The Human Genome Project
|
|
- Philippa Curtis
- 5 years ago
- Views:
Transcription
1 The Human Genome Project
2 The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the HGP will be the ability to better diagnose, treat, and prevent disease. --- Francis Collins, Director of the HGP and the National Human Genome Research Institute (NHGRI)
3 The genome is our Genetic Blueprint Nearly every human cell contains 23 pairs of chromosomes 1-22 and XY or XX XY = Male XX = Female Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)
4 The Genome is Who We Are on the inside! Chromosomes consist of DNA molecular strings of A, C, G, & T base pairs, A-T, C-G Information coded in DNA Genes DNA sequences that encode proteins less than 3% of human genome
5 The Human Genome Project Until the early 1970 s, DNA was the most difficult cellular molecule for biochemists to analyze. DNA is now the easiest molecule to analyze we can now isolate a specific region of the genome, produce a virtually unlimited number of copies of it, and determine its nucleotide sequence overnight. Molecular Biology Of The Cell. Alberts et al
6 The Beginning of the Project Most the first 10 years of the project were spent improving the technology to sequence and analyze DNA. Scientists all around the world worked to make detailed maps of our chromosomes and sequence model organisms, like worm, fruit fly, and mouse.
7 The Human Genome Project At the height of the Human Genome Project, sequencing factories were generating DNA sequences at a rate of 1000 nucleotides per second 24/7. Technical breakthroughs that allowed the Human Genome Project to be completed have had an enormous impact on all of biology.. Molecular Biology Of The Cell. Alberts et al
8 The Challenges were Overwhelming First there was the Assembly The DNA sequence is so long that no technology can read it all at once, so it was broken into pieces. There were millions of clones (small sequence fragments). The assembly process included finding where the pieces overlapped in order to put the draft together. 3,200,000 piece puzzle
9 The Human Genome Project Goals: identify all the approximate 30,000 genes in human DNA, determine the sequences of the 3 billion chemical base pairs that make up human DNA, store this information in databases, improve tools for data analysis, transfer related technologies to the private sector, and address the ethical, legal, and social issues (ELSI) that may arise from the project. Milestones: 1990: Project initiated as joint effort of U.S. Department of Energy and the National Institutes of Health June 2000: Completion of a working draft of the entire human genome (covers >90% of the genome to a depth of 3-4x redundant sequence) February 2001: Analyses of the working draft are published April 2003: HGP sequencing is completed and Project is declared finished two years ahead of schedule U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
10 UCSC put the human genome sequence on the web July 7, 2000 UCSC put the human genome sequence on CD in October 2000, with varying results Cyber geeks Searched for hidden Messages, and GATTACA
11 The Completion of the Human Genome Sequence June 2000 White House announcement that the majority of the human genome (80%) had been sequenced (working draft). Working draft made available on the web July 2000 at genome.ucsc.edu. Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature. Completion of 99.99% of the genome as finished sequence on July 2003.
12 What does the draft human genome sequence tell us? By the Numbers The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G). The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.5 million bases. Smallest is trna gene at 76bp! The total number of genes is estimated at around 30,000--much lower than previous estimates of 80,000 to 140,000. Almost all (99.9%) nucleotide bases are exactly the same in all people. The functions are unknown for over 50% of discovered genes. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
13 What does the draft human genome sequence tell us? How It's Arranged The human genome's gene-dense "urban centers" are predominantly composed of the DNA building blocks G and C. In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T. GC- and AT-rich regions usually can be seen through a microscope as light and dark bands on chromosomes. Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between. Stretches of up to 30,000 C and G bases repeating over and over often occur adjacent to gene-rich areas, forming a barrier between the genes and the "junk DNA." These CpG islands are believed to help regulate gene activity. Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (231). U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
14 The human genome How It's Arranged The human genome's gene-dense "urban centers" are predominantly composed of the DNA building blocks G and C. In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T. GC- and AT-rich regions usually can be seen through a microscope as light and dark bands on chromosomes. Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between. Stretches of up to 30,000 C and G bases repeating over and over often occur adjacent to gene-rich areas, forming a barrier between the genes and the "junk DNA." These CpG islands are believed to help regulate gene activity. Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (231). U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
15 The Wheat from the Chaff What does the draft human genome sequence tell us? Less than 2% of the genome codes for proteins. Repeated sequences that do not code for proteins ("junk DNA") make up at least 50% of the human genome. Repetitive sequences are thought to have no direct functions, but they shed light on chromosome structure and dynamics. Over time, these repeats reshape the genome by rearranging it, creating entirely new genes, and modifying and reshuffling existing genes. The human genome has a much greater portion (50%) of repeat sequences than the mustard weed (11%), the worm (7%), and the fly (3%). U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
16 What does the draft human genome sequence tell us? How the Human Compares with Other Organisms Unlike the human's seemingly random distribution of gene-rich areas, many other organisms' genomes are more uniform, with genes evenly spaced throughout. Humans have on average three times as many kinds of proteins as the fly or worm because of mrna transcript "alternative splicing" and chemical modifications to the proteins. This process can yield different protein products from the same gene. Humans share most of the same protein families with worms, flies, and plants; but the number of gene family members has expanded in humans, especially in proteins involved in development and immunity. Although humans appear to have stopped accumulating repeated DNA over 50 million years ago, there seems to be no such decline in rodents. This may account for some of the fundamental differences between hominids and rodents, although gene estimates are similar in these species. Scientists have proposed many theories to explain evolutionary contrasts between humans and other organisms, including those of life span, litter sizes, inbreeding, and genetic drift. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
17 What does the draft human genome sequence tell us? Variations and Mutations Scientists have identified about 3 million locations where single-base DNA differences (SNPs) occur in humans. This information promises to revolutionize the processes of finding chromosomal locations for disease-associated sequences and tracing human history. The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females. Researchers point to several reasons for the higher mutation rate in the male germline, including the greater number of cell divisions required for sperm formation than for eggs. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
18 What does the draft human genome sequence tell us? Led to the discovery of whole new classes of proteins and genes, while revealing that many proteins have been much more highly conserved in evolution than had been suspected. Provided new tools for determining the functions of proteins and of individual domains within proteins, revealing a host of unexpected relationships between them. Molecular Biology Of The Cell. Alberts et al
19 What does the draft human genome sequence tell us? By making large amounts of protein available, it has yielded an efficient way to mass produce protein hormones and vaccines Dissection of regulatory genes has provided an important tool for unraveling the complex regulatory networks by which eukaryotic gene expression is controlled. Molecular Biology Of The Cell. Alberts et al
20 The Project is not Done Next there is the Annotation: The sequence is like a topographical map, the annotation would include cities, towns, schools, libraries and coffee shops! So, where are the genes? How do genes work? And, how do scientists use this information for scientific understanding and to benefit us?
21 What do genes do anyway? We only have ~19,000 genes, so that means that each gene has to do a lot. Genes make proteins that make up nearly all we are (muscles, hair, eyes). Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease). OR OR Eye Color and Hair Color are determined by genes
22 Of Mice and Men: It s all in the genes Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible? Did you say cheese? Mmm, Cheese! One human gene can make many different proteins while a mouse gene can only make a few!
23 Genes are important By selecting different pieces of a gene, your body can make many kinds of proteins. (This process is called alternative splicing.) If a gene is expressed that means it is turned on and it will make proteins.
24 The UCSC Genome Browser
25 The browser takes you from early maps of the genome...
26 ... to a multi-resolution view...
27 ... at the gene cluster level...
28 ... the single gene level...
29 ... the single exon level...
30 ... and at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag
31 The Continuing Project Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function. Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don t really understand how they work. Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.
CHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationHAS 4320 Pharmaceutical Industry. Dr Burton
HAS 4320 Pharmaceutical Industry Dr Burton prescription drugs represent approximately 10 percent of the total national personal health care spending, since 1995 The main drivers of rising pharmaceutical
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationStudying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationChapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning
Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts
More information2017 Amplyus, all rights reserved
The Human Genome Project What it is: The initiative that sequenced the entire human genome The Human Genome Project (HGP) is widely recognized as a tremendous success of government initiative and international
More informationDNA. Using DNA to solve crimes
DNA Using DNA to solve crimes Physical characteristics are inherited from both parents DNA contains all the inherited information for each person DNA is contained in the nucleus of every cell in your body
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationTransposable Elements. (or, Jumping Genes)
Transposable Elements (or, Jumping Genes) Barbara McClintock (1902-1992) She and Marie Curie are the only sole female recipients of the Nobel Prize. She discovered and described the principles of transposable
More informationComputational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationGenetics. Genetics- is the study of all manifestation of inheritance from the distributions of traits to the molecules of the gene itself
What is Genetics? Genetics Mapping of genes Basis of life Inheritable traits Abnormalities Disease Development DNA RNA Proteins Central dogma - Watson & Crick Genes- segments of DNA that code for proteins
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More informationGenomes: What we know and what we don t know
Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationLECTURE 12: INSIGHTS FROM GENOME SEQUENCING
LECTURE 12: INSIGHTS FROM GENOME SEQUENCING Read Chapter 10 (p366-375) DOE s Genomics and its implications (link at course website) STS (p359), SNP, SSR (integrates the following) Linkage, Physical, Sequence
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationCHAPTER 21 GENOMES AND THEIR EVOLUTION
GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationRoadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome
Introduction to Molecular Biology Lodish et al Ch1-4 http://www.ncbi.nlm.nih.gov/books EECS 458 CWRU Fall 2004 DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Roadmap The Cell Lodish
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationHow does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger.
How does the human genome stack up? Organism Human (Homo sapiens) Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster) Yeast (S. cerevisiae) Bacterium
More informationCOMP 555 Bioalgorithms. Fall Lecture 1: Course Introduction
COMP 555 Bioalgorithms Fall 2014 Jan Prins Lecture 1: Course Introduction Read Chapter 1 and Chapter 3, Secns 3.1-3.7 1 Intended Audience COMP 555: Bioalgorithms Suitable for both undergraduate and graduate
More informationLECTURE 20. Repeated DNA Sequences. Prokaryotes:
LECTURE 20 Repeated DNA Sequences Prokaryotes: 1) Most DNA is in the form of unique sequences. Exceptions are the genes encoding ribosomal RNA (rdna, 10-20 copies) and various recognition sequences (e.g.,
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationResult Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
More informationComplete draft sequence 2001
Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms
More information12/8/09 Comp 590/Comp Fall
12/8/09 Comp 590/Comp 790-90 Fall 2009 1 One of the first, and simplest models of population genealogies was introduced by Wright (1931) and Fisher (1930). Model emphasizes transmission of genes from one
More information12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule
I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,
More informationScience 10 Unit 1 GENETICS
Science 10 Unit 1 GENETICS 1.1 DNA Structure and Function Part I- The Nucleus: Control Centre of the Cell Every cell in your body has a specific JOB- but how do they become specialized? E.g. hair cells
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
More information(Very) Basic Molecular Biology
(Very) Basic Molecular Biology (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix DNA molecule (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationDNA Function. DNA Heredity and Protein Synthesis
DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationLecture 8: Transgenic Model Systems and RNAi
Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationMutations, Genetic Testing and Engineering
Mutations, Genetic Testing and Engineering Objectives Describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study the genomes of organisms (TEKS
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationIl trascrittoma dei mammiferi
29 Novembre 2005 Il trascrittoma dei mammiferi dott. Manuela Gariboldi Gruppo di ricerca IFOM: Genetica molecolare dei tumori (responsabile dott. Paolo Radice) Copyright 2005 IFOM Fondazione Istituto FIRC
More informationMODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
More informationWhich Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<
Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is
More informationDNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE
DNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE Recommended reading: The Double Helix: A Personal Account of the Discovery of the Structure of DNA, by James D.
More informationBIO 4342 Lecture on Repeats
BIO 4342 Lecture on Repeats Jeremy Buhler June 14, 2006 1 How RepeatMasker Works Running RepeatMasker is the most common first step in annotating genomic DNA sequences. What exactly does it do? Given a
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationSolutions will be posted on the web.
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 7 FRIDAY December 3,
More informationName AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationChapter 7: Genetics Lesson 7.1: From DNA to Proteins
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you
More informationChapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationLecture 20: Drosophila melanogaster
Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3
More informationProtein Synthesis and Processing A New Language
Why? Protein Synthesis and Processing A New Language DNA is often referred to as the genetic blueprint. In the same way blueprints produced by an architect contain the instructions for construction of
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationAnnotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationWarm Up #15: Using the white printer paper on the table:
Warm Up #15: Using the white printer paper on the table: 1. Fold it into quarters. 2. Draw out the possible structure of what you think this picture is showing in one of the boxes (Hint: This is a macromolecule).
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationBIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
More informationA) (5 points) As the starting step isolate genomic DNA from
GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB
More informationGenes and human health - the science and ethics
Deoxyribonucleic acid (DNA) - why is it so important? Genes and human health - the science and ethics DNA is essential to all living organisms, from bacteria to man, as it contains a code which specifies
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationA primer on the structure and function of genes
A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationGuided Notes Unit 5: Molecular Genetics
Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationGene Expression. Chapters 11 & 12: Gene Conrtrol and DNA Technology. Cloning. Honors Biology Fig
Chapters & : Conrtrol and Technology Honors Biology 0 Cloning Produced by asexual reproduction and so it is genetically identical to the parent st large cloned mammal: Dolly the sheep Animals that are
More informationFurther Reading - DNA
Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information
More informationChapter 12. DNA Technology. Lectures by Edward J. Zalisko
Chapter 12 DNA Technology PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane B. Reece
More informationChapter 15 THE HUMAN GENOME PROJECT AND GENOMICS
Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially
More informationNucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.
Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
More informationName: Date: Pd: Nucleic acids
Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
More informationChapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationCSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa
CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationHigher Unit 1: DNA and the Genome Topic 1.1 The Structure and Organisation of DNA
Higher Unit : DNA and the Genome Topic. The Structure and Organisation of DNA. Which of the following diagrams shows the correct structure of DNA? 2. A section of double stranded DNA was found to have
More information