NCBI Molecular Biology Resources. Entrez & BLAST. Entrez: Database Integration. Database Searching with Entrez. WWW Access. Using Entrez.
|
|
- Priscilla Casey
- 6 years ago
- Views:
Transcription
1 NCBI Molecular Biology Resources Using Entrez WWW Access Entrez & BLAST March 2007 Phylogeny Entrez: Database Integration Taxonomy PubMed abstracts Genomes Word weight 3-D Structure VAST Neighbors Related Structures Database Searching with Entrez Using limits and field restriction to find human MutL homolog Linking and neighboring with MutL Mapping SNPs onto structure and the genome BLAST Nucleotide sequences Neighbors Related Sequences Hard Link Protein sequences BLAST Neighbors Related Sequences BLink Domains 1
2 Global NCBI (Entrez) Search Global Entrez Search Results Human hereditary nonpolyposis colon cancer Nucleotide Sequences Advanced Search Options Tabs Nucleotide database now three parts EST expressed sequence tags GSS genome survey sequences CoreNucleotide everything else 2
3 More Precise Nucleotides Search Useful Field Restrictions [Title]: Definition line in GenBank / GenPept format shown in Summary format glyceraldehyde 3 phosphate dehydrogenase[title] [Organism]: NCBI s taxonomy. Organizing system for molecular databases mouse[organism]; green plants[organism]; Streptomyces coelicolor[organism] [Properties]: molecule type, location, database source biomol_mrna[properties]; biomol_genomic[properties]; gene_in_mitochondrion[properties]; srcdb pdb[properties] nonpolyposis[all Fields] AND colon cancer[title] AND human[organism] AND biomol_mrna[properties] AND srcdb_refseq[properties] [Filter]: subsets of data, Entrez links all[filter]; nucleotide mapview[filter]; nucleotide omim[filter] Organism Field: NCBI s Taxonomy Useful Properties Field Terms Molecule type biomol_mrna biomol_genomic GenBank division gbdiv_est gbdiv_htg gbdiv_xxx Gene location gene_in_mitochondrion gene_in_chloroplast gene_in_genomic Source Database srcdb_refseq srcdb_pdb srcdb_swiss_prot 3
4 Human MutL RefSeq NM_000249: Links GenBank Records OMIM: Human Disease Genes Literature Links OMIM Conserved Domain 4
5 Protein Link BLAST Link Sequence Links Conserved Domains Finding Homologs and Structures BLink: BLAST Link Redundant GIs BLink: non-redundant relatives top 200 only zebrafish homolog BLAST 5
6 Short Cut: Related Structures E. coli MutL Structure Structure Neighbors Cn3D viewer Pubchem compound 3D Domain Neighbors Conserved Domains MLH1 Domain Structure: CDD MLH1: ATPase Domain ATPase Domain Mismatch Repair Domain 6
7 GeneView: Variations Human MLH1 Mapping Polymorphisms onto Structure ATPase domain Related Structures Mapping Variation Onto Structure Asn Ile Ile Val Conserved Asn 7
8 NM_000249: Genome Links Genome Resources The Map Viewer Map Viewer: Human MLH1 Customizable Genome BLAST EST Hits Transcripts Download data and sequences Models NCBI Assembly Gene Annotations 8
9 Synteny: Mammalian Genomes orthologs Homologene paralogs orthologs Albumin Gene Family Completely Annotated Eukaryotic frog Genomes A chick A mouse A mouse B chick B frog B Homologous UniGene determined for other organisms Protein similarities first Guided A-chain by taxonomic gene tree B-chain gene Includes orthologs and paralogs gene duplication early globin gene Homologene Cluster Rice Homolog 9
10 The Gene Database Gene Centered Information Unifies LocusLink and microbial Genomes 2.4 million records for 3,822 taxa Genes MLH1: One Stop Shopping Human 38,603 Sea Urchin 30,603 Chimpanzee 31,502 Mosquito 13,763 Mouse 60,746 Fruit Fly 21,116 Rat 38,117 C. elegans 20,935 Dog 20,154 Fungi 168,802 Cow 23, 677 Green Plants 76,847 Chicken 18, 469 Archea 74,627 Zebrafish 38, 594 Bacteria 1,361,390 Genes MLH1: One Stop Shopping (cont.) Genes: Display Options and Links 10
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationHot Topics. What s New with BLAST?
Hot Topics What s New with BLAST? Slides based on NCBI talk at American Society of Human Genetics October 2005 Hot Topics Outline I. New BLAST Algorithm: Discontiguous MegaBLAST II. New Databases III.
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationWhat You NEED to Know
What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM
More informationEntrez Gene: gene-centered information at NCBI
D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National
More informationDatabases NCBI - ENTREZ
Databases NCBI - ENTREZ Data & Software Resources BLAST CDD COG GENSAT GenBank Whole Genome Shotgun Sequences Gene Gene Expression Nervous System Atlas (GENSAT) Gene Expression Omnibus (GEO) Profiles
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationA Prac'cal Guide to NCBI BLAST
A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities
More informationThis software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
More informationNCBI Molecular Biology Resources
NCBI Molecular Biology Resources Part 2: Using NCBI BLAST December 2009 Using BLAST Basics of using NCBI BLAST Using the new Interface Improved organism and filter options New Services Primer BLAST Align
More informationAnnotation. (Chapter 8)
Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store
More informationA Field Guide to GenBank and NCBI Molecular Biology Resources
A Field Guide to GenBank and NCBI Molecular Biology Resources slightly modified from Peter Cooper ftp://ftp.ncbi.nih.gov/pub/cooper/fieldguide/ Eric Sayers ftp://ftp.ncbi.nih.gov/pub/sayers/field_guide/u_penn/
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationGuided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationBIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology
More informationBLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationGenome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationChimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R.
Chimp BAC analysis: Adapted by Wilson Leung and Sarah C.R. Elgin from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. Michael R. Brent Prerequisites: BLAST exercise: Detecting and Interpreting Genetic
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationAP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.
New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationDatabases/Resources on the web
Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationIntroduction to Bioinformatics. What are the goals of the course? Who is taking this course? Textbook. Web sites. Literature references
Introduction to Bioinformatics Who is taking this course? People with very diverse backgrounds in biology Some people with backgrounds in computer science and biostatistics Most people (will) have a favorite
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
More informationNCBI Molecular Biology Resources. NCBI Resources
NBI Molecular Biology Resources A Field Guide NBI Resources The NBI Entrez System NBI Sequence Databases Primary data: GenBank Derivative data: RefSeq, Gene Protein Structure and Function Sequence polymorphisms
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationFrom AP investigative Laboratory Manual 1
Comparing DNA Sequences to Understand Evolutionary Relationships. How can bioinformatics be used as a tool to determine evolutionary relationships and to better understand genetic diseases? BACKGROUND
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationA tutorial introduction into the MIPS PlantsDB barley&wheat database instances
transplant 2 nd user training workshop Poznan, Poland, June, 27 th, 2013 A tutorial introduction into the MIPS PlantsDB barley&wheat database instances TUTORIAL ANSWERS Please direct any questions related
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationIdentification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources
Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi
More informationBIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)
BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationInvestigating Inherited Diseases
Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise to inherited diseases.
More informationTraining materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationGenomic and bioinformatics resources
Genomic and bioinformatics resources 徐唯哲 Paul Wei-Che HSU Assistant Research Specialist Bioinformatics Core, Institute of Molecular Biology, Academia Sinica, Taiwan, R.O.C. 1 What Bioinformatics Can Do
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationEvolutionary Genetics. LV Lecture with exercises 6KP. Databases
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Databases HS2018 Bioinformatics - R R Assignment The Minimalistic Approach!2 Bioinformatics - R Possible Exam Questions for R: Q1: The function
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationChapter 2. Genomic Databases and Resources at the National Center for Biotechnology Information. Tatiana Tatusova. Abstract. 1.
Chapter 2 Genomic Databases and Resources at the National Center for Biotechnology Information Tatiana Tatusova Abstract The National Center for Biotechnology Information (NCBI), as a primary public repository
More informationPre-Lab Questions. 1. Use the following data to construct a cladogram of the major plant groups.
Pre-Lab Questions Name: 1. Use the following data to construct a cladogram of the major plant groups. Table 1: Characteristics of Major Plant Groups Organism Vascular Flowers Seeds Tissue Mosses 0 0 0
More informationChapter 5. Structural Genomics
Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationGood Science. Benefit to Society
Good Science Benefit to Society Human genes claimed in granted U.S. patents Jensen and Murray, Science 310:239-240 (14 Oct. 2005) Specifically, this map is based on a BLAST homology search linking nucleotide
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationBME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
More informationThe Human Genome Project
The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationPATHWAY ANALYSIS. Susan LM Coort, PhD Department of Bioinformatics, Maastricht University. PET course: Toxicogenomics
PATHWAY ANALYSIS Susan LM Coort, PhD Department of Bioinformatics, Maastricht University 1 Data analysis overview Microarray scans Slide based on a slide from J. Pennings, RIVM, NL Image analysis Preprocessing
More informationMicroarray Data Analysis in GeneSpring GX 11. Month ##, 200X
Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options
More informationO C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationIdentifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN
More informationCS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
More information(a) (3 points) Which of these plants (use number) show e/e pattern? Which show E/E Pattern and which showed heterozygous e/e pattern?
1. (20 points) What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c) Methods of detection (such as gel electrophoresis,
More informationAaditya Khatri. Abstract
Abstract In this project, Chimp-chunk 2-7 was annotated. Chimp-chunk 2-7 is an 80 kb region on chromosome 5 of the chimpanzee genome. Analysis with the Mapviewer function using the NCBI non-redundant database
More information