Supporting Information
|
|
- Stewart Watts
- 6 years ago
- Views:
Transcription
1 Supporting Information Beauregard et al /pnas Fig. S1. Model depicting the regulatory pathway leading to expression of matrix genes. The master regulator Spo0A can be directly or indirectly phosphorylated by the five histidine kinases, KinA KinE. When the level of phosphorylated Spo0A (Spo0A P) reaches a threshold, sini transcription is activated. SinI acts as an anti-repressor that binds the repressor SinR, allowing the expression of matrix genes. Fig. S2. Only a small subset of B. subtilis cells grown in minimal salts nitrogen glycerol (MSNg) medium express matrix genes. Wild-type (3610) cells harboring P tapa -yfp were inoculated in MSNg medium and imaged after 24 h. Shown are overlays of fluorescence (false-colored green) and transmitted light (gray) images. 1of6
2 Fig. S3. B. subtilis does not colonize hair in minimal salts nitrogen (MSN) medium. Wild-type (3610) cells constitutively expressing yfp were incubated in the presence of sterilized human hair and incubated for 24 h. Overlay of fluorescence (false-colored green) and transmitted light (gray) images is shown. Fig. S4. Arabinogalactan, pectin, and xylan support growth of B. subtilis. Growth curve of cells shaken at 37 C in MSN with the indicated compounds as a sole carbon source. Note that the initial decrease in the xylan curve is due to the fact that xylan displays some absorbance at OD 600 and that, as the bacteria break down the xylan, there is a decrease in OD 600 until growth of bacteria surpasses xylan breakdown. 2of6
3 Fig. S5. Galactose, Arabinose, Fucose, Xylose, and Glucuronate do not induce biofilm formation. (A) Pellicle formation of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at a final concentration of 0.5% at the onset of the assay. AG, Arabinogalactan. Images are top-down view of wells and were taken after 24 h at 30 C. (B) Pellicle weight assay of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at a final concentration of 0.5% at the onset of the assay. Analysis of variance revealed a significant main group effect between the conditions used [F(6, 21), P < 0.001]. Tukey s post hoc test revealed that only galacturonic acid, arabinogalactan, and pectin (marked with asterisks) showed greater pellicle mean mass compared with MSNc alone, and that galacturonic acid was statistically different then pectin. Fig. S6. Plant polysaccharides induce pellicle formation at a concentration of 0.5%. Pellicle weight assay of wild-type cells in MSNc. The indicated mono- or polysaccharides were added at the indicated final concentration of 0.5% at the onset of the assay. Two-way analysis of variance revealed a significant main group effect between the conditions used [F(2, 27), P < 0.001]. Tukey s post hoc test revealed that concentrations of 0.05% and 0.1% of any sugars showed lesser pellicle mean mass compared with concentration of 0.5%. 3of6
4 Fig. S7. The double deletion of KinC and KinD partially affects plant colonization. Mutant strains constitutively expressing YFP were coincubated with 6-d-old seedlings of A. thaliana. Colonization of the root was observed after 24 h. Overlays of fluorescence (false-colored green) and transmitted light (gray) images are shown. Pictures are representative of at least twelve independent roots. (Scale bars: 50 μm.) Fig. S8. Galactose rescues biofilm formation of a gale mutant in minimal salts glutamate glycerol (MSgg) medium. Deletion mutants for gale, galkt, or both were assayed for pellicle formation in the biofilm-inducing medium MSgg with or without the addition of galactose. Top-down view of pellicle formed by the indicated strains after incubation for 24 h at 30 C. 4of6
5 Fig. S9. Xyloglucan but not carboxymethylcellulose induces pellicle formation. Pellicle weight assay of wild-type cells in MSNc. The indicated polysaccharides were added at the indicated final concentration of 0.5% at the onset of the assay. CMC, carboxymethylcellulose. Two-way analysis of variance revealed a significant main group effect between the conditions used [F(3, 28), P < 0.001]. Tukey s post hoc test revealed that xyloglucan showed a greater pellicle mean mass compared with MSNc alone, and that xyloglucan was statistically different from AG. Fig. S10. The anti-sigma factor rsgi and its cognate sigma factor sigi are not involved in responding to plant polysaccharides. Top-down view of pellicle assay in which the indicated mutant cells were incubated for 24 h at 30 C in the presence of arabinogalactan (AG), pectin, or xylan in MSNc medium. 5of6
6 Table S1. Strains used in this study Strain Genotype Reference/source NCIB3610 Wild type. Undomesticated strain Lab stock CA018 amye::p tapa -yfp (spec) (1) PB133 amye::p hyperc1o1 -yfp (spec) Edgardo Sanabria-Valentín HV1142 amye::p spac -cfp (spec) This study PB178 eps::tet tasa::kan amye:: Phyperc1o1 -yfp (spec) This study PB228 eps::tet amye::p hyperc1o1 -yfp (spec) This study PB229 tasa::mls amye::p hyperc1o1 -yfp (spec) This study PB251 tasa::kan amye::p spac -cfp (spec) This study PB240 spo0a::mls amye::p hyperc101 -yfp (spec) This study PB177 sini::kan amye::p yqxm -yfp (spec) This study SSB43 spo0a::mls (2) ZK4654 sini::kan Lab stock FC63 kina::mls (3) HV1326 kinb::cm Lab stock HV1260 kinc::cm (4) DL153 kind::tet (5) HV1372 kine::cm This study ALM105 kinc::mls kind::tet (3) SSB46 srfaa::mls (2) PB214 kina::mls amye::p hyperc101 -yfp (spec) This study PB224 kinb::cm amye::p hyperc101 -yfp (spec) This study PB225 kinc::cm amye::p hyperc101 -yfp (spec) This study PB166 kind::mls amye::p hyperc101 -yfp (spec) This study PB215 kine::cm amye::p hyperc101 -yfp (spec) This study PB227 kinc::mls kind::tet amye::p hyperc101 -yfp(spec) This study PB283 srfaa::mls amye::p hyperc101 -yfp (spec) This study YC704 gale::tet (6) YC534 galkt::kan (6) YC705 gale::tet galkt::kan (6) PB384 gale::tet amye::p hyperc101 -yfp (spec) This study PB385 galkt::kan amye::p hyperc101 -yfp (spec) This study PB386 gale::tet galkt::kan amye::p hyperc101 -yfp (spec) This study PB08 Bacillus subtilis GB03 Joseph W. Kloepper PB288 Bacillus amyloliquefaciens FZB42 Michael Fischbach Unless indicated, strains are derivatives of B. subtilis Antibiotics: spectinomycin (spec), kanamycin (kan), MLS (mls), chloramphenicol (cm), tetracycline (tet). 1. Vlamakis H, Aguilar C, Losick R, Kolter R (2008) Control of cell fate by the formation of an architecturally complex bacterial community. Genes Dev 22(7): Branda SS, González-Pastor JE, Ben-Yehuda S, Losick R, Kolter R (2001) Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci USA 98(20): McLoon AL, Guttenplan SB, Kearns DB, Kolter R, Losick R (2011) Tracing the domestication of a biofilm-forming bacterium. J Bacteriol 193(8): Aguilar C, Vlamakis H, Guzman A, Losick R, Kolter R (2010) KinD is a checkpoint protein linking spore formation to extracellular-matrix production in Bacillus subtilis biofilms. MBio 1(1): e López D, Vlamakis H, Losick R, Kolter R (2009) Paracrine signaling in a bacterium. Genes Dev 23(14): Chai Y, Beauregard PB, Vlamakis H, Losick R, Kolter R (2012) Galactose metabolism plays a crucial role in biofilm formation by Bacillus subtilis. MBio 3(4):e of6
A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis
Journal of Bacteriology Supplemental material A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis via the histidine kinase KinD signaling Moshe Shemesh 1,2* and Yunrong
More informationRemA (YlzA) and RemB (YaaB) Regulate Extracellular Matrix Operon Expression and Biofilm Formation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, June 2009, p. 3981 3991 Vol. 191, No. 12 0021-9193/09/$08.00 0 doi:10.1128/jb.00278-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. RemA (YlzA) and RemB
More informationwith protein synthesis
JB Accepts, published online ahead of print on 4 October 2013 J. Bacteriol. doi:10.1128/jb.00975-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. D-amino acids indirectly inhibit
More informationMetabolism and Chromosome Copy Number Control Mutually Exclusive Cell Fates in Bacillus subtilis
Manuscript EMBO-2010-76658 Metabolism and Chromosome Copy Number Control Mutually Exclusive Cell Fates in Bacillus subtilis Yunrong Chai, Thomas Norman, Roberto Kolter, Richard M. Losick Corresponding
More informationFunctional analysis of the protein Veg that stimulates biofilm formation in Bacillus
JB Accepts, published online ahead of print on 1 February 2013 J. Bacteriol. doi:10.1128/jb.02201-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13
More informationMaterials and methods. by University of Washington Yeast Resource Center) from several promoters, including
Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)
More informationΔsig. ywa. yjbm. rela -re. rela
A wt A. A, P rela -re la A/Δ yjbm A/Δ ywa C A, P hy-s igd, D (A, P IPTG hy-s igd, ) D D (+ IPTG ) D/Δ rela Figure S1 SigD B. Figure S1. SigD levels and swimming motility in (p)ppgpp synthetase mutants.
More informationSupporting Online Material for
Originally published 30 April 2010; corrected 7 December 2011 www.sciencemag.org/cgi/content/full/328/5978/627/dc1 Supporting Online Material for D-Amino Acids Trigger Biofilm Disassembly Ilana Kolodkin-Gal,
More informationYuaB functions synergistically with the exopolysaccharide and TasA amyloid fibres to allow biofilm formation by Bacillus subtilis.
JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.00223-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationBACTERIAL BIOFILMS FORMATION AT AIR LIQUID INTERFACES
Innovative Romanian Food Biotechnology Vol. 5, Issue of December, 009 009 by Dunărea de Jos University Galaţi Received September 1, 009/ Accepted November 8, 009 RESEARCH ARTICLE BACTERIAL BIOFILMS FORMATION
More informationFtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis
FtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis Jeffrey Meisner, Paula Montero Llopis, Lok-To Sham, Ethan Garner, Thomas G. Bernhardt, David
More information-7 ::(teto) ::(teto) 120. GFP membranes merge. overexposed. Supplemental Figure 1 (Marquis et al.)
P spoiie -gfp -7 ::(teto) 120-91 ::(teto) 120 GFP membranes merge overexposed Supplemental Figure 1 (Marquis et al.) Figure S1 TetR-GFP is stripped off the teto array in sporulating cells that contain
More informationNot so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus
Not so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus subtilis and its impact on the evolution of biofilms Gili Rosenberg 1, Nitai Steinberg 1,4, Yaara Oppenheimer-Shaanan
More information1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA.
LS1a Fall 06 Problem Set #10 Due Friday 12/15 at noon in your TF s drop box on the 2 nd floor of the Science Center all questions including the (*extra*) one should be turned in 1. In lecture we learned
More informationA Discovery Laboratory Investigating Bacterial Gene Regulation
Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of
More informationSupplemental Material. Supplemental Tables. Table S1. Strains used in this study.
Supplemental Material Supplemental Tables Table S1. Strains used in this study. Strain Genotype Reference E. coli strains S17-1λpir Wild-type (1) BL21(DE3) Wild-type Life Technologies DH10B Wild-type Life
More information9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?
6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?
More informationThe plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.
Name Microbial Genetics, BIO 410/510 2008 Exam II The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. 1.) Indicate where replication
More informationSupplementary information
Spatio-temporal Assembly of Functional Mineral Scaffolds within Microbial Biofilms Yaara Oppenheimer-Shaanan, Odelia Sibony-Nevo, Zohar Bloom-Ackermann, Ronit Suissa, Nitai Steinberg, Vlad Brumfeld, Elena
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationAn accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis biofilmsmmi_
Molecular Microbiology (2011) 80(5), 1155 1168 doi:10.1111/j.1365-2958.2011.07653.x First published online 4 May 2011 An accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis
More informationOrthogonal Ribosome Biofirewall
1 2 3 4 5 Supporting Information Orthogonal Ribosome Biofirewall Bin Jia,, Hao Qi,, Bing-Zhi Li,, Shuo pan,, Duo Liu,, Hong Liu,, Yizhi Cai, and Ying-Jin Yuan*, 6 7 8 9 10 11 12 Key Laboratory of Systems
More informationS156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
More informationThe prevalence and origin of exoproteaseproducing cells in the Bacillus subtilis biofilm
Microbiology (14), 1, 56 66 DOI 1.199/mic..72389- The prevalence and origin of exoproteaseproducing cells in the Bacillus subtilis biofilm Victoria L. Marlow, 1 Francesca R. Cianfanelli, 1 Michael Porter,
More informationSupplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
More informationHOUR EXAM I BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam.
Name First Last (Please Print) PID Number - HOUR EXAM I BIOLOGY 422 FALL, 2011 In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. 1 Signature 2 3 4 5 6
More informationInside the Burch Lab: E. Coli and Triclosan Resistance. By: Pamela Lammonds
Inside the Burch Lab: E. Coli and Triclosan Resistance By: Pamela Lammonds Purpose and Goals of Research Concerns over infectious disease have risen in the past few years. In response to this concern,
More informationSolutions to 7.02 Quiz III
Solutions to 7.02 Quiz III Class Average = 79 Standard Deviation = 12 Range Grade % 85-100 A 40 72-84 B 37 55-71 C 20 > 54 D/F 3 Question 1 On day 1 of the genetics lab, the entire 7.02 class did a transposon
More informationSupplementary Information. for. How Escherichia coli lands and forms cell clusters on a surface: a new role of surface. topography
Supplementary Information for How Escherichia coli lands and forms cell clusters on a surface: a new role of surface topography Huan Gu 1, 2, *, Aaron Chen 1, 2, *,, Xinran Song 1, 2, Megan E. Brasch 1,2,
More informationSUPPLEMENTAL MATERIAL. Plasmid construction
SUPPLEMENTAL MATERIAL Plasmid construction pkm288 [dnax-yfp (phleo)] was generated by subcloning an EcoRI-PstI fragment (dnax-yfp) from pkl183 (Lemon and Grossman, 1998) into pdt2. pdt2 is a puc19 derivative
More informationDynamic map of protein interactions in the Escherichia coli chemotaxis pathway. Attractant exchange profile during kinetics measurements.
Supplementary data Dynamic map of protein interactions in the Escherichia coli chemotaxis pathway David Kentner, Victor Sourjik Table of content: Figure S1 Figure S2 Figure S3 Table SI Microscopy setups
More informationOptimizing Bacterial Adhesion to a Microfluidic Platform for Monitoring Bacterial Biofilm Growth
Optimizing Bacterial Adhesion to a Microfluidic Platform for Monitoring Bacterial Biofilm Growth Aaron Cheng August 6th, 2010 Mentors: Mariana Meyer, Peter Dykstra Professor Reza Ghodssi Bacterial Quorum
More informationptka epsb Figure S1. The PtkA kinase contributes to EPS production Shown is colony wrinkling on biofilm-inducing medium for strains NCBI 3610
Figure S1 WT epsab ptka ptka epsb Figure S1. The PtkA kinase contributes to EPS production Shown is colony wrinkling on biofilm-inducing medium for strains NCBI 3610 (WT), BAE252 ( epsab), YC176 ( ptka),
More information7.02 Microbial Genetics in Lab Quiz. Fall, September 27, 2001 ANSWER KEY
7.02 Microbial Genetics in Lab Quiz Fall, 2001 September 27, 2001 ANSWER KEY This quiz contains 4 questions worth a total of 48 points. Be sure to write your name, Bench letter and Undergraduate TA s (UTA)
More informationStacy L. Hrizo and Nancy Kaufmann From the Department of Biological Sciences, University of Pittsburgh, Pittsburgh, Pennsylvania 15260
Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 3, pp. 164 169, 2009 Laboratory Exercises Illuminating Cell Signaling:
More informationAminoacid change in chromophore. PIN3::PIN3-GFP GFP S65 (no change) (5.9) (Kneen et al., 1998)
Supplemental Table. Table S1. Fluorophore characteristics of used fluorescent proteins, Related to Figure 2 and 3. Transgenic line Fluprescent marker Aminoacid change in chromophore pk(a) Ref. PIN3::PIN3-GFP
More informationAntibiotic effects on yqfa protein function in Escherichia coli metabolism
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2016 Antibiotic effects on yqfa
More informationProbing phenotypic growth in expanding Bacillus subtilis biofilms
Appl Microbiol Biotechnol (2016) 100:4607 4615 DOI 10.1007/s00253-016-7461-4 METHODS AND PROTOCOLS Probing phenotypic growth in expanding Bacillus subtilis biofilms Xiaoling Wang 1,2 & Stephan A. Koehler
More informationSupplemental Data. Sentandreu et al. (2011). Plant Cell /tpc
SUPPLEMENTAL ANALYSIS 1. Definition of the PIF3-regulated transcriptome in the dark. We applied an ANOVA approach using the Rosetta Resolver platform to look for genes whose expression was statistically
More informationBIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off
BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When
More informationDesigning and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive
Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are
More informationConfirming the Phenotypes of E. coli Strains
Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond
More informationSUPPLEMENTAL MATERIAL FOR. Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important
SUPPLEMENTAL MATERIAL FOR Nutrient-regulated Proteolysis of MrpC Halts Expression of Genes Important for Commitment to Sporulation during Myxococcus xanthus Development Ramya Rajagopalan and Lee Kroos
More informationAntagonism of Two Plant-Growth Promoting Bacillus velezensis Isolates. Against Ralstonia solanacearum and Fusarium oxysporum
1 2 Antagonism of Two Plant-Growth Promoting Bacillus velezensis Isolates Against Ralstonia solanacearum and Fusarium oxysporum 3 4 5 Yu Cao 1, Hualiang Pi 2, Pete Chandrangsu 2, Yongtao Li 1, Yuqi Wang
More informationBi 1x Spring 2016: LacI Titration
Bi 1x Spring 2016: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationBIOLOGY. Bacteria Growth Lab. Bacterial Growth. Slide 2 / 61. Slide 1 / 61. Slide 4 / 61. Slide 3 / 61. Slide 5 / 61. Slide 6 / 61
Slide 1 / 61 Slide 2 / 61 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of
More information7.03 Final Exam. TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young
7.03 Final Exam Name: TA: Alex Bagley Alice Chi Dave Harris Max Juchheim Doug Mills Rishi Puram Bethany Redding Nate Young Section time: There are 13 pages including this cover page Please write your name
More informationSupplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
More informationChapter 6: Microbial Growth
Chapter 6: Microbial Growth 1. Requirements for Growth 2. Culturing Microorganisms 3. Patterns of Microbial Growth 1. Requirements for Growth Factors that affect Microbial Growth Microbial growth depends
More informationSupplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
More informationSupplementary Information: The timing of transcriptional regulation in synthetic gene circuits. Corresponding author.
Supplementary Information: The timing of transcriptional regulation in synthetic gene circuits Yu-Yu Cheng 1, Andrew J. Hirning 1, Krešimir Josić 1,2,3, and Matthew R. Bennett 1,4, 1 Department of Biosciences,
More informationSupplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments
Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments Supplementary Table S1 Complete data set for ccamk-13snf2 and hit1snf1 experiments Supplementary Table S2 M. loti
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationLab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab
Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab OBJECTIVES 1. Understand the use of MPN to determine likely fecal water contamination. 2. Understand the use of MUG,
More informationSupplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
More informationRequirement for a Functional int Product in Temperature Inductions of
JOURNAL OF VIROLOGY, SePt. 1970, p. 320-325 Vol. 6, No. 3 Copyright 1970 American Society for Microbiology Prinited in U.S.A. Requirement for a Functional int Product in Temperature Inductions of Prophage
More informationHowever, only a fraction of these genes are transcribed in an individual cell at any given time.
All cells in an organism contain the same set of genes. However, only a fraction of these genes are transcribed in an individual cell at any given time. It is the pattern of gene expression that determines
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationStalled antibiotics development. A solved problem No new classes of antibiotics for 30 years
Stalled antibiotics development A solved problem No new classes of antibiotics for 30 years Stalled antibiotics development A solved problem No new classes of antibiotics for 30 years Walsh & Fischbach
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
More informationEffect of mutations in the outer membrane components on bacteriophage T4 adsorption to Escherichia coli
Effect of mutations in the outer membrane components on bacteriophage T4 adsorption to Escherichia coli ALICE WANG AND KEVIN LIN Department of Microbiology and Immunology, UBC Esherichia coli strains with
More informationSupplementary Figure 1. Determination of the purity of CP. a, SDS-PAGE of CP and CP- PTX conjugate, and b, HPLC trace of purified CP.
Supplementary Figure 1. Determination of the purity of CP. a, SDS-PAGE of CP and CP- PTX conjugate, and b, HPLC trace of purified CP. Supplementary Figure 2. Synthesis of CP-PTX conjugate. Supplementary
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSupplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationBiology 2250 Transformation laboratory
Biology 2250 Transformation laboratory Prior to lab: Discuss how to use micropipettes. Discuss how to use microcentrifuge balance. Discuss how to spread bacteria with alcohol and glass rods. Bacteria are
More informationGenetics Lecture Notes Lectures 13 16
Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
More informationENVIRONMENTAL PARAMETERS OF GROWTH
ENVIRONMENTAL PARAMETERS OF GROWTH The growth and survival of microorganisms are affected by the chemical and physical conditions of the external environment. Environmental factors which have significant
More informationNotch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling
More informationThank you and good morning.
Thank you and good morning. 1 I have no conflicts of interest to disclose. 2 I m going to speak today about basic science research into group B strep virulence. GBS remains an important cause of neonatal
More informationAD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
More informationGenomic DNA Mini Kit (Blood/Cultured Cell) For research use only
Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only Sample : up to 300 µl of whole blood, up to 200 µl of frozen blood, up to 200 µl of buffy coat, cultured animal cells (up to 1 x 107), 9
More informationMinimal Bactericidal Concentration for Biofilms (MBC-B) Nicole Billings and Katharina Ribbeck *
Minimal Bactericidal Concentration for Biofilms (MBC-B) Nicole Billings and Katharina Ribbeck * Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA *For correspondence:
More informationThe Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae
Letters in General Microbiology The Effect of Bioaugmented Soil on the Pathogenicity of Pseudomonas syringae Rachel Sohn, Melissa Kane and Michelle Wong Department of Biology, Rutgers University, Camden
More informationChapter 9 Microbial Genetics
Chapter 9 Microbial Genetics You are expected to know details of 1) DNA replication 2) RNA synthesis (transcription) 3) Protein synthesis (translation) Genome & Genes A genome is all the genetic information
More informationSupporting information
Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),
More informationPhenotype MicroArrays: A Platform for Phenotypic Characterization of Cells and Species Description
Stacy O. Montgomery, Ph.D. ICCC12 Florianopolis Brazil 30 Sept. 2010 smontgomery@biolog.com Phenotype MicroArrays: A Platform for Phenotypic Characterization of Cells and Species Description Agenda Microbial
More informationIsolation and screening of pyocyanin producing Pseudomonas spp. from soil
Int. J. Adv. Res. Biol. Sci. (2017). 4(4): 147-152 International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 4, Issue
More informationSI Results Peculiarities in the consumption of ammonium and glucose by AmtB- strains SI Materials and Methods Strain Construction
SI Results Peculiarities in the consumption of ammonium and glucose by AmtB - strains. The AmtB - strain failed to consume all the ammonium in the medium under NH 3 -limiting conditions (.5 mm total ammonium
More informationPearson Education Limited Edinburgh Gate Harlow Essex CM20 2JE England and Associated Companies throughout the world
Pearson Education Limited Edinburgh Gate Harlow Essex CM20 2JE England and Associated Companies throughout the world Visit us on the World Wide Web at: www.pearsoned.co.uk Pearson Education Limited 2014
More informationMcbio 316: Exam 3. (10) 2. Compare and contrast operon vs gene fusions.
Mcbio 316: Exam 3 Name (15) 1. Transposons provide useful tools for genetic analysis. List 5 different uses of transposon insertions. ANSWER: Many answers are possible, however, if multiple items on the
More information7.02/ Microbial Genetics Exam Study Questions
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 7.02/10.702 Microbial Genetics Exam Study Questions These questions adapted from old exam questions--are
More informationSupplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
More informationAutophagy induction [h]
A SD-N [h]: SD-N [h]: 1 2 4 1 2 4 1 2 4 -GFP 1 2 4 percentage GFP-Atg8 [%] 1 9 8 7 6 5 4 3 2 1 1 2 4 Autophagy induction [h] -13xmyc SD-N [h]: 1 2 4 -GFP -13xmyc 1 prape1 mape1 - - GFP - 13xmyc mape1 [%]
More information7.02/ Genetics Exam Study Questions Spring The exam will be: Thursday, April 27 th, :05-11:55 AM Walker Gym, 3 rd floor (50-340)
7.02/10.702 Genetics Exam Study Questions Spring 2006 Annoucements: The exam will be: Thursday, April 27 th, 2006 11:05-11:55 AM Walker Gym, 3 rd floor (50-340) Please note that these practice questions
More informationSupplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native
Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native Ag43 phase variation depends on Ag43, motility, chemotaxis and AI-2 sensing. Cells were grown to OD600 of 0.6 at 37 C and aggregation
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationSupplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato
Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty
More informationCHAPTER 5 SUMMARY AND CONCLUSION. 188 P a g e
CHAPTER 5 SUMMARY AND CONCLUSION 188 P a g e Deinococcus radiodurans R1 exhibits an extraordinary tolerance to various abiotic stresses including radiations and desiccation. The amazing radioresistance
More informationHampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis
Richter et al. BMC Evolutionary Biology (2018) 18:155 https://doi.org/10.1186/s12862-018-1266-2 RESEARCH ARTICLE Hampered motility promotes the evolution of wrinkly phenotype in Bacillus subtilis Anne
More informationFORMULATION OF BACTERIAL CONSORTIA AND STUDYING THEIR SYNERGISTIC EFFECT ON TREATMENT OF EFFLUENT
CHAPTER 5 FORMULATION OF BACTERIAL CONSORTIA AND STUDYING THEIR SYNERGISTIC EFFECT ON TREATMENT OF EFFLUENT 5.1. Introduction Based on the biodegradability, the industrial pollutants have been classified
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationSeveral Aspects of Microbial Technology for Food Pasteurization and Sterilization
, Vol. 10, No. 4, pp. 183-190, Dec. 2009 Several Aspects of Microbial Technology for Food Pasteurization and Sterilization Tetsuaki TSUCHIDO Department of Life Science and Biotechnology, Faculty of Chemistry,
More informationIsolation and Characterization of Two Antibiotic-Producing Bacteria
Isolation and Characterization of Two Antibiotic-Producing Bacteria Madeline Gibson Abstract The discovery of antibiotics with novel mechanisms has plateaued in the last twenty years. As antibiotics are
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationGene disruption and construction of C-terminally tagged strains
Supplementary information Supplementary Methods Gene disruption and construction of C-terminally tagged strains A PCR-based gene targeting method (Bähler et al., 1998; Sato et al., 2005) was used for constructing
More informationCopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution
CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution Cat. Nos. C400EL10, C400CH10, and CIS40025 Available exclusively thru Lucigen. lucigen.com/epibio
More information