SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

Transcription

1 Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko Yamaguchi, Hisae Kadowaki, Kohsuke Takeda, Hideki Nishitoh, Atsushi Matsuzawa, Isao Naguro, and Hidenori Ichijo

2 Figure S1. The Effect of Zinc Deficiency on SOD1 Status, Related to Figure 2 (A) IP-IB analysis of SOD1-Derlin-1 interaction in HEK293 cells. Cells transfected with Flag-SOD1 and Venus-Derlin-1(CT4)-HA were incubated with 10% of either normal or ions-depleted FBS for 72 h either in the presence or absence of zinc. For the preparation of ions-depleted FBS, FBS was treated with Chelex-100 resin.

3 (B) Lysate from HEK293 cells transfected with Flag-SOD1 and stimulated with or without TPEN were fractionated by Superdex 75 column in PBS. IB analysis of SOD1 in each fraction. (C) Lysate from HEK293 stimulated with or without TPEN were fractionated by Superdex 75 column in PBS. IB analysis of endogenous SOD1 in each fraction. (D) IB analysis of SOD1 complex. HEK293 cells transfected with Flag-SOD1 were treated with TPEN. Cell extracts were resolved by SDS PAGE either in reduced (+DTT) or non-reduced (-DTT) condition.

4 Figure S2. The SOD1-Derlin-1 Interaction Induces ER Stress Under Conditions of Zinc Deficiency, Related to Figure 4

5 (A) IB analysis of Herp induction in NSC34 cells infected with GFP or Flag-SOD1 expressing adenovirus. (B) Gene expression analyzed by qrt-pcr. HEK293 cells transfected with control, SOD1 or Derlin-1 sirna were stimulated with 10 µm TPEN for 12 h (mean ± SD, n=4, t-test). *P < 0.05, **P < (C) IB analysis of SOD1 and Derlin-1 in HEK293 cells. Cells were transfected with control, SOD1 or Derlin-1 sirna.

6 Figure S3. The SOD1-Derlin-1 Interaction Induces the Inhibition of Cytosolic Protein Synthesis and the Inhibition of Protein Synthesis Improve the Viability, Related to Figure 5

7 (A) Protein synthesis analysis. HeLa cells were infected with control or Derlin-1(CT4) expressing lentivirus. After stimulation with 10 µm TPEN for the indicated length of time, cells were metabolically labeled with [ 35 S] methionine and cysteine. The decrease is shown as a percentage of the intensity observed at 0 h TPEN stimulation (mean ± SD, n=3, t-test). *P < (B) Vaibility was measured for HeLa cells pre-treated with 50 µg/ml CHX for 15 min, washed out and then stimulated with TPEN for 24 h. The decrease is shown as a percentage of the viability observed in the non-stimulated condition (mean ± SD, n=3, t-test). *P < 0.05, **P < 0.01.

8

9 Figure S4. ZIP14 Was Induced by ATF6 in the Condition of Zinc Deficiency, Related to Figure 6 (A) IB analysis of ZIP14 in HepG2 cells. Cells were transfected with control or ZIP14 sirna. Asterisks, non-specific bands. (B) The sequence of up-region from translational start of hzip14 promoter -0.1K contains ERSE- and UPRE-like sequence. The mutations of each sequence were also indicated. (C-F) Luciferase assay of hzip14 promoter in HepG2 cells. Cells transfected with the luciferase reporter plasmid containing various lengths of hzip14 promoter regions (-1.15K, -0.85K, -0.35K, -0.1K) or GRP78 were stimulated with 5 µg/ml tunicamycin (Tu) for 24 h (C) (n=3). Cells were transfected with indicated reporter plasmid and stimulated with 5 µg/ml tunicamycin for 24 h (D) (n=3, ANOVA). Cells were transfected with indicated reporter plasmid with or without ATF Flag (E) (n=3). Cells were transfected with hzip14 promoter -0.1K with or without ATF Cells were then stimulated with 5 µg/ml tunicamycin for 24 h (F) (n=3, t-test). (G) Gene expression analysis in HepG2 cells infected with GFP or ATF Flag

10 expressing adenovirus (n=3). All data represented mean ± SD. *P < 0.05, **P < 0.01.

11 EXTENDED EXPERIMENTAL PROCEDURES Plasmids, Adenovirus Vector, Lentiviral Vectors, and sirnas The cdnas encoding Flag-SOD1 and ATF6-Flag mutants were constructed in the pcdna3.0 plasmid (Invitrogen) using PCR. The pcdna3.0-derlin-1-ha, pcdna3.0-variant of yellow fluorescent protein (Venus)-Derlin-1(CT1)-HA, pcdna3.0-venus-derlin-1(ct4)-ha, pcdna3.0-venus-derlin-1(ct5)-ha, pcdna3.0-venus-derlin-2(ct)-ha, pcdna3.0-venus-derlin-3(ct)-ha, pcdna3.0-venus-ha, and pcdna3.0-flag-sod1 plasmids have been described previously 13. The genome DNAs that encoded the hzip14 promoter regions for the luciferase assay were constructed in the pgl4.10 plasmid (Promega) using PCR. Transfection was performed using the FuGENE6 transfection reagent (Roche) according to the manufacturer s instructions. Recombinant adenovirus and lentivirus were constructed and used for infections as described 13. The small interfering RNAs used for gene knockdown are presented in the list of small interfering RNAs section.

12 Antibodies The generation of MS785 and the anti-herp antibody have been previously described 14. The Derlin-1 antibody has been previously described 13. Antibodies against SOD1 (polyclonal SOD100, Enzo Life Science), α-tubulin (Harlan), PERK (Cell Signaling), ZIP14 (abcam), Flag (M2, Sigma; 1E6, Wako), and HA (3F10, Roche) were purchased. Cell Cultures HEK293 cells and NSC34 cells were cultured in Dulbecco s modified Eagle s medium (DMEM) containing 10% FBS, 4.5 mg/ml glucose, and 100 units/ml penicillin. HeLa cells were cultured in DMEM containing 10% FBS, 1 mg/ml glucose, and 100 units/ml penicillin and were maintained in an atmosphere with 5% CO 2 at 37 C. HepG2 cells were cultured in MEM containing 10% FBS and 100 units/ml penicillin as well as maintained in an atmosphere with 5% CO 2 at 37 C. Quantitative RT-PCR

13 The total RNA was isolated from cells using the Isogen reagent (Wako) and reverse-transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). PCR was performed using the Power SYBR Green PCR Master Mix and ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Roche). The primers used for PCR are presented in the primers used for qrt-pcr section. The levels were normalized to S18 mrna. Immunoblotting Analysis The cells were lysed on ice in RIPA buffer (for the SOD1 aggregation assay and ZIP14 protein) or in a buffer containing 20 mm Tris-HCl ph 7.5, 150 mm NaCl, 10 mm EDTA, 1% Triton X-100, 5 µg/ml leupeptin and 1 mm phenylmethylsulfonyl fluoride. After centrifugation, the cell extracts were resolved using SDS-PAGE and electroblotted onto polyvinylidine difluoride membranes. After blocking with 5% skim milk in TBS-T (50 mm Tris-HCl ph 8.0, 150 mm NaCl, and 0.05% Tween 20), the membranes were probed with antibodi -tubulin, Derlin-1, GFP, ZIP14 or PERK. The proteins were detected using an ECL system.

14 Immunoprecipitation Analysis The cell lysates were immunoprecipitated with an anti-flag antibody and MS785 using protein G-Sepharose. For the endogenous SOD1-Derlin-1interaction, ImmunoCruz TM IP/WB Optima A (SANTA CRUZ BIOTECHNOLOGY, INC.) was used with the anti-derlin-1 antibody. The beads were washed with washing buffer 1 containing 20 mm Tris-HCl ph 7.5, 500 mm NaCl, 5 mm EGTA, and 1% Triton X-100 as well as washing buffer 2 containing 20 mm Tris-HCl ph 7.5, 150 mm NaCl, and 5 mm EGTA; the beads were then separated by SDS-PAGE and immunoblotted with antibodies for HA, Flag, SOD1, or Derlin-1. The protein was detected using an ECL system. Aliquots of the whole- -tubulin, HA, Flag, and SOD1. Sample Preparation for Characterizing the Serum Factor FBS was fractionated by gel filtration chromatography using the Superdex 75 (Figure. 1B)

15 or Superdex 200 column (Figure 1C) in a Hepes-based buffer (50 mm HEPES-KOH [ph 7.5], 10 mm KCl, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, and 1.5 mm MgCl 2 ). Boiled FBS was separated by centrifugation at 100,000 g into precipitate (ppt) and supernatant (sup) fractions. Eluted fractions from the Superdex 75 column were treated with alkaline buffer, proteinase K (ProK) or phosphate buffered saline (PBS) at 37 C for 3 h. After neutralization or inactivation, the samples were added to the cell media (Figure 1D). Eluted fractions from the Superdex 200 column were ethanol precipitated (EtOH) and separated into ppt and sup fractions (Figure 1E). Lipids in FBS were extracted using the Bligh-Dyer method under acidic (HCl), neutral or alkaline (NaOH) conditions. The samples were separated into aqueous (upper) and organic layers (lower) (Figure 1F). Measuring the Zinc Concentration The zinc concentration was determined using the Metallo Assay Zinc LS-MPR (AKJ Global Technology Co., Ltd.).

16 Cell Viability Cell viability was determined using Cell Counting Kit-8 (Doujindo). Cell viability was determined under each condition in triplicate and expressed as a percentage compared with the non-stimulated cells. Luciferase Assay The HepG2 cells were transiently transfected with expression and reporter plasmids. The cell extracts were analyzed for firefly luciferase and Renilla activity using the dual luciferase kit (Promega). Firefly luciferase activity was divided by Renilla luciferase activity to normalize transfection efficiency. List of Small Interfering RNAs sirnas SOD1 #1 forward reverse SOD1 #2 forward SOD1-HSS (Invitrogen) aauccaugcaggccuucagucaguc gacugacugaaggccugcauggauu SOD1-HSS (Invitrogen) auuaucuccaaacucaugaacaugg

17 reverse Derlin-1 #1 forward reverse Derlin-1 #2 forward reverse Derlin-1 #3 forward reverse Control sirna ccauguucaugaguuuggagauaau DERL1-HSS (Invitrogen) aaccaauagcgcgugaucgccggga ucccggcgaucacgcgcuauugguu DERL1-HSS (Invitrogen) augaggccgaguuugccgaccaagg ccuuggucggcaaacucggccucau DERL1-HSS (Invitrogen) accaaauccugauacuccuccucuc gagaggaggaguaucaggauuuggu Stealth RNAi Negative Control Medium GC Duplex (Invitrogen) Primers Used for qrt-pcr sxbp-1 forward sxbp-1 reverse BiP forward BiP reverse S18 forward S18 reverse hzip14 forward hzip14 reverse mzip1 forward mzip1 reverse mzip2 forward mzip2 reverse mzip3 forward mzip3 reverse mzip4 forward mzip4 reverse ctgagtccgaatcaggtgcag cccaacaggatatcagactc tgttacaatcaaggtctatgaaggtg caaaggtgacttcaatctgtgg tttgcgagtactcaacaccaa gcatatcttcggcccaca gagttcccacatgagctagga aagaagagagcttgttggatgc catgtcttctggacctgctg ccatggccaagatgaactct cagatggatgcagctacagg ctgctcccaagaagacacct gcgtattcctggctacatgc tgaaggtctccaggtctataaagg cagctactgcagaagattgagg tccagcagttggggaagat

18 mzip5 forward mzip5 reverse mzip6 forward mzip6 reverse mzip7 forward mzip7 reverse mzip8 forward mzip8 reverse mzip9 forward mzip9 reverse mzip10 forward mzip10 reverse mzip11 forward mzip11 reverse mzip12 forward mzip12 reverse mzip13 forward mzip13 reverse mzip14 forward mzip14 reverse mznt1 forward mznt1 reverse mznt2 forward mznt2 reverse mznt3 forward mznt3 reverse mznt4 forward mznt4 reverse mznt5 forward mznt5 reverse mznt6 forward mznt6 reverse mznt7 forward mznt7 reverse aggacctagtgagcaatcagagg ttctccaagatcccttttgttcc aagtgagaagaaggcagaaatcc ggagaagatgtaacagagcatcg aacatagccatgggacttctagg attctactgggatgaggaacagc ctaacggacacatccacttcga cccttcagacaggtacatgagctt cgtggcaataatgctacacaa catgcatcaggaaggaaacc cgaatgtttaagcactacaagca aagctttcttccaatagtggattc aaaagacggcatctgctacc tggatcccgattccaatg tggacacaaggagactgcaa ttcccccagctgtgagtaac cagcttccttgtgagcaaaaa acctcatgggggatctcat gtcagtggccattctctgtg cattgagcaggatgacgaag aacaccagcaattccaacg tccactgggtcatcacttctc gatcaaaggggacaccatgt gagggccaaccccattat tgcacacctggctattgact gggaatagagccgggatg taggtggatacatggcaaatagc agttcatatggatggttctctgc gcctgtcaagttctacttctgagac tctcggtatgatattaatccctcaa ttagaagtcctggctgtatttgc gaatagaaagcatcgtgaacagg cgctttctcttatgggtatgttaga tctctcgactccttctgagaaaata

19 mznt8 forward mznt8 reverse mznt10 forward mznt10 reverse ms18 forward ms18 reverse tgattctctctgttcatgttgcta gggcttgagcaattcctgt tctgaagcactcaatatcagagg agaatatgatagccgtgatgacc cttccacaggaggcctacac tggtgttgagtactcgcaaaat