Detecting Structural Variants in PacBio Reads Tools and Applications

Size: px
Start display at page:

Download "Detecting Structural Variants in PacBio Reads Tools and Applications"

Transcription

1 Detecting Structural Variants in PacBio Reads Tools and Applications Aaron Wenger For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved.

2 STRUCTURAL VARIANT = DIFFERENCE 50 BP Deletion Insertion Duplication Inversion Tandem Repeat Translocation

3 ASSAYS TO DETECT STRUCTURAL VARIANTS Cytogenetics Microarray Sequencing technologies karyotype, FISH oligo acgh, SNP acgh short read, PacBio long read resolution >5 Mb, >100 kb >50 kb basepair limitation marker density, microscope resolution probe density read length (mappability and spanning), systematic bias

4 STRUCTURAL VARIANTS DETECTED IN A HUMAN GENOME PacBio 20,000 Short reads 4,000 repeats + GC-rich + large insertions Huddleston et al. (2017) Genome Research 27(5): Seo et al. (2016) Nature 538: Sudmant et al. (2016) Nature 526:75-81.

5 VARIATION BETWEEN TWO HUMAN GENOMES vs variants basepairs affected 5 Mb 3 Mb 10 Mb SNVs indels structural variants Huddleston et al. (2017) Genome Research 27(5):

6 THE HUMAN GENOME IS COMPARATIVELY EASY structural variants per Mb percent of genome affected by SV reported short-read sensitivity for SV 7 0.3% 20% human fruit fly % 23% zebrafish % 1% Huddleston et al. (2017) Genome Research 27(5): Zichner et al. (2013) Genome Research 23(3): Patowary et al. (2013) Zebrafish 10(1): Zebrafish image courtesy of Lizzy Griffiths

7 EACH CLADE HAS ITS OWN STRUCTURAL VARIANT PROFILE human fruit fly zebrafish

8 Any study of genetic variation is incomplete until structural variation is detected with PacBio sequencing.

9 Any study of genetic variation is incomplete until structural variation is detected with PacBio sequencing. rare disease diagnosis GWAS evodevo

10 Any study of genetic variation is incomplete until structural variation is detected with PacBio sequencing. rare disease diagnosis GWAS evodevo

11 CLINICAL CASE HISTORY 7 yrs 10 yrs left atrial myxoma resection, atrial repair testicular mass, right orchiectomy 13 yrs pituitary tumor 16 yrs 18 yrs 19 yrs 21 yrs present (26 yrs) recurrence of myxomata, resection, adrenal microadenoma recurrence of ventricular myxomata, resection, VT ACTH-independent Cushing s disease, thyroid nodules transphenoidal resection of pituitary recurrence of myxomata, consideration for heart transplant genetics suggests Carney complex PRKAR1A testing negative short-read whole genome sequencing negative Merker et al. (2017) Genetics in Medicine. doi: /gim

12 EVALUATING STRUCTURAL VARIANTS Sequel System SEQUENCE (8-FOLD) Deletions 50 bp NGM-LR MAP READS PBHoney CALL VARIANTS Insertions 50 bp Initial call set 6,971 6,821 Merker et al. (2017) Genetics in Medicine. doi: /gim

13 EVALUATING STRUCTURAL VARIANTS Sequel System SEQUENCE (8-FOLD) Deletions 50 bp NGM-LR MAP READS PBHoney CALL VARIANTS Insertions 50 bp Initial call set 6,971 6,821 Not in segdup 5,893 6,254 Not in NA12878 healthy control Overlaps RefSeq coding exon Gene linked to some disease in OMIM Merker et al. (2017) Genetics in Medicine. doi: /gim Rescheneder, Sedlazeck, and Schatz. 2,476 3, English et al. (2014) BMC Bioinformatics 15:180.

14 HETEROZYGOUS 2.2 KB DELETION IN PRKAR1A Merker et al. (2017) Genetics in Medicine. doi: /gim

15 RNA-SEQ SHOWS REDUCED EXPRESSION AND NOVEL EXON-EXON JUNCTION normalized read counts control (n=16) case Merker et al. (2017) Genetics in Medicine. doi: /gim

16 DELETION CLASSIFIED AS PATHOGENIC PVS1 null variant (nonsense, frameshift, canonical splice sites, initiation codon, single or multiexon deletion) in a gene where loss of function is a known mechanism of disease. PS2 de novo (both maternity and paternity confirmed) in a patient with the disease and no family history Merker et al. (2017) Genetics in Medicine. doi: /gim

17 CLINICAL CASE HISTORY 7 yrs 10 yrs left atrial myxoma resection, atrial repair testicular mass, right orchiectomy 13 yrs pituitary tumor 16 yrs 18 yrs 19 yrs recurrence of myxomata, resection, adrenal microadenoma recurrence of ventricular myxomata, resection, VT ACTH-independent Cushing s disease, thyroid nodules genetics suggests Carney complex PRKAR1A testing negative 21 yrs present (26 yrs) transphenoidal resection of pituitary recurrence of myxomata, consideration for heart transplant Merker et al. (2017) Genetics in Medicine. doi: /gim short-read whole genome sequencing negative PacBio sequencing identifies causative structural variant in PRKAR1A

18 Merker et al. (2017) Genetics in Medicine. doi: /gim

19 Any study of genetic variation is incomplete until structural variation is detected with PacBio sequencing. rare disease diagnosis GWAS evodevo

20 SMRT LINK 5.0 INTRODUCES PBSV pbsv command line utility for top-level commands pbsvutil command line utility for detailed commands SMRT Link web interface

21 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

22 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

23 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis chr ACGCGGCCGCCTCCTCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGA A PASS IMPRECISE;SVTYPE=DEL;END=904587;SVLEN=-97;SVANN=TANDEM GT:AD:DP 0/1:9:15

24 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis chr Deletion -97. GT:AD:DP 0/1:9:15 SVANN=TANDEM

25 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

26 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

27 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

28 PBSV: SMRT LINK STRUCTURAL VARIANT CALLER SMRT Analysis

29 HOW MUCH TO SEQUENCE? Human HG00733 Sequel System 211 Gb (70-fold) Standard is full dataset Subsample / titrate to lower coverage Evaluate overlap with standard call set 100% 90% % SVs detected 80% 70% 60% 50% 40% 30% 20% Het Hom Het Hom short read 10% 0% Coverage Coverage

30 SUMMARY vs. 5 Mb 3 Mb 10 Mb PacBio 20,000 SNVs indels structural variants Short reads 4,000 repeats + GC-rich + large insertions

31 ACKNOWLEDGMENTS Stanford Univ PacBio Schatz Lab Euan Ashley Jason Merker Sowmi Utiramerur Yuan Li Chris Dunn Ben Lerch Jim Drake Mary Budagyan Jason Chin Sarah Kingan Greg Concepcion Michael Schatz Philipp Rescheneder Fritz Sedlazeck Nat Echols Jonas Korlach Aaron Klammer Paul Peluso Christine Lambert Kevin Eng NGM-LR penalty convex errors indels gap size

32 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved. Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, SMRTbell, Iso-Seq, and Sequel are trademarks of Pacific Biosciences. BluePippin and SageELF are trademarks of Sage Science. NGS-go and NGSengine are trademarks of GenDx. FEMTO Pulse and Fragment Analyzer are trademarks of Advanced Analytical Technologies. All other trademarks are the sole property of their respective owners.

Structural Variant Detection in SMRT Link 5 with pbsv

Structural Variant Detection in SMRT Link 5 with pbsv Structural Variant Detection in SMRT Link 5 with pbsv Aaron Wenger 2017-06-27 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All

More information

Structural Variant Detection in SMRT Link 5 with pbsv

Structural Variant Detection in SMRT Link 5 with pbsv Structural Variant Detection in SMRT Link 5 with pbsv Aaron Wenger 2017-06-27 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All

More information

Emerging applications of SMRT Sequencing

Emerging applications of SMRT Sequencing Emerging applications of SMRT Sequencing N Lance Hepler For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved. AGENDA

More information

Jenny Gu, PhD Strategic Business Development Manager, PacBio

Jenny Gu, PhD Strategic Business Development Manager, PacBio IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,

More information

Revolutionize Genomics with SMRT Sequencing. Single Molecule, Real-Time Technology

Revolutionize Genomics with SMRT Sequencing. Single Molecule, Real-Time Technology Revolutionize Genomics with SMRT Sequencing Single Molecule, Real-Time Technology Resolve to Master Complexity Despite large investments in population studies, the heritability of the majority of Mendelian

More information

The Why, What, and How of the Iso-Seq Method: Using Full-length RNA Sequencing to Annotate Genomes and Solve Diseases

The Why, What, and How of the Iso-Seq Method: Using Full-length RNA Sequencing to Annotate Genomes and Solve Diseases The Why, What, and How of the Iso-Seq Method: Using Full-length RNA Sequencing to Annotate Genomes and Solve Diseases For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 by Pacific

More information

Juliet - One Click Minor Variant Calling

Juliet - One Click Minor Variant Calling Juliet - One Click Minor Variant Calling github.com/pacificbiosciences/minorseq For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All

More information

Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis)

Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Before You Begin Review the template preparation procedure for Iso-Seq analysis here. The procedure provides instructions for constructing

More information

SMRT Analysis Barcoding Overview

SMRT Analysis Barcoding Overview SMRT Analysis Barcoding Overview Introduction This document is for users with Sequel Systems using SMRT Link v5.0.0 or v5.0.1. This document covers: Barcoding designs, strategies and modes for preparing

More information

Understanding Accuracy in SMRT Sequencing

Understanding Accuracy in SMRT Sequencing Understanding Accuracy in SMRT Sequencing Jonas Korlach, Chief Scientific Officer, Pacific Biosciences Introduction Single Molecule, Real-Time (SMRT ) DNA sequencing achieves highly accurate sequencing

More information

SMRT Analysis Barcoding Overview (v6.0.0)

SMRT Analysis Barcoding Overview (v6.0.0) SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document

More information

Procedure & Checklist - Using the BIO-RAD CHEF Mapper XA Pulsed Field Electrophoresis System

Procedure & Checklist - Using the BIO-RAD CHEF Mapper XA Pulsed Field Electrophoresis System Procedure & Checklist - Using the BIO-RAD CHEF Mapper XA Pulsed Field Electrophoresis System Before You Begin This procedure can be used to evaluate genomic DNA (gdna) to ensure that it is of high quality

More information

Statistics Output Guide

Statistics Output Guide Statistics Output Guide Introduction This document describes the file sts.xml, which is produced by the Sequel System s primary analysis pipeline. This XML file contains the chip-level sample distribution

More information

Looking Ahead: Improving Workflows for SMRT Sequencing

Looking Ahead: Improving Workflows for SMRT Sequencing Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences

More information

The Iso-Seq Method: Transcriptome Sequencing Using Long Reads

The Iso-Seq Method: Transcriptome Sequencing Using Long Reads The Iso-Seq Method: Transcriptome Sequencing Using Long Reads Elizabeth Tseng, Ph.D. Senior Staff Scientist FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright

More information

Understanding, Curating, and Analyzing your Diploid Genome Assembly

Understanding, Curating, and Analyzing your Diploid Genome Assembly Understanding, Curating, and Analyzing your Diploid Genome Assembly Sarah B. Kingan, Ph.D. Senior Scientist, Bioinformatics, PacBio Applications East Coast UGM, Baltimore, MD Tuesday June 27th 2017 For

More information

Case 3. Laura Yeates BSc (hons) Grad Dip Gen Couns. FHGSA

Case 3. Laura Yeates BSc (hons) Grad Dip Gen Couns. FHGSA Case 3 Laura Yeates BSc (hons) Grad Dip Gen Couns. FHGSA Genetic Counsellor & Clinic Coordinator Molecular Cardiology Program, Centenary Institute HCM & Genetic Heart Disease Clinics, RPAH ICCG 2018 Proband

More information

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING

NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING NUCLEOTIDE RESOLUTION STRUCTURAL VARIATION DETECTION USING NEXT- GENERATION WHOLE GENOME RESEQUENCING Ken Chen, Ph.D. kchen@genome.wustl.edu The Genome Center, Washington University in St. Louis The path

More information

02 Agenda Item 03 Agenda Item

02 Agenda Item 03 Agenda Item 01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application

More information

End of the road for short read sequencing. Prof. Graham Taylor PhD FRCPath Guy s, St Thomas s & King s College Hospital

End of the road for short read sequencing. Prof. Graham Taylor PhD FRCPath Guy s, St Thomas s & King s College Hospital End of the road for short read sequencing Prof. Graham Taylor PhD FRCPath Viapath @ Guy s, St Thomas s & King s College Hospital This talk 1. Short Read Sequencing and its Limitations 2. Applications of

More information

Guidelines for Using the BIO-RAD CHEF Mapper XA Pulsed Field Electrophoresis

Guidelines for Using the BIO-RAD CHEF Mapper XA Pulsed Field Electrophoresis Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers

More information

Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing

Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing Alix Kieu Cruse November 2015 For Research Use Only. Not for use in diagnostics procedures. Copyright 2015 by

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

De Novo and Hybrid Assembly

De Novo and Hybrid Assembly On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the

More information

Investor Slides. May 2018

Investor Slides. May 2018 Investor Slides May 2018 For Research Use Only. Not for use in diagnostics procedures. Copyright 2018 by Pacific Biosciences of California, Inc. All rights reserved. FORWARD LOOKING STATEMENTS All statements

More information

The Human Genome and its upcoming Dynamics

The Human Genome and its upcoming Dynamics The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001

More information

Building a platinum human genome assembly from single haplotype human genomes. Karyn Meltz Steinberg PacBio UGM December,

Building a platinum human genome assembly from single haplotype human genomes. Karyn Meltz Steinberg PacBio UGM December, Building a platinum human genome assembly from single haplotype human genomes Karyn Meltz Steinberg PacBio UGM December, 2015 @KMS_Meltzy Single haplotype from hydatidiform mole Enucleated egg (no maternal

More information

100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes

100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes 100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes Michael Schatz January 15, 2019 PAG2019 Bioinformatics Workshop @mike_schatz Tomato Domestication & Agriculture Tomatoes are

More information

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary

Personal Genomics Platform White Paper Last Updated November 15, Executive Summary Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,

More information

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

Structural variation analysis using NGS sequencing

Structural variation analysis using NGS sequencing Structural variation analysis using NGS sequencing Victor Guryev NBIC NGS taskforce meeting April 15th, 2011 Scale of genomic variants Scale 1 bp 10 bp 100 bp 1 kb 10 kb 100 kb 1 Mb Variants SNPs Short

More information

Complementary Technologies for Precision Genetic Analysis

Complementary Technologies for Precision Genetic Analysis Complementary NGS, CGH and Workflow Featured Publication Zhu, J. et al. Duplication of C7orf58, WNT16 and FAM3C in an obese female with a t(7;22)(q32.1;q11.2) chromosomal translocation and clinical features

More information

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products

More information

PacBio. The world s first single molecule, real-time DNA sequencer

PacBio. The world s first single molecule, real-time DNA sequencer PacBio The world s first single molecule, real-time DNA sequencer A revolutionary third generation DNA sequencing system incorporating novel single molecule sequencing with unprecedented readlengths to

More information

The Iso-Seq Method for Human Diseases and Genome Annotation

The Iso-Seq Method for Human Diseases and Genome Annotation The Iso-Seq Method for Human Diseases and Genome Annotation Elizabeth Tseng/ June 2018 @Magdoll For Research Use Only. Not for use in diagnostics procedures. Copyright 2018 by Pacific Biosciences of California,

More information

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence

More information

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis

More information

Guidelines for Using the Sage Science Pippin Pulse Electrophoresis Power Supply System

Guidelines for Using the Sage Science Pippin Pulse Electrophoresis Power Supply System Please note: the unsupported protocol described herein may not have been validated by Pacific Biosciences and is provided as-is and without any warranty. Use of this protocol is offered to those customers

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq. Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche

More information

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

More information

NGS-based innovations within the Leiden Network

NGS-based innovations within the Leiden Network NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Structural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Structural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Structural variation Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Genetic variation How much genetic variation is there between individuals? What type of variants

More information

Custom Panels via Clinical Exomes

Custom Panels via Clinical Exomes Custom Panels via Clinical Exomes Andrew Wallace Feb 2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester Custom Panel via Exome Approach Pros Reduced validation overhead Single validation

More information

Agilent NGS Solutions : Addressing Today s Challenges

Agilent NGS Solutions : Addressing Today s Challenges Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

Guidelines for Using the Sage Science Pippin Pulse

Guidelines for Using the Sage Science Pippin Pulse Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers

More information

100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES

100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES Nanopore Community Meeting 2018 100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES Michael Schatz Johns Hopkins University, Baltimore, MD @mike_schatz @NanoporeConf #NanoporeConf

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing

More information

Assay Validation Services

Assay Validation Services Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.

More information

Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah

Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?

More information

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles

More information

14 March, 2016: Introduction to Genomics

14 March, 2016: Introduction to Genomics 14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided

More information

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden

More information

Bionano Solve Theory of Operation: Variant Annotation Pipeline

Bionano Solve Theory of Operation: Variant Annotation Pipeline Bionano Solve Theory of Operation: Variant Annotation Pipeline Document Number: 30190 Document Revision: B For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics,

More information

Surely Better Target Enrichment from Sample to Sequencer and Analysis

Surely Better Target Enrichment from Sample to Sequencer and Analysis sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom

More information

Analysis of Structural Variants using 3 rd generation Sequencing

Analysis of Structural Variants using 3 rd generation Sequencing Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz January 12, 2016 Bioinformatics / PAG XXIV @mike_schatz / #PAGXXIV Analysis of Structural Variants using 3 rd generation

More information

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting

Setting Standards and Raising Quality for Clinical Bioinformatics. Joo Wook Ahn, Guy s & St Thomas 04/07/ ACGS summer scientific meeting Setting Standards and Raising Quality for Clinical Bioinformatics Joo Wook Ahn, Guy s & St Thomas 04/07/2016 - ACGS summer scientific meeting 1. Best Practice Guidelines Draft guidelines circulated to

More information

Automating the ACMG Guidelines with VSClinical. Gabe Rudy VP of Product & Engineering

Automating the ACMG Guidelines with VSClinical. Gabe Rudy VP of Product & Engineering Automating the ACMG Guidelines with VSClinical Gabe Rudy VP of Product & Engineering Thanks to NIH & Stakeholders NIH Grant Supported - Research reported in this publication was supported by the National

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data

Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October

More information

Analysis of structural variation. Alistair Ward - Boston College

Analysis of structural variation. Alistair Ward - Boston College Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an

More information

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable

More information

MRC-Holland MLPA. Description version 05; 16 March 2018

MRC-Holland MLPA. Description version 05; 16 March 2018 SALSA MLPA probemix P453-A2 GAA Lot A2-0617. As compared to previous version A1 (lot A1-0514), one reference probe has been removed and one has been replaced. The GAA gene encodes the enzyme acid alpha-glycosidase

More information

Next Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs

Next Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II

A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge

More information

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype

Next Generation Genetics: Using deep sequencing to connect phenotype to genotype Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000

More information

Implementation and Evaluation of 10X Genomics Chromium technology

Implementation and Evaluation of 10X Genomics Chromium technology Implementation and Evaluation of 10X Genomics Chromium technology Claire Kuchly & Olivier Bouchez 28/11/2017 get@genotoul.fr @get_genotoul 1 Chromium evaluation: pilot phase Platform installed in november

More information

How to deal with your RNA-seq data?

How to deal with your RNA-seq data? How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018

More information

Template Preparation FIND MEANING IN COMPLEXITY. Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved.

Template Preparation FIND MEANING IN COMPLEXITY. Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved. Template Preparation FIND MEANING IN COMPLEXITY Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved. PN 100-336-800-02 Specifics of SMRT Sequencing Data Steps of Overview SMRTbell

More information

The Agilent Technologies SureSelect Platform for Target Enrichment

The Agilent Technologies SureSelect Platform for Target Enrichment The Agilent Technologies SureSelect Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Kimberly Troutman Field Applications Scientist January 27 th, 2011 Agenda 1 Introduction:

More information

In silico variant analysis: Challenges and Pitfalls

In silico variant analysis: Challenges and Pitfalls In silico variant analysis: Challenges and Pitfalls Fiona Cunningham Variation annotation coordinator EMBL-EBI www.ensembl.org Sequencing -> Variants -> Interpretation Structural variants SNP? In-dels

More information

Supplementary Information for:

Supplementary Information for: Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro

More information

Quality assurance in NGS (diagnostics)

Quality assurance in NGS (diagnostics) Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product

More information

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.

More information

Wet-lab Considerations for Illumina data analysis

Wet-lab Considerations for Illumina data analysis Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina

More information

In addition, 10 reference probes are included in this probemix, detecting several different autosomal chromosomal locations.

In addition, 10 reference probes are included in this probemix, detecting several different autosomal chromosomal locations. SALSA MLPA probemix P179-B1 Limb Malformations-1 Lot B1-1014, B1-0611. As compared to the previous lot A2 (lot A2-0311), one GLI3 and three ROR2 probes have been replaced. Four extra GLI3 probes and one

More information

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic

More information

FFPE in your NGS Study

FFPE in your NGS Study FFPE in your NGS Study Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia Dec 6, 2017 Our mandate is to advance knowledge about cancer and other diseases and to use

More information

AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING HUI-JOU CHOU. A thesis submitted to the. Graduate School Camden

AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING HUI-JOU CHOU. A thesis submitted to the. Graduate School Camden AN ALGORITHM FOR STRUCTURAL VARIANT DETECTION WITH THIRD GENERATION SEQUENCING BY HUI-JOU CHOU A thesis submitted to the Graduate School Camden Rutgers, The State University of New Jersey in partial fulfillment

More information

Variant Callers. J Fass 24 August 2017

Variant Callers. J Fass 24 August 2017 Variant Callers J Fass 24 August 2017 Variant Types Caller Consistency Pabinger (2014) Briefings Bioinformatics 15:256 Freebayes Bayesian haplotype caller that can call SNPs, short CNVs / duplications,

More information

Procedure & Checklist - Preparing Asymmetric SMRTbell Templates

Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Guidelines for Preparing 20 kb SMRTbell Templates

Guidelines for Preparing 20 kb SMRTbell Templates Guidelines for Preparing 20 kb SMRTbell Templates User Bulletin This Bulletin provides recommendations and tips for preparing 20 kb SMRTbell templates using the BluePippin size-selection method. Once you

More information

New Frontiers of Genetic Profiling Achieve Higher Sensitivity and Greater Insights with Molecular Barcodes, Long Read Capture and Optimized Exomes

New Frontiers of Genetic Profiling Achieve Higher Sensitivity and Greater Insights with Molecular Barcodes, Long Read Capture and Optimized Exomes New Frontiers of Genetic Profiling Achieve Higher Sensitivity and Greater Insights with Molecular Barcodes, Long Read Capture and Optimized Exomes Jennifer Jones, PhD Senior Field Application Scientist

More information

Investor Presentation

Investor Presentation Investor Presentation October 2018 For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 by Pacific Biosciences of California, Inc. All rights reserved. 1 FORWARD LOOKING STATEMENTS

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

NGS to address ncrna and viruses

NGS to address ncrna and viruses NGS to address ncrna and viruses Introduction & TRON Next generation sequencing transcriptomics ncrnas vrna June 30, 2010 John Castle Institute for Translational Oncology and Immunology (TRON) Mainz, Germany

More information

SureSelect Clinical Research Exome V2. Optimized for Rare Diseases

SureSelect Clinical Research Exome V2. Optimized for Rare Diseases SureSelect Clinical Research Exome V2 Optimized for Rare Diseases SureSelect Clinical Research Exome V2 Definitive nswers Where It Matters Most he SureSelect Clinical Research Exome V2 is the newest version

More information

Corporate Overview. December Erik Holmlin President & CEO

Corporate Overview. December Erik Holmlin President & CEO Corporate Overview December 2018 Erik Holmlin President & CEO Forward-Looking Statements This presentation contains forward-looking statements. Forward-looking statements describe future expectations,

More information

Structural(varia+on!

Structural(varia+on! Structural(varia+on! Programming)for)Biology)! CSH,!October!2012!!!! Tomas!Marques7Bonet! ICREA!Research!Professor! InsAtut!de!Biologia!EvoluAva! Nucleotide Forms!of!geneAc!variaAon.!! Single)base8pair)changes)

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino -

Illumina Genome Analyzer. Progenika Experience. - Susana Catarino - Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information