2 Cat. No. EGE-2002-15 FOR RESEARCH USE ONLY. NOT INTENDED