Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Size: px
Start display at page:

Download "Supplemental Data Supplementary Figure Legends and Scheme Figure S1."

Transcription

1 Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells, (A) observed under confocal microscopy, (B) and counted. C-F, effect of UTK1 on EGF-induced lamellipodia formation. TT cells were pretreated with the indicated concentrations of UTK1 for 15 min and stimulated with EGF. After 10 min (C and D) or 12 h (E and F), the cells were observed under confocal microscopy (C and E), and counted (D and F). Data represent means SD (n = 6). G, inhibitory activity of UTK1 on EGF-induced cell migration, monitored using a chemotaxis chamber. Data represent means SD (n = 5). Arrows, lamellipodia. Scale bar, 10!m. For F, statistical analyses were performed with a two-tailed Student s t-test; *, P = ; **, P = 4.7 x Throughout, the data was representative of at least three independent studies. For B, D and F, more than 300 cells were analyzed per experiment. Figure S2. UTK1 inhibits the second EGF-induced wave of Rac1 activation in TT cells. A, time-course analysis of Rac1 activation following EGF stimulation. TT cells were stimulated with EGF for the indicated periods, then the cells were examined for active Rac1 by pull-down assay. B and C, effect of UTK1 on EGF-induced Rac1 activation. TT cells were pretreated with UTK1 for 12 h (B) or 15 min (C), and stimulated with EGF. Following 10 min (B) or 9 h (C) of incubation, the cells were examined for active Rac1 by pull-down assay. Throughout, the data was representative of at least three independent studies. Figure S3. B-UTK1ox binds to the C-terminal region of !. A, schematic illustration of wild type and mutants of GST ! for in vitro B-UTK1 pull-down assay. B, in vitro B-UTK1 pull-down assay. Purified GST ! proteins (GST only, C50, "C200, "C100, or WT) were incubated with B-UTK1ox and avidin beads. The precipitated proteins were subjected to western blotting using anti-gst antibody. Throughout, the data was representative of at least three independent studies. Figure S4. Knockdown of both Tiam1 and #Pix does not affect the first EGF-induced wave of Rac1 activation. A, control, Tiam1, or #Pix sirna-transfected A431 cells were stimulated with EGF for 2 min. Then, the cells were examined for active Rac1 by pull-down assay. B, control, Tiam1, or

2 #Pix sirna-transfected A431 cells were stimulated with EGF for 5 min. Then, the cells with lamellipodia were counted. Data represent means SD (n = 6). Throughout, the data was representative of at least three independent studies. For B, more than 300 cells were analyzed per experiment. Figure S ! and Tiam1 are involved in the second EGF-induced wave of Rac1 activation in TT cells. A, TT cells were transfected with control, Tiam1, #Pix, or ! sirna and were cultured for 72 h. Then the cells were subjected to western blotting using the indicated antibodies. B, control, Tiam1, #Pix, or ! sirna-transfected TT cells were incubated in the upper chamber and stimulated with or without EGF for 24 h. Then, the migrated cells were counted. Data represent means SD (n = 5). C, control, Tiam1, #Pix, or ! sirna-transfected TT cells were stimulated with EGF for 9 h. Then, the cells were examined for active Rac1 by pull-down assay. For B, statistical analyses were performed with a two-tailed Student s t-test; *, P = 4.1 x 10-7 ; **, P = 4.3 x Throughout, the data was representative of at least three independent studies. Figure S6. Time-course analysis of Tiam1 expression in EGF-treated A431 cells. A431 cells were treated with EGF for the indicated periods. The cells were lysed and subjected to western blotting using the indicated antibodies. The data was representative of at least three independent studies. Figure S7. NSC23766 inhibits the second EGF-induced wave of Rac1 activation but not the first wave. A431 cells were pretreated with NSC23766 for 12 h (A) and 15 min (B) and stimulated with EGF. Following 2 min (A) or 12 h (B) of incubation, the cells were examined for active Rac1 by pull-down assay. C, Effect of NSC23766 on EGF-induced cell migration in A431 cells, monitored using a chemotaxis chamber. Data represent means SD (n = 5). Throughout, the data was representative of at least three independent studies. Figure S8. Effect of UTK1 on expression levels and intracellular localization of Tiam1 protein. A, A431 cells were pretreated with UTK1 for 15 min and stimulated with EGF. Following 12 h of incubation, the cells were lysed and subjected to western blotting using the indicated antibodies. B, A431 cells were co-transfected with Tiam1-6 x myc and FLAG !. The cells were stimulated with EGF for 12 h in the absence or presence of 3!M UTK1. Then the cells were fixed and immunostained, and observed under confocal microscopy. Scale bar, 10!m. Throughout, the data was representative of at least three independent studies.

3 Figure S9. Asef and Vav2 do not interact with !. Lysates of A431 cells stimulated with EGF for 2 min or 12 h were incubated with GST or GST !. The binding proteins of GST or GST ! precipitated with Glutathione Sepharose 4B were subjected to western blotting using the indicated antibodies. The data was representative of at least three independent studies. Scheme 1. Preparation of biotinylated compounds of UTK1 Biotinylated UTK1s (B-UTK1ph (3) and B-UTK1ox (6)) were synthesized as shown in Scheme 1. UTK1 (1), prepared according to our procedure 1, was directly converted to B-UTK1ph (3) by treatment with 2. B-UTK1ox (6) was synthesized via 5 by oxmation, reduction of the azide and coupling with 2.

4 A Fig. S1 0 h 10 min 90 min 6 h 10 h 12 h 14 h 16 h B 100 Lamellipodia formation (%) Time (h)

5 Fig. S1 (continued) C Lamellipodia formation at 10 min UTK !M EGF D 80 Lamellipodia formation (%) UTK1 (!M) EGF 1 ng/ml

6 Fig. S1 (continued) E Lamellipodia formation at 12 h UTK !M EGF F 30 * * * Lamellipodia formation (%) UTK1 (!M) EGF 1 ng/ml

7 Fig. S1 (continued) G 80 Cells / field UTK1 (!M) EGF 1 ng/ml

8 Fig. S2 A EGF 1 ng/ml B 1st wave of Rac1 activation (at 10 min) in TT cells UTK !M EGF 1 ng/ml Rac1-GTP Rac1 C 2nd wave of Rac1 activation (at 9 h) in TT cells UTK !M EGF 1 ng/ml Rac1-GTP Rac1

9 Fig. S3 A WT GST binding to UTK1 245 a.a. o!c100 GST x!c200 GST x C50 GST o GST GST x B GST C50!C200!C100 WT Pull-down: B-UTK1ox anti-gst Input anti-gst

10 Fig. S4 A 1st wave of Rac1 activation (at 2 min) Control Tiam1 "Pix sirna EGF 30 ng/ml Rac1-GTP Rac1 B 1st wave of lamellipodia formation (at 5 min) None EGF 30 ng/ml 100 Lamellipodia formation (%) Control Tiam1!Pix sirna

11 Fig. S5 A Control Tiam1 "Pix # sirna Tiam1 "Pix # "-actin B Cell migration None EGF 1 ng/ml * * * 80 Cells / field 40 0 Control Tiam1!Pix " sirna

12 Fig. S5 (continued) C 2nd wave of Rac1 activation (at 9 h) in TT cells Control Tiam1 "Pix sirna EGF 1 ng/ml Rac1-GTP Rac1 Control # sirna EGF 1 ng/ml Rac1-GTP Rac1

13 Fig. S6 EGF 30 ng/ml min Tiam1 "-actin

14 Fig. S7 A NSC !M EGF 30 ng/ml (2 min) Rac1-GTP Rac1 B NSC !M EGF 30 ng/ml (12 h) Rac1-GTP Rac1 C 120 cells / field NSC23766 (!M) EGF 30 ng/ml

15 Fig. S8 A UTK !M EGF 30 ng/ml Tiam1 "-actin

16 Fig. S8 (continued) B EGF EGF + UTK1 Merge F-actin FLAG # Tiam1-6 x myc

17 Fig. S9 EGF stimulation 2 min lysate Input GST GST # EGF stimulation 12 h lysate Input GST GST # Pull-down Asef Vav2

18 Scheme 1 cis UTK1 (1) C + N N N S N N K 2 C 3, DMF rt, 2 d., 19% cis C 5 N 5 N B-UTK1ph (3) S N N UTK1 (1) + N 3 N 2 4 (ref.2 MS 4A, DCM rt,.n., 47% cis N 5 N 3 PMe 3, TF/ 2 = 10:1, rt, 1 h cis then 2,DMF rt,.n., 58% B-UTK1ox (6) N N 5 N 5 N S N N

19 Supplementary Methods Materials EGF was purchased from Sigma (St. Louis, M). NSC23766 was purchased from Calbiochem (San Diego, CA). Mouse monoclonal anti-rac1 (clone 23A8) and mouse monoclonal anti-kinesin (clone 2) antibodies were purchased from Millipore (Bedford, MA). Mouse monoclonal anti-gst (B-14), rabbit polyclonal anti ! (C-16), rabbit polyclonal anti $ (C-17), rabbit polyclonal anti-tiam1 (C-16), and mouse monoclonal anti-myc (9E10) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse monoclonal anti-#-actin (AC-74), and mouse monoclonal anti-flag (M2) antibodies were purchased from Sigma. Mouse monoclonal anti % antibody was purchased from BD Transduction Laboratories (San Diego, CA). Rabbit polyclonal anti-flag (used for immunostaining) and rabbit polyclonal anti-#pix antibodies were purchased from Cell Signaling Technology (Beverly, MA). orseradish peroxidase-conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies were purchased from GE ealthcare (Little Chalfont, UK). Cell culture uman epidermal carcinoma A431 cells and A431 cells stably expressing FLAG ! (A431/FLAG ! cells) were maintained in DMEM (Nissui, Tokyo, Japan) supplemented with 5% calf serum (CS). uman esophageal carcinoma TT cells were maintained in RPMI1640 (Nissui) supplemented with 5% fetal bovine serum (FBS). Prior to stimulation with EGF, A431 cells and A431/FLAG ! cells were serum-starved by incubation in DMEM supplemented with 0.2% CS, and TT cells were serum-starved by incubation in RPMI1640 supplemented with 1% FBS for 15 min, respectively. Chemotaxis chamber assay using TT cells TT cells suspended in RPMI supplemented with 1% FBS were incubated in the upper chamber; the lower chamber contained RPMI supplemented with 1% FBS in the presence or absence of EGF (1 ng/ml). Drugs were added to both chambers. Following 24 h incubation, the filter was fixed with Me and stained with hematoxylin. The cells attached to the lower side of the filter were counted. Establishment of A431 cells stably expressing FLAG ! A431 cells were transfected with pcdna3/flag ! using Metafectene Pro (Biontex). Transfected cells were selected by 400!g/mL G418. Stable expression of FLAG ! was verified by western blotting.

20 Western blotting Cells were lysed with IP buffer containing 1% NP-40 and 0.1% SDS. Proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore) by electroblotting. After the membranes had been incubated with primary and secondary antibodies, the immune complexes were detected with an Immobilon Western kit (Millipore), and the luminescence was detected with a LAS-1000 mini (Fujifilm, Tokyo, Japan). Co-transfection and immunostaining A431 cells were transiently co-transfected with 0.5!g of pcdna3/flag ! and 0.5!g of pcs2+mt/tiam1 using Neon transfection system (Invitrogen). The cells were stimulated with EGF for 12 h in the absence or presence of UTK1 (3!M). Then the cells were fixed, permeabilized, and incubated in blocking buffer (1% bovine serum albumin in PBS) for 30 min. The cells were incubated with anti-flag antibody (1:200, Cell Signaling) and anti-myc antibody (1:500, Santa Cruz) in blocking buffer at 4 C for overnight. After rinsing three times with TBS-Tween (20 mm Tris-Cl (p 7.6), 137 mm NaCl, and 0.1% Tween 20) and once with blocking buffer, the cells were incubated with anti-rabbit-alexa 488 (1:1000, Molecular Probes) and anti-mouse-alexa 647 (1:1000, Molecular Probes) at room temperature for 1 h followed by staining with Texas Red phalloidin. Fluorescence images were obtained using a confocal laser scanning microscope system FV1000. RNA interference sirna for control ( ), ! (SS111443), Tiam1 (SS110756), and #Pix (SS113109) were purchased from Invitrogen. A431 and TT cells were transfected with sirna using iperfect (QIAGEN, ilden, Germany) according to the manufacturer s instructions. Characterization of UTK1, B-UTK1ph, and B-UTK1ox Spectral data of UTK1 (1 in Scheme 1): 1 NMR (300 Mz CDCl 3 )! (ppm) (9, m), 0.85 (1.5, d, J = 3.0 z), 0.88 (1.5, d, J = 3.0 z), 0.89 (3, s), 0.95 (3, s), 0.96 (3, s), 1.92 (1, m), 2.09 (2, m), 2.49 (3, s), 2.79 (0.5, dd, J = 7.5 z, 15.0 z), 2.80 (0.5, dd, J = 7.5 z, 15.0 z), 3.10 (1, dd, J = 1.8 z, 15.0 z), 4.41 (1, d, J = 7.5 z), 4.90 (1, s), 5.04 (1, s), 6.31 (1, s), 9.21 (1, br), (1, s), (1, s). 13 C NMR (125 Mz, CDCl 3 )! (ppm) 17.89, 19.02, 19.14, 21.80, 21.95, 24.53, 28.31, 28.49, 28.84, 28.98, 29.27, 30.87, 30.99, 31.11, 34.71, 34.76, 34.95, 34.99, 36.51, 36.68, 50.17, 50.23, 77.11, 77.15, , , , , , ,

21 151.94, , , IR (KBr) & = (br), 2923, 2866, 1624, 1484, 1447, 1385, 1368, 1276, 1249, 1197 cm -1. ESI-RMS m/z calcd for C Na 4 [M+Na] , found : m.p ºC. Purity of UTK1 measured with PLC was 97.7% Spectral data of B-UTK1ph (3 in Scheme 1): 1 NMR (300 Mz, CDCl 3 : MeD = 10 : 1) : ' (ppm) = 0.86 (3, d, J = 6.0 z), 0.89 (3, s), 0.96 (3, s), (29, m), 1.94 (1, m), (6, m), 2.45 (3, s), 2.74 (1, m), (2, m), (6, m), (2, m), 4.50 (1, m), 4.88 (1, s), 5.01 (1, s), 5.24 (1, br), 5.51 (1, br), (2, br), 6.29 (1, br), 6.34 (1, s), (1, s), (1, s). ESI-RMS m/z calcd for C N 4 Na 8 S [M+Na] , found Spectral data of B-UTK1ox (6 in Scheme 1): 1 NMR (300 Mz, CDCl 3 : MeD = 10 : 1) : ' (ppm) = 0.81 (3, d, J = 7.2 z), 0.83 (3, s), 0.89 (3, s), (32, m), (6, m), 2.22 (3, s), 2.64 (1, bd), 2.73 (1, dd, J = 8.4, 12.9 z), 2.84 (1, dd, J = 4.5, 12.9 z), (7, brm), 3.30 (1, m), 4.13 (2, t, J = 6.3 z), (2, m), 4.42 (1, dd, J = 4.5 z, 8.4 z), 4.80 (1, s), 5.02 (1, s), 6.25 (1, s), (2, br), 8.36 (1, s). ESI-RMS m/z calcd for C N 6 Na 8 S [M+Na] , found Supplementary References 1. Sawada, M., Kubo, S., Matsumura, K., Takemoto, Y., Kobayashi,., Tashiro, E., Kitahara, T., Watanabe,., and Imoto, M. (2011) Bioorg. Med. Chem. Lett. 21, Ki, S. W., Ishigami, K., Kitahara, T., Kasahara, K., Yoshida, M., and orinouchi, S. (2000) J. Biol. Chem. 275,

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Supplementary Figures and Legends

Supplementary Figures and Legends Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Amersham * ECL * Gel horizontal electrophoresis system

Amersham * ECL * Gel horizontal electrophoresis system GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

Ras activation kit. Catalog Number: ADI-EKS-460. Table of Contents

Ras activation kit. Catalog Number: ADI-EKS-460. Table of Contents Ras activation kit Catalog Number: ADI-EKS-460 Table of Contents Assay Design Page 1 Scientific Overview 1 Precautions 1 Materials Provided 2 Storage of Materials 2 Materials Required but Not Provided

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System

Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric

More information

Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated

Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario

More information

ab Optiblot Fluorescent Western Blot Kit

ab Optiblot Fluorescent Western Blot Kit ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog. 1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus

More information

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)

KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern

More information

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles

More information

Strep-tag detection in Western blots

Strep-tag detection in Western blots Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Ral Activation Assay Kit

Ral Activation Assay Kit Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

Maximize Your Western Blotting Results. Superior products for every step of the Western workflow

Maximize Your Western Blotting Results. Superior products for every step of the Western workflow Maximize Your Western Blotting Results Superior products for every step of the Western workflow Let Millipore s Western Blotting Expertise Help Keep Your Research On Track. One way to improve the quality

More information

Application Note. Author. Abstract. Biopharmaceuticals. Verified for Agilent 1260 Infinity II LC Bio-inert System. Sonja Schneider

Application Note. Author. Abstract. Biopharmaceuticals. Verified for Agilent 1260 Infinity II LC Bio-inert System. Sonja Schneider Combining small-scale purification and analysis of monoclonal antibodies on one instrument Protein purification with high-volume injection using the Agilent 126 Infinity Bio-inert Quaternary LC System

More information

ab SUMOylation Assay Kit

ab SUMOylation Assay Kit ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon Yun, Alexander D. Radian, Lucia de Almeida, Yon Rojanasakul, and Christian Stehlik

Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon Yun, Alexander D. Radian, Lucia de Almeida, Yon Rojanasakul, and Christian Stehlik 2 Immunity, Volume 36 Supplemental Information An NLRP7-Containing Inflammasome Mediates Recognition of Microbial Lipopeptides in Human Macrophages Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon

More information

Antibody Purification Guide

Antibody Purification Guide Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)

Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and

More information

In-Cell Western Kits I and II

In-Cell Western Kits I and II Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

More information

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra

Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra GE Healthcare Instructions 28-9670-57 AA Mag Sepharose Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra Protein A Mag Sepharose Xtra and Protein G Mag Sepharose Xtra are available in the following

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

Article. The Folliculin Tumor Suppressor Is a GAP. for the RagC/D GTPases That Signal. Amino Acid Levels to mtorc1

Article. The Folliculin Tumor Suppressor Is a GAP. for the RagC/D GTPases That Signal. Amino Acid Levels to mtorc1 Molecular Cell, Volume 52 Supplemental Information Article The Folliculin Tumor Suppressor Is a GAP for the RagC/D GTPases That Signal Amino Acid Levels to mtorc1 Zhi-Yang Tsun, Liron Bar-Peled, Lynne

More information

western blotting tech

western blotting tech western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

Mouse TNF alpha ELISA Kit

Mouse TNF alpha ELISA Kit Mouse TNF alpha ELISA Kit Catalog No. GWB-ZZD049 Size 96 wells/kit Sandwich ELISA kit for quantitative detection of mouse TNF alpha in cell culture supernates, serum and plasma(heparin, EDTA). Typical

More information

LAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7

LAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells

Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,

More information

The Alternatively Spliced e13 Transcript of the Rabbit Calcitonin Receptor Dimerizes with the C1a Isoform and Inhibits Its Surface Expression*

The Alternatively Spliced e13 Transcript of the Rabbit Calcitonin Receptor Dimerizes with the C1a Isoform and Inhibits Its Surface Expression* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 23085 23093, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Alternatively

More information

Store samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles.

Store samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles. Human Retinol Binding Protein 4, RBP4 ELISA Kit Preparation Plate Washing Discard the solution in the plate without touching the side walls. Blot the plate onto paper towels or other absorbent material.

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Western Blotting Detection Reagents

Western Blotting Detection Reagents Electrophoresis Western Blotting Detection Reagents Maximize Western Blot Detection Solutions for Any Blotting Application Choose the Best Approach for Your Needs When it comes to western blot detection,

More information

ab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)

ab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) ab183287 TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) Instructions for Use For the detection of Rabbit and Mouse Primary antibodies on Human tissue or cell samples. This product is

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information