Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
|
|
- Jocelin Mason
- 6 years ago
- Views:
Transcription
1 Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells, (A) observed under confocal microscopy, (B) and counted. C-F, effect of UTK1 on EGF-induced lamellipodia formation. TT cells were pretreated with the indicated concentrations of UTK1 for 15 min and stimulated with EGF. After 10 min (C and D) or 12 h (E and F), the cells were observed under confocal microscopy (C and E), and counted (D and F). Data represent means SD (n = 6). G, inhibitory activity of UTK1 on EGF-induced cell migration, monitored using a chemotaxis chamber. Data represent means SD (n = 5). Arrows, lamellipodia. Scale bar, 10!m. For F, statistical analyses were performed with a two-tailed Student s t-test; *, P = ; **, P = 4.7 x Throughout, the data was representative of at least three independent studies. For B, D and F, more than 300 cells were analyzed per experiment. Figure S2. UTK1 inhibits the second EGF-induced wave of Rac1 activation in TT cells. A, time-course analysis of Rac1 activation following EGF stimulation. TT cells were stimulated with EGF for the indicated periods, then the cells were examined for active Rac1 by pull-down assay. B and C, effect of UTK1 on EGF-induced Rac1 activation. TT cells were pretreated with UTK1 for 12 h (B) or 15 min (C), and stimulated with EGF. Following 10 min (B) or 9 h (C) of incubation, the cells were examined for active Rac1 by pull-down assay. Throughout, the data was representative of at least three independent studies. Figure S3. B-UTK1ox binds to the C-terminal region of !. A, schematic illustration of wild type and mutants of GST ! for in vitro B-UTK1 pull-down assay. B, in vitro B-UTK1 pull-down assay. Purified GST ! proteins (GST only, C50, "C200, "C100, or WT) were incubated with B-UTK1ox and avidin beads. The precipitated proteins were subjected to western blotting using anti-gst antibody. Throughout, the data was representative of at least three independent studies. Figure S4. Knockdown of both Tiam1 and #Pix does not affect the first EGF-induced wave of Rac1 activation. A, control, Tiam1, or #Pix sirna-transfected A431 cells were stimulated with EGF for 2 min. Then, the cells were examined for active Rac1 by pull-down assay. B, control, Tiam1, or
2 #Pix sirna-transfected A431 cells were stimulated with EGF for 5 min. Then, the cells with lamellipodia were counted. Data represent means SD (n = 6). Throughout, the data was representative of at least three independent studies. For B, more than 300 cells were analyzed per experiment. Figure S ! and Tiam1 are involved in the second EGF-induced wave of Rac1 activation in TT cells. A, TT cells were transfected with control, Tiam1, #Pix, or ! sirna and were cultured for 72 h. Then the cells were subjected to western blotting using the indicated antibodies. B, control, Tiam1, #Pix, or ! sirna-transfected TT cells were incubated in the upper chamber and stimulated with or without EGF for 24 h. Then, the migrated cells were counted. Data represent means SD (n = 5). C, control, Tiam1, #Pix, or ! sirna-transfected TT cells were stimulated with EGF for 9 h. Then, the cells were examined for active Rac1 by pull-down assay. For B, statistical analyses were performed with a two-tailed Student s t-test; *, P = 4.1 x 10-7 ; **, P = 4.3 x Throughout, the data was representative of at least three independent studies. Figure S6. Time-course analysis of Tiam1 expression in EGF-treated A431 cells. A431 cells were treated with EGF for the indicated periods. The cells were lysed and subjected to western blotting using the indicated antibodies. The data was representative of at least three independent studies. Figure S7. NSC23766 inhibits the second EGF-induced wave of Rac1 activation but not the first wave. A431 cells were pretreated with NSC23766 for 12 h (A) and 15 min (B) and stimulated with EGF. Following 2 min (A) or 12 h (B) of incubation, the cells were examined for active Rac1 by pull-down assay. C, Effect of NSC23766 on EGF-induced cell migration in A431 cells, monitored using a chemotaxis chamber. Data represent means SD (n = 5). Throughout, the data was representative of at least three independent studies. Figure S8. Effect of UTK1 on expression levels and intracellular localization of Tiam1 protein. A, A431 cells were pretreated with UTK1 for 15 min and stimulated with EGF. Following 12 h of incubation, the cells were lysed and subjected to western blotting using the indicated antibodies. B, A431 cells were co-transfected with Tiam1-6 x myc and FLAG !. The cells were stimulated with EGF for 12 h in the absence or presence of 3!M UTK1. Then the cells were fixed and immunostained, and observed under confocal microscopy. Scale bar, 10!m. Throughout, the data was representative of at least three independent studies.
3 Figure S9. Asef and Vav2 do not interact with !. Lysates of A431 cells stimulated with EGF for 2 min or 12 h were incubated with GST or GST !. The binding proteins of GST or GST ! precipitated with Glutathione Sepharose 4B were subjected to western blotting using the indicated antibodies. The data was representative of at least three independent studies. Scheme 1. Preparation of biotinylated compounds of UTK1 Biotinylated UTK1s (B-UTK1ph (3) and B-UTK1ox (6)) were synthesized as shown in Scheme 1. UTK1 (1), prepared according to our procedure 1, was directly converted to B-UTK1ph (3) by treatment with 2. B-UTK1ox (6) was synthesized via 5 by oxmation, reduction of the azide and coupling with 2.
4 A Fig. S1 0 h 10 min 90 min 6 h 10 h 12 h 14 h 16 h B 100 Lamellipodia formation (%) Time (h)
5 Fig. S1 (continued) C Lamellipodia formation at 10 min UTK !M EGF D 80 Lamellipodia formation (%) UTK1 (!M) EGF 1 ng/ml
6 Fig. S1 (continued) E Lamellipodia formation at 12 h UTK !M EGF F 30 * * * Lamellipodia formation (%) UTK1 (!M) EGF 1 ng/ml
7 Fig. S1 (continued) G 80 Cells / field UTK1 (!M) EGF 1 ng/ml
8 Fig. S2 A EGF 1 ng/ml B 1st wave of Rac1 activation (at 10 min) in TT cells UTK !M EGF 1 ng/ml Rac1-GTP Rac1 C 2nd wave of Rac1 activation (at 9 h) in TT cells UTK !M EGF 1 ng/ml Rac1-GTP Rac1
9 Fig. S3 A WT GST binding to UTK1 245 a.a. o!c100 GST x!c200 GST x C50 GST o GST GST x B GST C50!C200!C100 WT Pull-down: B-UTK1ox anti-gst Input anti-gst
10 Fig. S4 A 1st wave of Rac1 activation (at 2 min) Control Tiam1 "Pix sirna EGF 30 ng/ml Rac1-GTP Rac1 B 1st wave of lamellipodia formation (at 5 min) None EGF 30 ng/ml 100 Lamellipodia formation (%) Control Tiam1!Pix sirna
11 Fig. S5 A Control Tiam1 "Pix # sirna Tiam1 "Pix # "-actin B Cell migration None EGF 1 ng/ml * * * 80 Cells / field 40 0 Control Tiam1!Pix " sirna
12 Fig. S5 (continued) C 2nd wave of Rac1 activation (at 9 h) in TT cells Control Tiam1 "Pix sirna EGF 1 ng/ml Rac1-GTP Rac1 Control # sirna EGF 1 ng/ml Rac1-GTP Rac1
13 Fig. S6 EGF 30 ng/ml min Tiam1 "-actin
14 Fig. S7 A NSC !M EGF 30 ng/ml (2 min) Rac1-GTP Rac1 B NSC !M EGF 30 ng/ml (12 h) Rac1-GTP Rac1 C 120 cells / field NSC23766 (!M) EGF 30 ng/ml
15 Fig. S8 A UTK !M EGF 30 ng/ml Tiam1 "-actin
16 Fig. S8 (continued) B EGF EGF + UTK1 Merge F-actin FLAG # Tiam1-6 x myc
17 Fig. S9 EGF stimulation 2 min lysate Input GST GST # EGF stimulation 12 h lysate Input GST GST # Pull-down Asef Vav2
18 Scheme 1 cis UTK1 (1) C + N N N S N N K 2 C 3, DMF rt, 2 d., 19% cis C 5 N 5 N B-UTK1ph (3) S N N UTK1 (1) + N 3 N 2 4 (ref.2 MS 4A, DCM rt,.n., 47% cis N 5 N 3 PMe 3, TF/ 2 = 10:1, rt, 1 h cis then 2,DMF rt,.n., 58% B-UTK1ox (6) N N 5 N 5 N S N N
19 Supplementary Methods Materials EGF was purchased from Sigma (St. Louis, M). NSC23766 was purchased from Calbiochem (San Diego, CA). Mouse monoclonal anti-rac1 (clone 23A8) and mouse monoclonal anti-kinesin (clone 2) antibodies were purchased from Millipore (Bedford, MA). Mouse monoclonal anti-gst (B-14), rabbit polyclonal anti ! (C-16), rabbit polyclonal anti $ (C-17), rabbit polyclonal anti-tiam1 (C-16), and mouse monoclonal anti-myc (9E10) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse monoclonal anti-#-actin (AC-74), and mouse monoclonal anti-flag (M2) antibodies were purchased from Sigma. Mouse monoclonal anti % antibody was purchased from BD Transduction Laboratories (San Diego, CA). Rabbit polyclonal anti-flag (used for immunostaining) and rabbit polyclonal anti-#pix antibodies were purchased from Cell Signaling Technology (Beverly, MA). orseradish peroxidase-conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies were purchased from GE ealthcare (Little Chalfont, UK). Cell culture uman epidermal carcinoma A431 cells and A431 cells stably expressing FLAG ! (A431/FLAG ! cells) were maintained in DMEM (Nissui, Tokyo, Japan) supplemented with 5% calf serum (CS). uman esophageal carcinoma TT cells were maintained in RPMI1640 (Nissui) supplemented with 5% fetal bovine serum (FBS). Prior to stimulation with EGF, A431 cells and A431/FLAG ! cells were serum-starved by incubation in DMEM supplemented with 0.2% CS, and TT cells were serum-starved by incubation in RPMI1640 supplemented with 1% FBS for 15 min, respectively. Chemotaxis chamber assay using TT cells TT cells suspended in RPMI supplemented with 1% FBS were incubated in the upper chamber; the lower chamber contained RPMI supplemented with 1% FBS in the presence or absence of EGF (1 ng/ml). Drugs were added to both chambers. Following 24 h incubation, the filter was fixed with Me and stained with hematoxylin. The cells attached to the lower side of the filter were counted. Establishment of A431 cells stably expressing FLAG ! A431 cells were transfected with pcdna3/flag ! using Metafectene Pro (Biontex). Transfected cells were selected by 400!g/mL G418. Stable expression of FLAG ! was verified by western blotting.
20 Western blotting Cells were lysed with IP buffer containing 1% NP-40 and 0.1% SDS. Proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore) by electroblotting. After the membranes had been incubated with primary and secondary antibodies, the immune complexes were detected with an Immobilon Western kit (Millipore), and the luminescence was detected with a LAS-1000 mini (Fujifilm, Tokyo, Japan). Co-transfection and immunostaining A431 cells were transiently co-transfected with 0.5!g of pcdna3/flag ! and 0.5!g of pcs2+mt/tiam1 using Neon transfection system (Invitrogen). The cells were stimulated with EGF for 12 h in the absence or presence of UTK1 (3!M). Then the cells were fixed, permeabilized, and incubated in blocking buffer (1% bovine serum albumin in PBS) for 30 min. The cells were incubated with anti-flag antibody (1:200, Cell Signaling) and anti-myc antibody (1:500, Santa Cruz) in blocking buffer at 4 C for overnight. After rinsing three times with TBS-Tween (20 mm Tris-Cl (p 7.6), 137 mm NaCl, and 0.1% Tween 20) and once with blocking buffer, the cells were incubated with anti-rabbit-alexa 488 (1:1000, Molecular Probes) and anti-mouse-alexa 647 (1:1000, Molecular Probes) at room temperature for 1 h followed by staining with Texas Red phalloidin. Fluorescence images were obtained using a confocal laser scanning microscope system FV1000. RNA interference sirna for control ( ), ! (SS111443), Tiam1 (SS110756), and #Pix (SS113109) were purchased from Invitrogen. A431 and TT cells were transfected with sirna using iperfect (QIAGEN, ilden, Germany) according to the manufacturer s instructions. Characterization of UTK1, B-UTK1ph, and B-UTK1ox Spectral data of UTK1 (1 in Scheme 1): 1 NMR (300 Mz CDCl 3 )! (ppm) (9, m), 0.85 (1.5, d, J = 3.0 z), 0.88 (1.5, d, J = 3.0 z), 0.89 (3, s), 0.95 (3, s), 0.96 (3, s), 1.92 (1, m), 2.09 (2, m), 2.49 (3, s), 2.79 (0.5, dd, J = 7.5 z, 15.0 z), 2.80 (0.5, dd, J = 7.5 z, 15.0 z), 3.10 (1, dd, J = 1.8 z, 15.0 z), 4.41 (1, d, J = 7.5 z), 4.90 (1, s), 5.04 (1, s), 6.31 (1, s), 9.21 (1, br), (1, s), (1, s). 13 C NMR (125 Mz, CDCl 3 )! (ppm) 17.89, 19.02, 19.14, 21.80, 21.95, 24.53, 28.31, 28.49, 28.84, 28.98, 29.27, 30.87, 30.99, 31.11, 34.71, 34.76, 34.95, 34.99, 36.51, 36.68, 50.17, 50.23, 77.11, 77.15, , , , , , ,
21 151.94, , , IR (KBr) & = (br), 2923, 2866, 1624, 1484, 1447, 1385, 1368, 1276, 1249, 1197 cm -1. ESI-RMS m/z calcd for C Na 4 [M+Na] , found : m.p ºC. Purity of UTK1 measured with PLC was 97.7% Spectral data of B-UTK1ph (3 in Scheme 1): 1 NMR (300 Mz, CDCl 3 : MeD = 10 : 1) : ' (ppm) = 0.86 (3, d, J = 6.0 z), 0.89 (3, s), 0.96 (3, s), (29, m), 1.94 (1, m), (6, m), 2.45 (3, s), 2.74 (1, m), (2, m), (6, m), (2, m), 4.50 (1, m), 4.88 (1, s), 5.01 (1, s), 5.24 (1, br), 5.51 (1, br), (2, br), 6.29 (1, br), 6.34 (1, s), (1, s), (1, s). ESI-RMS m/z calcd for C N 4 Na 8 S [M+Na] , found Spectral data of B-UTK1ox (6 in Scheme 1): 1 NMR (300 Mz, CDCl 3 : MeD = 10 : 1) : ' (ppm) = 0.81 (3, d, J = 7.2 z), 0.83 (3, s), 0.89 (3, s), (32, m), (6, m), 2.22 (3, s), 2.64 (1, bd), 2.73 (1, dd, J = 8.4, 12.9 z), 2.84 (1, dd, J = 4.5, 12.9 z), (7, brm), 3.30 (1, m), 4.13 (2, t, J = 6.3 z), (2, m), 4.42 (1, dd, J = 4.5 z, 8.4 z), 4.80 (1, s), 5.02 (1, s), 6.25 (1, s), (2, br), 8.36 (1, s). ESI-RMS m/z calcd for C N 6 Na 8 S [M+Na] , found Supplementary References 1. Sawada, M., Kubo, S., Matsumura, K., Takemoto, Y., Kobayashi,., Tashiro, E., Kitahara, T., Watanabe,., and Imoto, M. (2011) Bioorg. Med. Chem. Lett. 21, Ki, S. W., Ishigami, K., Kitahara, T., Kasahara, K., Yoshida, M., and orinouchi, S. (2000) J. Biol. Chem. 275,
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationCulture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).
Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationby Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationRho activation kit. Catalog Number: ADI-EKS-465. Table of Contents
Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationIdentification of Microprotein-Protein Interactions via APEX Tagging
Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupplementary Figures and Legends
Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationAmersham * ECL * Gel horizontal electrophoresis system
GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationProtein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra
GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationRas activation kit. Catalog Number: ADI-EKS-460. Table of Contents
Ras activation kit Catalog Number: ADI-EKS-460 Table of Contents Assay Design Page 1 Scientific Overview 1 Precautions 1 Materials Provided 2 Storage of Materials 2 Materials Required but Not Provided
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationExperimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System
Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric
More informationManuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
More informationab Optiblot Fluorescent Western Blot Kit
ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic
More informationIMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
More informationSpecies predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
More informationKPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)
KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationSUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit
SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationRal Activation Assay Kit
Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationSupplementary File 3: DNA and RNA isolation
Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G
More informationMaximize Your Western Blotting Results. Superior products for every step of the Western workflow
Maximize Your Western Blotting Results Superior products for every step of the Western workflow Let Millipore s Western Blotting Expertise Help Keep Your Research On Track. One way to improve the quality
More informationApplication Note. Author. Abstract. Biopharmaceuticals. Verified for Agilent 1260 Infinity II LC Bio-inert System. Sonja Schneider
Combining small-scale purification and analysis of monoclonal antibodies on one instrument Protein purification with high-volume injection using the Agilent 126 Infinity Bio-inert Quaternary LC System
More informationab SUMOylation Assay Kit
ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationSonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon Yun, Alexander D. Radian, Lucia de Almeida, Yon Rojanasakul, and Christian Stehlik
2 Immunity, Volume 36 Supplemental Information An NLRP7-Containing Inflammasome Mediates Recognition of Microbial Lipopeptides in Human Macrophages Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon
More informationAntibody Purification Guide
Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationCombined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)
Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationProtein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra
GE Healthcare Instructions 28-9670-57 AA Mag Sepharose Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra Protein A Mag Sepharose Xtra and Protein G Mag Sepharose Xtra are available in the following
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationFor identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
More informationArticle. The Folliculin Tumor Suppressor Is a GAP. for the RagC/D GTPases That Signal. Amino Acid Levels to mtorc1
Molecular Cell, Volume 52 Supplemental Information Article The Folliculin Tumor Suppressor Is a GAP for the RagC/D GTPases That Signal Amino Acid Levels to mtorc1 Zhi-Yang Tsun, Liron Bar-Peled, Lynne
More informationwestern blotting tech
western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationMouse TNF alpha ELISA Kit
Mouse TNF alpha ELISA Kit Catalog No. GWB-ZZD049 Size 96 wells/kit Sandwich ELISA kit for quantitative detection of mouse TNF alpha in cell culture supernates, serum and plasma(heparin, EDTA). Typical
More informationLAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7
LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationHuman TGF-beta1 ELISA
K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic
More informationTECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationRegulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells
Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,
More informationThe Alternatively Spliced e13 Transcript of the Rabbit Calcitonin Receptor Dimerizes with the C1a Isoform and Inhibits Its Surface Expression*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 23085 23093, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Alternatively
More informationStore samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles.
Human Retinol Binding Protein 4, RBP4 ELISA Kit Preparation Plate Washing Discard the solution in the plate without touching the side walls. Blot the plate onto paper towels or other absorbent material.
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationOrexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,
Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)
Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming
More informationENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationWestern Blotting Detection Reagents
Electrophoresis Western Blotting Detection Reagents Maximize Western Blot Detection Solutions for Any Blotting Application Choose the Best Approach for Your Needs When it comes to western blot detection,
More informationab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)
ab183287 TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) Instructions for Use For the detection of Rabbit and Mouse Primary antibodies on Human tissue or cell samples. This product is
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More information