Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Beauregard et al /pnas Fig. S1. Model depicting the regulatory pathway leading to expression of matrix genes. The master regulator Spo0A can be directly or indirectly phosphorylated by the five histidine kinases, KinA KinE. When the level of phosphorylated Spo0A (Spo0A P) reaches a threshold, sini transcription is activated. SinI acts as an anti-repressor that binds the repressor SinR, allowing the expression of matrix genes. Fig. S2. Only a small subset of B. subtilis cells grown in minimal salts nitrogen glycerol (MSNg) medium express matrix genes. Wild-type (3610) cells harboring P tapa -yfp were inoculated in MSNg medium and imaged after 24 h. Shown are overlays of fluorescence (false-colored green) and transmitted light (gray) images. 1of6

2 Fig. S3. B. subtilis does not colonize hair in minimal salts nitrogen (MSN) medium. Wild-type (3610) cells constitutively expressing yfp were incubated in the presence of sterilized human hair and incubated for 24 h. Overlay of fluorescence (false-colored green) and transmitted light (gray) images is shown. Fig. S4. Arabinogalactan, pectin, and xylan support growth of B. subtilis. Growth curve of cells shaken at 37 C in MSN with the indicated compounds as a sole carbon source. Note that the initial decrease in the xylan curve is due to the fact that xylan displays some absorbance at OD 600 and that, as the bacteria break down the xylan, there is a decrease in OD 600 until growth of bacteria surpasses xylan breakdown. 2of6

3 Fig. S5. Galactose, Arabinose, Fucose, Xylose, and Glucuronate do not induce biofilm formation. (A) Pellicle formation of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at a final concentration of 0.5% at the onset of the assay. AG, Arabinogalactan. Images are top-down view of wells and were taken after 24 h at 30 C. (B) Pellicle weight assay of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at a final concentration of 0.5% at the onset of the assay. Analysis of variance revealed a significant main group effect between the conditions used [F(6, 21), P < 0.001]. Tukey s post hoc test revealed that only galacturonic acid, arabinogalactan, and pectin (marked with asterisks) showed greater pellicle mean mass compared with MSNc alone, and that galacturonic acid was statistically different then pectin. Fig. S6. Plant polysaccharides induce pellicle formation at a concentration of 0.5%. Pellicle weight assay of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at the indicated final concentration of 0.5% at the onset of the assay. Two-way analysis of variance revealed a significant main group effect between the conditions used [F(2, 27), P < 0.001]. Tukey s post hoc test revealed that concentrations of 0.05% and 0.1% of any sugars showed lesser pellicle mean mass compared with concentration of 0.5%. 3of6

4 Fig. S7. The double deletion of KinC and KinD partially affects plant colonization. Mutant strains constitutively expressing YFP were coincubated with 6-d-old seedlings of A. thaliana. Colonization of the root was observed after 24 h. Overlays of fluorescence (false-colored green) and transmitted light (gray) images are shown. Pictures are representative of at least twelve independent roots. (Scale bars: 50 μm.) Fig. S8. Galactose rescues biofilm formation of a gale mutant in minimal salts glutamate glycerol (MSgg) medium. Deletion mutants for gale, galkt, or both were assayed for pellicle formation in the biofilm-inducing medium MSgg with or without the addition of galactose. Top-down view of pellicle formed by the indicated strains after incubation for 24 h at 30 C. 4of6

5 Fig. S9. Xyloglucan but not carboxymethylcellulose induces pellicle formation. Pellicle weight assay of wild-type cells in MSNc. The indicated polysaccharides were added at the indicated final concentration of 0.5% at the onset of the assay. CMC, carboxymethylcellulose. Two-way analysis of variance revealed a significant main group effect between the conditions used [F(3, 28), P < 0.001]. Tukey s post hoc test revealed that xyloglucan showed a greater pellicle mean mass compared with MSNc alone, and that xyloglucan was statistically different from AG. Fig. S10. The anti-sigma factor rsgi and its cognate sigma factor sigi are not involved in responding to plant polysaccharides. Top-down view of pellicle assay in which the indicated mutant cells were incubated for 24 h at 30 C in the presence of arabinogalactan (AG), pectin, or xylan in MSNc medium. 5of6

6 Table S1. Strains used in this study Strain Genotype Reference/source NCIB3610 Wild type. Undomesticated strain Lab stock CA018 amye::p tapa -yfp (spec) (1) PB133 amye::p hyperc1o1 -yfp (spec) Edgardo Sanabria-Valentín HV1142 amye::p spac -cfp (spec) This study PB178 eps::tet tasa::kan amye:: Phyperc1o1 -yfp (spec) This study PB228 eps::tet amye::p hyperc1o1 -yfp (spec) This study PB229 tasa::mls amye::p hyperc1o1 -yfp (spec) This study PB251 tasa::kan amye::p spac -cfp (spec) This study PB240 spo0a::mls amye::p hyperc101 -yfp (spec) This study PB177 sini::kan amye::p yqxm -yfp (spec) This study SSB43 spo0a::mls (2) ZK4654 sini::kan Lab stock FC63 kina::mls (3) HV1326 kinb::cm Lab stock HV1260 kinc::cm (4) DL153 kind::tet (5) HV1372 kine::cm This study ALM105 kinc::mls kind::tet (3) SSB46 srfaa::mls (2) PB214 kina::mls amye::p hyperc101 -yfp (spec) This study PB224 kinb::cm amye::p hyperc101 -yfp (spec) This study PB225 kinc::cm amye::p hyperc101 -yfp (spec) This study PB166 kind::mls amye::p hyperc101 -yfp (spec) This study PB215 kine::cm amye::p hyperc101 -yfp (spec) This study PB227 kinc::mls kind::tet amye::p hyperc101 -yfp(spec) This study PB283 srfaa::mls amye::p hyperc101 -yfp (spec) This study YC704 gale::tet (6) YC534 galkt::kan (6) YC705 gale::tet galkt::kan (6) PB384 gale::tet amye::p hyperc101 -yfp (spec) This study PB385 galkt::kan amye::p hyperc101 -yfp (spec) This study PB386 gale::tet galkt::kan amye::p hyperc101 -yfp (spec) This study PB08 Bacillus subtilis GB03 Joseph W. Kloepper PB288 Bacillus amyloliquefaciens FZB42 Michael Fischbach Unless indicated, strains are derivatives of B. subtilis Antibiotics: spectinomycin (spec), kanamycin (kan), MLS (mls), chloramphenicol (cm), tetracycline (tet). 1. Vlamakis H, Aguilar C, Losick R, Kolter R (2008) Control of cell fate by the formation of an architecturally complex bacterial community. Genes Dev 22(7): Branda SS, González-Pastor JE, Ben-Yehuda S, Losick R, Kolter R (2001) Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci USA 98(20): McLoon AL, Guttenplan SB, Kearns DB, Kolter R, Losick R (2011) Tracing the domestication of a biofilm-forming bacterium. J Bacteriol 193(8): Aguilar C, Vlamakis H, Guzman A, Losick R, Kolter R (2010) KinD is a checkpoint protein linking spore formation to extracellular-matrix production in Bacillus subtilis biofilms. MBio 1(1): e López D, Vlamakis H, Losick R, Kolter R (2009) Paracrine signaling in a bacterium. Genes Dev 23(14): Chai Y, Beauregard PB, Vlamakis H, Losick R, Kolter R (2012) Galactose metabolism plays a crucial role in biofilm formation by Bacillus subtilis. MBio 3(4):e of6

A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis

A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis Journal of Bacteriology Supplemental material A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis via the histidine kinase KinD signaling Moshe Shemesh 1,2* and Yunrong

More information

RemA (YlzA) and RemB (YaaB) Regulate Extracellular Matrix Operon Expression and Biofilm Formation in Bacillus subtilis

RemA (YlzA) and RemB (YaaB) Regulate Extracellular Matrix Operon Expression and Biofilm Formation in Bacillus subtilis JOURNAL OF BACTERIOLOGY, June 2009, p. 3981 3991 Vol. 191, No. 12 0021-9193/09/$08.00 0 doi:10.1128/jb.00278-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. RemA (YlzA) and RemB

More information

with protein synthesis

with protein synthesis JB Accepts, published online ahead of print on 4 October 2013 J. Bacteriol. doi:10.1128/jb.00975-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. D-amino acids indirectly inhibit

More information

Metabolism and Chromosome Copy Number Control Mutually Exclusive Cell Fates in Bacillus subtilis

Metabolism and Chromosome Copy Number Control Mutually Exclusive Cell Fates in Bacillus subtilis Manuscript EMBO-2010-76658 Metabolism and Chromosome Copy Number Control Mutually Exclusive Cell Fates in Bacillus subtilis Yunrong Chai, Thomas Norman, Roberto Kolter, Richard M. Losick Corresponding

More information

Functional analysis of the protein Veg that stimulates biofilm formation in Bacillus

Functional analysis of the protein Veg that stimulates biofilm formation in Bacillus JB Accepts, published online ahead of print on 1 February 2013 J. Bacteriol. doi:10.1128/jb.02201-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13

More information

Materials and methods. by University of Washington Yeast Resource Center) from several promoters, including

Materials and methods. by University of Washington Yeast Resource Center) from several promoters, including Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)

More information

Δsig. ywa. yjbm. rela -re. rela

Δsig. ywa. yjbm. rela -re. rela A wt A. A, P rela -re la A/Δ yjbm A/Δ ywa C A, P hy-s igd, D (A, P IPTG hy-s igd, ) D D (+ IPTG ) D/Δ rela Figure S1 SigD B. Figure S1. SigD levels and swimming motility in (p)ppgpp synthetase mutants.

More information

Supporting Online Material for

Supporting Online Material for Originally published 30 April 2010; corrected 7 December 2011 www.sciencemag.org/cgi/content/full/328/5978/627/dc1 Supporting Online Material for D-Amino Acids Trigger Biofilm Disassembly Ilana Kolodkin-Gal,

More information

YuaB functions synergistically with the exopolysaccharide and TasA amyloid fibres to allow biofilm formation by Bacillus subtilis.

YuaB functions synergistically with the exopolysaccharide and TasA amyloid fibres to allow biofilm formation by Bacillus subtilis. JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.00223-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

BACTERIAL BIOFILMS FORMATION AT AIR LIQUID INTERFACES

BACTERIAL BIOFILMS FORMATION AT AIR LIQUID INTERFACES Innovative Romanian Food Biotechnology Vol. 5, Issue of December, 009 009 by Dunărea de Jos University Galaţi Received September 1, 009/ Accepted November 8, 009 RESEARCH ARTICLE BACTERIAL BIOFILMS FORMATION

More information

FtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis

FtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis FtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis Jeffrey Meisner, Paula Montero Llopis, Lok-To Sham, Ethan Garner, Thomas G. Bernhardt, David

More information

-7 ::(teto) ::(teto) 120. GFP membranes merge. overexposed. Supplemental Figure 1 (Marquis et al.)

-7 ::(teto) ::(teto) 120. GFP membranes merge. overexposed. Supplemental Figure 1 (Marquis et al.) P spoiie -gfp -7 ::(teto) 120-91 ::(teto) 120 GFP membranes merge overexposed Supplemental Figure 1 (Marquis et al.) Figure S1 TetR-GFP is stripped off the teto array in sporulating cells that contain

More information

Not so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus

Not so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus Not so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus subtilis and its impact on the evolution of biofilms Gili Rosenberg 1, Nitai Steinberg 1,4, Yaara Oppenheimer-Shaanan

More information

1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA.

1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA. LS1a Fall 06 Problem Set #10 Due Friday 12/15 at noon in your TF s drop box on the 2 nd floor of the Science Center all questions including the (*extra*) one should be turned in 1. In lecture we learned

More information

A Discovery Laboratory Investigating Bacterial Gene Regulation

A Discovery Laboratory Investigating Bacterial Gene Regulation Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of

More information

Supplemental Material. Supplemental Tables. Table S1. Strains used in this study.

Supplemental Material. Supplemental Tables. Table S1. Strains used in this study. Supplemental Material Supplemental Tables Table S1. Strains used in this study. Strain Genotype Reference E. coli strains S17-1λpir Wild-type (1) BL21(DE3) Wild-type Life Technologies DH10B Wild-type Life

More information

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements? 6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

More information

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. Name Microbial Genetics, BIO 410/510 2008 Exam II The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. 1.) Indicate where replication

More information

Supplementary information

Supplementary information Spatio-temporal Assembly of Functional Mineral Scaffolds within Microbial Biofilms Yaara Oppenheimer-Shaanan, Odelia Sibony-Nevo, Zohar Bloom-Ackermann, Ronit Suissa, Nitai Steinberg, Vlad Brumfeld, Elena

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

An accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis biofilmsmmi_

An accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis biofilmsmmi_ Molecular Microbiology (2011) 80(5), 1155 1168 doi:10.1111/j.1365-2958.2011.07653.x First published online 4 May 2011 An accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis

More information

Orthogonal Ribosome Biofirewall

Orthogonal Ribosome Biofirewall 1 2 3 4 5 Supporting Information Orthogonal Ribosome Biofirewall Bin Jia,, Hao Qi,, Bing-Zhi Li,, Shuo pan,, Duo Liu,, Hong Liu,, Yizhi Cai, and Ying-Jin Yuan*, 6 7 8 9 10 11 12 Key Laboratory of Systems

More information

S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused

S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.

More information

The prevalence and origin of exoproteaseproducing cells in the Bacillus subtilis biofilm

The prevalence and origin of exoproteaseproducing cells in the Bacillus subtilis biofilm Microbiology (14), 1, 56 66 DOI 1.199/mic..72389- The prevalence and origin of exoproteaseproducing cells in the Bacillus subtilis biofilm Victoria L. Marlow, 1 Francesca R. Cianfanelli, 1 Michael Porter,

More information

Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc

Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site

More information

HOUR EXAM I BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam.

HOUR EXAM I BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. Name First Last (Please Print) PID Number - HOUR EXAM I BIOLOGY 422 FALL, 2011 In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. 1 Signature 2 3 4 5 6

More information

Inside the Burch Lab: E. Coli and Triclosan Resistance. By: Pamela Lammonds

Inside the Burch Lab: E. Coli and Triclosan Resistance. By: Pamela Lammonds Inside the Burch Lab: E. Coli and Triclosan Resistance By: Pamela Lammonds Purpose and Goals of Research Concerns over infectious disease have risen in the past few years. In response to this concern,

More information

Solutions to 7.02 Quiz III

Solutions to 7.02 Quiz III Solutions to 7.02 Quiz III Class Average = 79 Standard Deviation = 12 Range Grade % 85-100 A 40 72-84 B 37 55-71 C 20 > 54 D/F 3 Question 1 On day 1 of the genetics lab, the entire 7.02 class did a transposon

More information

Supplementary Information. for. How Escherichia coli lands and forms cell clusters on a surface: a new role of surface. topography

Supplementary Information. for. How Escherichia coli lands and forms cell clusters on a surface: a new role of surface. topography Supplementary Information for How Escherichia coli lands and forms cell clusters on a surface: a new role of surface topography Huan Gu 1, 2, *, Aaron Chen 1, 2, *,, Xinran Song 1, 2, Megan E. Brasch 1,2,

More information

SUPPLEMENTAL MATERIAL. Plasmid construction

SUPPLEMENTAL MATERIAL. Plasmid construction SUPPLEMENTAL MATERIAL Plasmid construction pkm288 [dnax-yfp (phleo)] was generated by subcloning an EcoRI-PstI fragment (dnax-yfp) from pkl183 (Lemon and Grossman, 1998) into pdt2. pdt2 is a puc19 derivative

More information

Dynamic map of protein interactions in the Escherichia coli chemotaxis pathway. Attractant exchange profile during kinetics measurements.

Dynamic map of protein interactions in the Escherichia coli chemotaxis pathway. Attractant exchange profile during kinetics measurements. Supplementary data Dynamic map of protein interactions in the Escherichia coli chemotaxis pathway David Kentner, Victor Sourjik Table of content: Figure S1 Figure S2 Figure S3 Table SI Microscopy setups

More information

Optimizing Bacterial Adhesion to a Microfluidic Platform for Monitoring Bacterial Biofilm Growth

Optimizing Bacterial Adhesion to a Microfluidic Platform for Monitoring Bacterial Biofilm Growth Optimizing Bacterial Adhesion to a Microfluidic Platform for Monitoring Bacterial Biofilm Growth Aaron Cheng August 6th, 2010 Mentors: Mariana Meyer, Peter Dykstra Professor Reza Ghodssi Bacterial Quorum

More information

ptka epsb Figure S1. The PtkA kinase contributes to EPS production Shown is colony wrinkling on biofilm-inducing medium for strains NCBI 3610

ptka epsb Figure S1. The PtkA kinase contributes to EPS production Shown is colony wrinkling on biofilm-inducing medium for strains NCBI 3610 Figure S1 WT epsab ptka ptka epsb Figure S1. The PtkA kinase contributes to EPS production Shown is colony wrinkling on biofilm-inducing medium for strains NCBI 3610 (WT), BAE252 ( epsab), YC176 ( ptka),

More information

7.02 Microbial Genetics in Lab Quiz. Fall, September 27, 2001 ANSWER KEY

7.02 Microbial Genetics in Lab Quiz. Fall, September 27, 2001 ANSWER KEY 7.02 Microbial Genetics in Lab Quiz Fall, 2001 September 27, 2001 ANSWER KEY This quiz contains 4 questions worth a total of 48 points. Be sure to write your name, Bench letter and Undergraduate TA s (UTA)

More information

Stacy L. Hrizo and Nancy Kaufmann From the Department of Biological Sciences, University of Pittsburgh, Pittsburgh, Pennsylvania 15260

Stacy L. Hrizo and Nancy Kaufmann From the Department of Biological Sciences, University of Pittsburgh, Pittsburgh, Pennsylvania 15260 Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 3, pp. 164 169, 2009 Laboratory Exercises Illuminating Cell Signaling:

More information

Aminoacid change in chromophore. PIN3::PIN3-GFP GFP S65 (no change) (5.9) (Kneen et al., 1998)

Aminoacid change in chromophore. PIN3::PIN3-GFP GFP S65 (no change) (5.9) (Kneen et al., 1998) Supplemental Table. Table S1. Fluorophore characteristics of used fluorescent proteins, Related to Figure 2 and 3. Transgenic line Fluprescent marker Aminoacid change in chromophore pk(a) Ref. PIN3::PIN3-GFP

More information

Antibiotic effects on yqfa protein function in Escherichia coli metabolism

Antibiotic effects on yqfa protein function in Escherichia coli metabolism University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2016 Antibiotic effects on yqfa

More information

Probing phenotypic growth in expanding Bacillus subtilis biofilms

Probing phenotypic growth in expanding Bacillus subtilis biofilms Appl Microbiol Biotechnol (2016) 100:4607 4615 DOI 10.1007/s00253-016-7461-4 METHODS AND PROTOCOLS Probing phenotypic growth in expanding Bacillus subtilis biofilms Xiaoling Wang 1,2 & Stephan A. Koehler

More information

Supplemental Data. Sentandreu et al. (2011). Plant Cell /tpc

Supplemental Data. Sentandreu et al. (2011). Plant Cell /tpc SUPPLEMENTAL ANALYSIS 1. Definition of the PIF3-regulated transcriptome in the dark. We applied an ANOVA approach using the Rosetta Resolver platform to look for genes whose expression was statistically

More information

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When

More information

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are

More information

Confirming the Phenotypes of E. coli Strains

Confirming the Phenotypes of E. coli Strains Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond

More information

SUPPLEMENTAL MATERIAL FOR. Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important

SUPPLEMENTAL MATERIAL FOR. Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important SUPPLEMENTAL MATERIAL FOR Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important for Commitment to Sporulation during Myxococcus xanthus Development Ramya Rajagopalan and Lee Kroos

More information

Antagonism of Two Plant-Growth Promoting Bacillus velezensis Isolates. Against Ralstonia solanacearum and Fusarium oxysporum

Antagonism of Two Plant-Growth Promoting Bacillus velezensis Isolates. Against Ralstonia solanacearum and Fusarium oxysporum 1 2 Antagonism of Two Plant-Growth Promoting Bacillus velezensis Isolates Against Ralstonia solanacearum and Fusarium oxysporum 3 4 5 Yu Cao 1, Hualiang Pi 2, Pete Chandrangsu 2, Yongtao Li 1, Yuqi Wang

More information

Bi 1x Spring 2016: LacI Titration

Bi 1x Spring 2016: LacI Titration Bi 1x Spring 2016: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a

More information

BIOLOGY. Bacteria Growth Lab. Bacterial Growth. Slide 2 / 61. Slide 1 / 61. Slide 4 / 61. Slide 3 / 61. Slide 5 / 61. Slide 6 / 61

BIOLOGY. Bacteria Growth Lab. Bacterial Growth. Slide 2 / 61. Slide 1 / 61. Slide 4 / 61. Slide 3 / 61. Slide 5 / 61. Slide 6 / 61 Slide 1 / 61 Slide 2 / 61 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of

More information

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young

7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young 7.03 Final Exam Name: TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young Section time: There are 13 pages including this cover page Please write your name

More information

Supplemental Data. Furlan et al. Plant Cell (2017) /tpc

Supplemental Data. Furlan et al. Plant Cell (2017) /tpc Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.

More information

Chapter 6: Microbial Growth

Chapter 6: Microbial Growth Chapter 6: Microbial Growth 1. Requirements for Growth 2. Culturing Microorganisms 3. Patterns of Microbial Growth 1. Requirements for Growth Factors that affect Microbial Growth Microbial growth depends

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants

More information

Supplementary Information: The timing of transcriptional regulation in synthetic gene circuits. Corresponding author.

Supplementary Information: The timing of transcriptional regulation in synthetic gene circuits. Corresponding author. Supplementary Information: The timing of transcriptional regulation in synthetic gene circuits Yu-Yu Cheng 1, Andrew J. Hirning 1, Krešimir Josić 1,2,3, and Matthew R. Bennett 1,4, 1 Department of Biosciences,

More information

Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments

Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments Supplementary Table S1 Complete data set for ccamk-13snf2 and hit1snf1 experiments Supplementary Table S2 M. loti

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins

More information

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618 Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop

More information

Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab

Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab OBJECTIVES 1. Understand the use of MPN to determine likely fecal water contamination. 2. Understand the use of MUG,

More information

Supplementary information

Supplementary information Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines

More information

Requirement for a Functional int Product in Temperature Inductions of

Requirement for a Functional int Product in Temperature Inductions of JOURNAL OF VIROLOGY, SePt. 1970, p. 320-325 Vol. 6, No. 3 Copyright 1970 American Society for Microbiology Prinited in U.S.A. Requirement for a Functional int Product in Temperature Inductions of Prophage

More information

However, only a fraction of these genes are transcribed in an individual cell at any given time.

However, only a fraction of these genes are transcribed in an individual cell at any given time. All cells in an organism contain the same set of genes. However, only a fraction of these genes are transcribed in an individual cell at any given time. It is the pattern of gene expression that determines

More information

Supplementary Information

Supplementary Information Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion

More information

Stalled antibiotics development. A solved problem No new classes of antibiotics for 30 years

Stalled antibiotics development. A solved problem No new classes of antibiotics for 30 years Stalled antibiotics development A solved problem No new classes of antibiotics for 30 years Stalled antibiotics development A solved problem No new classes of antibiotics for 30 years Walsh & Fischbach

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,

More information

Effect of mutations in the outer membrane components on bacteriophage T4 adsorption to Escherichia coli

Effect of mutations in the outer membrane components on bacteriophage T4 adsorption to Escherichia coli Effect of mutations in the outer membrane components on bacteriophage T4 adsorption to Escherichia coli ALICE WANG AND KEVIN LIN Department of Microbiology and Immunology, UBC Esherichia coli strains with

More information

Supplementary Figure 1. Determination of the purity of CP. a, SDS-PAGE of CP and CP- PTX conjugate, and b, HPLC trace of purified CP.

Supplementary Figure 1. Determination of the purity of CP. a, SDS-PAGE of CP and CP- PTX conjugate, and b, HPLC trace of purified CP. Supplementary Figure 1. Determination of the purity of CP. a, SDS-PAGE of CP and CP- PTX conjugate, and b, HPLC trace of purified CP. Supplementary Figure 2. Synthesis of CP-PTX conjugate. Supplementary

More information

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.

Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Biology 2250 Transformation laboratory

Biology 2250 Transformation laboratory Biology 2250 Transformation laboratory Prior to lab: Discuss how to use micropipettes. Discuss how to use microcentrifuge balance. Discuss how to spread bacteria with alcohol and glass rods. Bacteria are

More information

Genetics Lecture Notes Lectures 13 16

Genetics Lecture Notes Lectures 13 16 Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +

More information

ENVIRONMENTAL PARAMETERS OF GROWTH

ENVIRONMENTAL PARAMETERS OF GROWTH ENVIRONMENTAL PARAMETERS OF GROWTH The growth and survival of microorganisms are affected by the chemical and physical conditions of the external environment. Environmental factors which have significant

More information

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling

More information

Thank you and good morning.

Thank you and good morning. Thank you and good morning. 1 I have no conflicts of interest to disclose. 2 I m going to speak today about basic science research into group B strep virulence. GBS remains an important cause of neonatal

More information

AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between

AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1

More information

Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only

Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only Sample : up to 300 µl of whole blood, up to 200 µl of frozen blood, up to 200 µl of buffy coat, cultured animal cells (up to 1 x 107), 9

More information

Minimal Bactericidal Concentration for Biofilms (MBC-B) Nicole Billings and Katharina Ribbeck *

Minimal Bactericidal Concentration for Biofilms (MBC-B) Nicole Billings and Katharina Ribbeck * Minimal Bactericidal Concentration for Biofilms (MBC-B) Nicole Billings and Katharina Ribbeck * Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA *For correspondence:

More information

The Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae

The Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae Letters in General Microbiology The Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae Rachel Sohn, Melissa Kane and Michelle Wong Department of Biology, Rutgers University, Camden

More information

Chapter 9 Microbial Genetics

Chapter 9 Microbial Genetics Chapter 9 Microbial Genetics You are expected to know details of 1) DNA replication 2) RNA synthesis (transcription) 3) Protein synthesis (translation) Genome & Genes A genome is all the genetic information

More information

Supporting information

Supporting information Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),

More information

Phenotype MicroArrays: A Platform for Phenotypic Characterization of Cells and Species Description

Phenotype MicroArrays: A Platform for Phenotypic Characterization of Cells and Species Description Stacy O. Montgomery, Ph.D. ICCC12 Florianopolis Brazil 30 Sept. 2010 smontgomery@biolog.com Phenotype MicroArrays: A Platform for Phenotypic Characterization of Cells and Species Description Agenda Microbial

More information

Isolation and screening of pyocyanin producing Pseudomonas spp. from soil

Isolation and screening of pyocyanin producing Pseudomonas spp. from soil Int. J. Adv. Res. Biol. Sci. (2017). 4(4): 147-152 International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 4, Issue

More information

SI Results Peculiarities in the consumption of ammonium and glucose by AmtB- strains SI Materials and Methods Strain Construction

SI Results Peculiarities in the consumption of ammonium and glucose by AmtB- strains SI Materials and Methods Strain Construction SI Results Peculiarities in the consumption of ammonium and glucose by AmtB - strains. The AmtB - strain failed to consume all the ammonium in the medium under NH 3 -limiting conditions (.5 mm total ammonium

More information

Pearson Education Limited Edinburgh Gate Harlow Essex CM20 2JE England and Associated Companies throughout the world

Pearson Education Limited Edinburgh Gate Harlow Essex CM20 2JE England and Associated Companies throughout the world Pearson Education Limited Edinburgh Gate Harlow Essex CM20 2JE England and Associated Companies throughout the world Visit us on the World Wide Web at: www.pearsoned.co.uk Pearson Education Limited 2014

More information

Mcbio 316: Exam 3. (10) 2. Compare and contrast operon vs gene fusions.

Mcbio 316: Exam 3. (10) 2. Compare and contrast operon vs gene fusions. Mcbio 316: Exam 3 Name (15) 1. Transposons provide useful tools for genetic analysis. List 5 different uses of transposon insertions. ANSWER: Many answers are possible, however, if multiple items on the

More information

7.02/ Microbial Genetics Exam Study Questions

7.02/ Microbial Genetics Exam Study Questions MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 7.02/10.702 Microbial Genetics Exam Study Questions These questions adapted from old exam questions--are

More information

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively. Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10

More information

Autophagy induction [h]

Autophagy induction [h] A SD-N [h]: SD-N [h]: 1 2 4 1 2 4 1 2 4 -GFP 1 2 4 percentage GFP-Atg8 [%] 1 9 8 7 6 5 4 3 2 1 1 2 4 Autophagy induction [h] -13xmyc SD-N [h]: 1 2 4 -GFP -13xmyc 1 prape1 mape1 - - GFP - 13xmyc mape1 [%]

More information

7.02/ Genetics Exam Study Questions Spring The exam will be: Thursday, April 27 th, :05-11:55 AM Walker Gym, 3 rd floor (50-340)

7.02/ Genetics Exam Study Questions Spring The exam will be: Thursday, April 27 th, :05-11:55 AM Walker Gym, 3 rd floor (50-340) 7.02/10.702 Genetics Exam Study Questions Spring 2006 Annoucements: The exam will be: Thursday, April 27 th, 2006 11:05-11:55 AM Walker Gym, 3 rd floor (50-340) Please note that these practice questions

More information

Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native

Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native Ag43 phase variation depends on Ag43, motility, chemotaxis and AI-2 sensing. Cells were grown to OD600 of 0.6 at 37 C and aggregation

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Supplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato

Supplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty

More information

CHAPTER 5 SUMMARY AND CONCLUSION. 188 P a g e

CHAPTER 5 SUMMARY AND CONCLUSION. 188 P a g e CHAPTER 5 SUMMARY AND CONCLUSION 188 P a g e Deinococcus radiodurans R1 exhibits an extraordinary tolerance to various abiotic stresses including radiations and desiccation. The amazing radioresistance

More information

Hampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis

Hampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis Richter et al. BMC Evolutionary Biology (2018) 18:155 https://doi.org/10.1186/s12862-018-1266-2 RESEARCH ARTICLE Hampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis Anne

More information

FORMULATION OF BACTERIAL CONSORTIA AND STUDYING THEIR SYNERGISTIC EFFECT ON TREATMENT OF EFFLUENT

FORMULATION OF BACTERIAL CONSORTIA AND STUDYING THEIR SYNERGISTIC EFFECT ON TREATMENT OF EFFLUENT CHAPTER 5 FORMULATION OF BACTERIAL CONSORTIA AND STUDYING THEIR SYNERGISTIC EFFECT ON TREATMENT OF EFFLUENT 5.1. Introduction Based on the biodegradability, the industrial pollutants have been classified

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

Several Aspects of Microbial Technology for Food Pasteurization and Sterilization

Several Aspects of Microbial Technology for Food Pasteurization and Sterilization , Vol. 10, No. 4, pp. 183-190, Dec. 2009 Several Aspects of Microbial Technology for Food Pasteurization and Sterilization Tetsuaki TSUCHIDO Department of Life Science and Biotechnology, Faculty of Chemistry,

More information

Isolation and Characterization of Two Antibiotic-Producing Bacteria

Isolation and Characterization of Two Antibiotic-Producing Bacteria Isolation and Characterization of Two Antibiotic-Producing Bacteria Madeline Gibson Abstract The discovery of antibiotics with novel mechanisms has plateaued in the last twenty years. As antibiotics are

More information

REGULATION OF GENE EXPRESSION

REGULATION OF GENE EXPRESSION REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the

More information

Gene disruption and construction of C-terminally tagged strains

Gene disruption and construction of C-terminally tagged strains Supplementary information Supplementary Methods Gene disruption and construction of C-terminally tagged strains A PCR-based gene targeting method (Bähler et al., 1998; Sato et al., 2005) was used for constructing

More information

CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution

CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution Cat. Nos. C400EL10, C400CH10, and CIS40025 Available exclusively thru Lucigen. lucigen.com/epibio

More information