Download the Lectin sequence output from
|
|
|
- Gervase Murphy
- 5 years ago
- Views:
Transcription
1 Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from Open these in BioEdit (free software). What is the difference between these outputs? How can you tell which worked and which did not work so well? How can you turn these multiple chromatograms into a single sequence of the Lectin gene in A, C, G and T text format? Use the NIH bioinformatics program web site, Here you can recover sequences for practically any published experiment involving DNA, RNA or protein. You can also search the results of your own experiments against the database of known sequences. Using BLAST : search the completed, assembled Lectin sequence you generated above, using nucleotide-nucleotide (blastn), then translated nucleotide-protein (blastx) searches. What exactly is this gene? Has anyone sequenced it before? Who, when, and when was it published? Does it make a known protein?
2 Does the protein have a known structure? If so, what features does it have? Part II. You are a molecular biologist working for the Centers for Disease Control and Prevention (CDC), a US Govt. body in Atlanta, GA. A cruise ship docks in Miami, FL, and you get an urgent call to attend the patients aboard the ship. About half of the passengers and crew are sick with an unidentified illness, and it is thought that they might have contracted a new virus. The ship is quarantined at the dock, and the passengers are unable to leave. You go to the ship, where sleepless doctors hand you samples from patients. Back in the lab, you convert RNA from the samples to DNA and get the following sequence: TCAACCAAGTCTGCCTCACCTGACATCGTGGGTACAATCAATGCCCTCCTGGCGAGGATCGCGGCTGCCCGTTCCCTGGTACATCGAGCA AAGGAAGAACTTTCCACCAGGCCGAGACCCGTTGTCGTGATGATATCAGGAAAACCAGGAATAGGGAAGACCCACCTTGCCAGAGAGCTG GCTAAGAAGATCGCAACCACCCTTACGGGAGACCAGAGGGTGGGCCTCATCCCACGCAATGGTGTTGACCACTGGGACGCGTACAAGGGA GAGAGGGTCGTCCTTTGGGATGATTACGGTATGAGTAATCCCATGATCCACGATGTCAGGTTGCAGGAGCTTGCTGACACTTGCCCCCTA ACACTAAATTGTGACAGGATTGAGAACAAAGGTAAAGTTTTTGACAGTGATGCTATAATTATCACCACTAACTTGGCCAACCCAGCACCA CTGGTCTATGTCAACTTTGAGGCGTGCTCGAGGCGCAAATGATTTCTTCGTGTACGCCGAAGCCCCTGATGTTGAGAAGGCGAAGCGCGA CTTCCCAGGCCAACCTGATATGTGGAAGAATGCCTTCAGCCCTGACTTCTCTCACATAAAGCTGATGCTGGCCCCGCAGGGTGGCTTTGA CAAGAACGGCAATACCCCACATGGGATGGGTGTCATGAAGACCCTCCCCATCGGTTCTCTCATCGCCCGTGCTTCAGGACTCCTCCATGA AAGGCTGGATGAGTACGAGTTGCAAGGCCCAGCCCTCACAACCTTCAACTTTGACCGAAACAAAGTGCTCGCTTTCAGACAGCTTGCTGC TGAAAACAAGTACGGGTTGATGGATACGATGAGAGTTGGAGGGCAACTCAAGGGCGTCAGAACCATGCCAGAGCTCAAGCAAGCACTCAA GAACATCTCAAAGAGGTGCCAGATAGTGTATGGTGGCAGCACCTACACACTTGAATCTGATGGCAAGGGTAGTGTGAGGGTTGACT 1. Searching DNA and Protein databases: Use the NIH bioinformatics program web site, Here you can recover sequences for practically any published experiment involving DNA, RNA or protein. You can also search the results of your own experiments against the database of known sequences. Using BLAST ( search the sequence above, using nucleotide-nucleotide (blastn) search. A. What organism is this sequence from? Genus and species? B. Is it identical, or similar, to anything that has been previously published? C. Why are the people on the ship ill? What would you do about it?
3 2. Open reading frames and protein sequences. A. Use the sequence above to search the NCBI protein database (GenPept NR) by changing the default search to the blastx program that does a 6-frame translation on the protein. A. Do you think this sequence codes for protein (yes / no). B. Is this sequence sense or antisense? C. Does the search give you any idea about the potential function of the protein? This type of protein has a generic name, can you figure it out? D. Is the sequence above a complete protein coding sequence? E. Can you find the complete genome sequence of this species? What is its GenBank Accession #? F. What is the name and accession number of the whole protein from which this sequence is derived? 3. Protein sequences A. Recover the whole protein sequence related to the DNA above in fasta format using the accession number above. How many amino acids does it contain?
4 B. What conserved domains does this protein have ( C. What other conserved domains are present in the other viral proteins in the genome? D. Do any of these have solved 3D structures? E. Where is the protein product of the protein in (A) likely to be targeted? (For predicted protein targeting see website at: Cut and paste the protein sequence that you generated for Part A). Part III You are investigating the role of genetic diversity on the flowering time / maturity date of rice. As part of your analysis, you use an Illumina HiSeq 2000 to generate 20,000,000 reads from RNA from five biological replicates at eight time points across the transition from vegetative growth to flowering. Your analysis reveals that a very small RNA molecule is strongly associated with the transition to flowering. AGAAUCUUGAUGAUGCUGCAU Using NCBI Nucleotide Blast as above, search for similar sequences in the database. A. Were the parameters you entered in the Blast search altered in any way automatically? B. Why might it be necessary to use different parameters for a shorter input sequence? Do you notice any difference in the output of the search using this short sequence compared to the longer sequence above? C. Has this sequence been previously recorded in the database of small, regulatory RNA at mirbase ( Note that this database uses a code for different species, such that rice (Oryza sativa) has the code osa, maize (Zea mays) has the code zma, etc.
5 D. Does this RNA have a known function? What is it? E. What is the sequence of the full message for this sequence (the pri-mirna, pre-mirna, or stem loop sequence)? F. Use the longer sequence of the pri-mirna you obtained above to search the rice genome at multiple resources, for example NCBI (select Oryza sativa as target organism), the rice genome project ( and phytozome ( (make sure to select Oryza sativa in the Plant Tree of Life at the left, and no other species). G. How do these resources differ? Do they all give you the same answer? Why do you think this is? H. How many hits are there in the rice genome? I. How many encode this exact pri-mirna? J. How many likely encode a version of this mirna?
Tutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
BME 110 Midterm Examination
BME 110 Midterm Examination May 10, 2011 Name: (please print) Directions: Please circle one answer for each question, unless the question specifies "circle all correct answers". You can use any resource
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
BLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
Worksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
Why learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
Bioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
FUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
DNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Bioinformatic tools for metagenomic data analysis
Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
![Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G](/thumbs/95/123686269.jpg "Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G")
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
Introduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.
SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop
Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
Biology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
O C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
Bacteriophage Evolution Lab Week
Bacteriophage Evolution Lab Week 6 10-16-06 Introduction Items you must bring to this lab: 1. Write-up from Phage Lab 5 2. The number and letter of the original phage suspension (1A-16A, 1B-16B) that your
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.
SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop
Tools and Opportunities to Enhance Risk Analysis. Nathan J. Hillson
Tools and Opportunities to Enhance Risk Analysis Nathan J. Hillson njhillson@lbl.gov Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System National
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
Name: Block: Date: Purpose: To better understand the roles played by DNA, m-rna, and t-rna and amino acids in enzyme formation and gene expression.
Name: Block: Date: Adapted from: Blueprint Gene to Working (Protein) Enzyme: Breaking the Genetic Code Purpose: To better understand the roles played by DNA, m-rna, and t-rna and amino acids in enzyme
Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<
Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is
Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
BIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
BLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
![Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]](/thumbs/75/71877651.jpg "Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]")
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
Why Use BLAST? David Form - August 15,
Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use
I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
Fundamentals of Bioinformatics: computation, biology, computational biology
Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) HC70AL Spring 2004 An Introduction to Bioinformatics -- Part I By Brandon Le April 6, 2004 What is a Gene? An ordered sequence of nucleotides What are the 4
HC70AL Spring 2011! An Introduction to Bioinformatics! By!! Brandon Le! April 7, 2011!
HC70AL Spring 2011! An Introduction to Bioinformatics! By!! Brandon Le! April 7, 2011! Outline 1. Review of Dideoxy Sequencing 2. Obtaining and Processing DNA Sequences 3. What is a Gene? 4. Sequence Analysis
Genetic tests are available for hundreds of disorders. DNA testing can pinpoint the exact genetic basis of a disorder.
Human DNA Analysis Human DNA Analysis There are roughly 6 billion base pairs in your DNA. Biologists search the human genome using sequences of DNA bases. Genetic tests are available for hundreds of disorders.
A Prac'cal Guide to NCBI BLAST
A Prac'cal Guide to NCBI BLAST Leonardo Mariño-Ramírez NCBI, NIH Bethesda, USA June 2018 1 NCBI Search Services and Tools Entrez integrated literature and molecular databases Viewers BLink protein similarities
2. The dropdown box has a number of databases that are searchable. Select the gene option and search for dihydrofolate reductase.
Bioinformatics Introduction Worksheet The first part of this exercise is aimed at walking you through some of the key tools used by scientists to explore the relationship between genes and proteins throughout
Guided Notes Unit 5: Molecular Genetics
Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics
SAMPLE LITERATURE Please refer to included weblink for correct version.
Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
Regulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
Bioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage
Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated
Introduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
Sections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
COMPARATIVE ANALYSIS AND INSILICO CHARACTERIZATION OF LEA, DREB AND OsDHODH1 GENES INVOLVED IN DROUGHT RESISTANCE OF ORYZA SATIVA
International Journal of Bio-Technology and Research (IJBTR) ISSN (P):2249-6858; ISSN (E):2249-796X Vol. 7, Issue 3, Jun 2017, 47-56 TJPRC Pvt. Ltd. COMPARATIVE ANALYSIS AND INSILICO CHARACTERIZATION OF
Prokaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine
1 Abstract A prokaryotic annotation pipeline was developed to automatically annotate draft and complete bacterial genomes. The protein coding genes in the genomes are predicted by the combination of Glimmer
26 STNews October 2008
26 STNews October 2008 Knowing whether to use U or T when searching RNA sequences on STN Introduction When you are designing a search query for sequence information on STN, it is important to consider
Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection Handed out: November 28 Due: December 14 Introduction In this laboratory we
Gene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton
Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked
Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
Genome Annotation - 2. Qi Sun Bioinformatics Facility Cornell University
Genome Annotation - 2 Qi Sun Bioinformatics Facility Cornell University Output from Maker GFF file: Annotated gene, transcripts, and CDS FASTA file: Predicted transcript sequences Predicted protein sequences
Bioinformatics Sequence And Genome Analysis David W Mount
Bioinformatics Sequence And Genome Analysis David W Mount We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,
Exploring the Genetic Basis for Behavior. Instructor s Notes
Exploring the Genetic Basis for Behavior Instructor s Notes Introduction This lab was designed for our 300-level Advanced Genetics course taken by juniors and seniors majoring in Biology or Biochemistry.
UNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
Exercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
Assembling Protein Molecules
How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.
BLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
Product Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
Big picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
03-511/711 Computational Genomics and Molecular Biology, Fall
03-511/711 Computational Genomics and Molecular Biology, Fall 2011 1 Problem Set 0 Due Tuesday, September 6th This homework is intended to be a self-administered placement quiz, to help you (and me) determine
Computational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Practical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 14, Lecture 27 István Albert Bioinformatics Consulting Center Penn State No homework this week Project to be given out next Thursday (Dec 1 st ) Due following
Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
Pre-Lab Questions. 1. Use the following data to construct a cladogram of the major plant groups.
Pre-Lab Questions Name: 1. Use the following data to construct a cladogram of the major plant groups. Table 1: Characteristics of Major Plant Groups Organism Vascular Flowers Seeds Tissue Mosses 0 0 0
Data Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
Genomics and Database Mining (HCS 604.3) April 2005
Genomics and Database Mining (HCS 604.3) April 2005 David M. Francis OARDC 1680 Madison Ave Wooster, OH 44691 e-mail: francis.77@osu.edu Introduction: Computers have changed the way biologists go about
Introducing Bioinformatics Concepts in CS1
Introducing Bioinformatics Concepts in CS1 Stuart Hansen Computer Science Department University of Wisconsin - Parkside hansen@cs.uwp.edu Erica Eddy Computer Science Department University of Wisconsin
Section 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
2014 APHL Next Generation Sequencing (NGS) Survey
APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and
Annotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
Written by: Prof. Brian White
Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure