Introduction. Lance Martin, BIOFAB Operations
|
|
|
- Jonathan Gray
- 6 years ago
- Views:
Transcription
1 Introduction Lance Martin, BIOFAB Operations
2 Several capacities needed to support EOU engineering Design Libraries Feature 1 Variants Feature 2 Variants Assemble Clone Assay Analyze Feature 1 Feature 2 Repeat
3 Core capacities map onto workflow Design Assemble Clone Assay and Analyze Data
4 Design : EOU assembly strategy Part < 250 bases NO SLIC Gibson CPEC / GG / Bio-Brick CPEC / GG / Bio-brick (No SLIC / Gibson) If (combinatorial library) && (junctions < 25 bp) NO CPEC / GG / Bio-Brick GG / Bio-Brick (No CPEC) Want scar flexibility and multipart cloning? NO Bio-Brick / GG Promoter RBS Golden gate (GG) NO (our parts were too long to order as oligo with BsaI sites) 1) Cost effective Embed in primers? Promoter NO (our parts were too long) Primer + Bsa! sites adds > 40 bases Order oligos, clone, PCR amplify full part NO (too short) Parts often too small for PCR 2) Scarless assembly 3) One-plot multi-insert cloning Anneal and clone oligos with compatible junctions 4) Good for combinatorial libraries Nathan Hillso (JBEI)
5 Design : strategy for scarless combinatorial assembly Promoter Ins 5ʻUTR PCR GGTCTCAATGA CCAGAGTTACT 5ʻUTR Ins CTATTGAGACC ATAGACTCTGG BsaI Digest 5ʻUTR Ins Promoter Library (N) Ins 5ʻUTR x N
6 Design : developed software tools to automate design tasks Feature Library 1 ) Automated and batch oligo and junction design Oligo Library Vector Library 2 ) Simulate PCR, digest, junction verification, ligation 5ʻUTR Ins Ins 3 ) Batch vector map output 5ʻUTR x N Wes Whitaker (UCB), Jenhan Tao (UCB)
7 Design and Cloning : integrated software into workflow Vector file 14 Promoter & 12 RBS Sequences 1. Automate design of 52 (fwd and rev) oligo sequences with specified junctions 2. Automate junction checking for 168 planned assemblies and generation of all vector files Vector Design Assembly OK? If NO, Re-plan Order Oligos Base Vector Anneal Cut Ligate + Clones 3. Automate check of hundreds of sequencing traces against user-specified vector files Sequence? Pick Transform, Plate
8 Assay and Analysis : plate reader, cytometer, HTG Analysis
9 Protocols in operations manual, packaging all software. Plan to make these tools and methods available.
10 Current Future Manual cloning workflow with some robotic automation More automated cloning workflow
11 Future : High-throughput oligo (or full library) synthesis with automated oligo preparation (phosphorylation / annealing)
12 Future : Automated combinatorial fluid handling (e.g., for ligation of combinatorial library into PCR product) Oligo Library Library Vector 5ʻUTR Ins
13 Future : Accelerate cloning (e.g., next-gen sequencing and ufluidics to screen and cherry-pick from complex ligation mix?)
14 Current Future Modest feature library sizes with no functional pre-screening Highly multiplexed in vitro screening of large feature libraries prior to in vivo characterization
15 Future : In vitro systems for screening components 1) In vitro transcription / translation (P. Carr, D. Kong) 2) Characterization of sequence features (e.g., bar-seq for multiplexed expression readout for library of thousands of features)
16 Current Future Feature libraries for constitutive expression Libraries of sensor features
17 Future : Expanding scope of EOU to include inducible promoters and post-transcriptional controllers Libraries of orthogonal post-transcriptional (5ʼ UTR) controllers Riboregulator w/ tarna repression Aptamer + trans-active riboregulator shrna libraries (in microbes) Characterized Libraries Aptamer + ribozyme Aptamer + ribozyme for signal integration
18 Future : In vitro measurement of component bio-physical parameters to aid the design of new regulatory features Tools for measuring protein (e.g., transcription factor) and DNA interactions ; may be used to aid functional characterization of new transcription factors
19 Current Future Conventional cloning (e.g., Top10)and assay strains (BW25113) Engineered chassis
20 Future : Engineering host cell context in order to improve predictable function of EOU Genome engineering and / or deploying orthogonal gene expression architecture (e.g., a virtual machine) in order to improve predictable performance of the EOU
21 Current Future 96 well plate ; plate reader and flow cytometer Chemostat for multiplexed assays and addressable environmental control ; methods for transcript quantification
22 Future : Measurement context with environmental control (e.g., for characterization of transfer function for EOU)
23 Future : Measurement tools for transcript quantification (e.g., HTG, ncounter, qpcr, Fluidigm parallelized qpcr, etc.) Systems for high-throughput transcript quantification (e.g. qpcr)
BIOFAB Operations Manual
BIOFAB Operations Manual Lance Martin BIOFAB (Dated: July 20, 2010) The long-term goal of the BIOFAB is to engineer libraries of Central Dogma (C-Dog) regulatory features that can encode predictable levels
Building DNA Libraries to Explore the Combinatorial Design Space. Dr. Yifan Li Senior Scientist GenScript USA Inc.
Building DNA Libraries to Explore the Combinatorial Design Space Dr. Yifan Li Senior Scientist GenScript USA Inc. Outline Combinatorial Optimization for Metabolic Pathway Engineering Case Studies for Combinatorial
Supplementary Information
Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.
DNA Matters Constructing Genes, Enzymes and Pathways by the Plate
DNA Matters Constructing Genes, Enzymes and Pathways by the Plate Leda Notchey May 19, 2015 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
Molecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
j5: DNA assembly design automation
j5: DNA assembly design automation Nathan J. Hillson njhillson@lbl.gov BIOEN Workshop on Synthetic Biology October 26, 2010 The DNA assembly goal Biofuel metabolic pathway: OrfA OrfB OrfC OrfD OrfE Metabolic
Supplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
Automated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Sequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
BBF RFC 28: A method for combinatorial multi-part assembly based on the Type IIs restriction enzyme AarI
BBF RFC 28: A method for combinatorial multi-part assembly based on the Type IIs restriction enzyme AarI Sergio G. Peisajovich, Andrew Horwitz, Oliver Hoeller, Benjamin Rhau & Wendell Lim 16 September
Next-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
Building with DNA 2. Andrew Tolonen Genoscope et l'université d'évry 08 october atolonen at
Building with DNA 2 Andrew Tolonen Genoscope et l'université d'évry 08 october 2014 atolonen at genoscope.cns.fr @andrew_tolonen www.tolonenlab.org Yesterday we talked about ways to assemble DNA building
Supplementary Material for StairSTEPS Manuscript
Supplementary Material for StairSTEPS Manuscript S1. Supplementary Materials and Methods S1.1 Plasmid vector construction All plasmids for expression of dcas9 were derived from the pjed103 vector series
Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014
Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?
Gene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
TBRT Meeting April 2018 Scott Weigel Sales Director
TBRT Meeting April 2018 Scott Weigel Sales Director About Us AgriPlex Genomics was formed in 2014 with the goal of creating a platform for targeted sequencing and genotyping in large numbers of samples.
Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors
Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram
G E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation
Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation The Lexogen QuantSeq 3 mrna-seq Library Prep Kits for Illumina (FWD and REV) produce ready-to-sequence libraries
A protocol for the assembly of 2 or 3 sgrnas. Table of contents
A protocol for the assembly of 2 or 3 sgrnas Table of contents Simplified protocol... 2 Table 1 Nomenclature of PCR products/primers... 3 Table 2 Structure features of primers... 3 Sequence of DT1T2-PCR
Recombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
Rapid, Accurate and Flexible DNA Quantitation Using the QuantiFluor dsdna System on the MANTIS Liquid Handler
Rapid, Accurate and Flexible DNA Quantitation Using the QuantiFluor dsdna System on the MANTIS Liquid Handler Materials Required MANTIS Instrument (Formulatrix) High Volume Chips (Formulatrix Cat.# MCHS6)
pdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
Chapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors
Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors A Vector GR1 SacI BamHI CTCTGGCTAACTAGGC Insert 5/7nt - G TCGAGAGACCGATTGATCCG Insert 5/7nt - CCTAG 1 G CAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC
Supplemental information Precise A T to G C base editing in the rice genome
Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base
Impact of gdna Integrity on the Outcome of DNA Methylation Studies
Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Data Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
V Fig.2: A Individual genes
The ACEMBL - flexbac-ec Kit - A VERSATILE AND CONVENIENT DONOR - ACCEPTOR BASED ASSEMBLY CLONING AND RECOMBINEERING SYSTEM FOR MULTI-GENE EXPRESSION IN E. COLI Multiplex expression of proteins are one
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
Next-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
Recombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training
Training: Ion S5 and S5 XL Systems workflow training This interactive course focuses on the Ion S5 and Ion S5 XL Systems operation and the Ion AmpliSeq workflow on the Ion Chef System for sequencing. The
REPORT DOCUMENTATION PAGE
REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions,
Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
DEFY THE LAW OF AVERAGES. Single-Cell Targeted Gene Expression Analysis
DEFY THE LAW OF AVERAGES Single-Cell Targeted Gene Expression Analysis SINGLE-CELL ANALYSIS THAT DEFIES THE LAW OF AVERAGES GET ACCURATE, RELIABLE GENE EXPRESSION DATA WITH THE FLUIDIGM SINGLE-CELL WORKFLOW
Yeast 2-Hybrid Kayla Nygaard
Yeast 2-Hybrid 2.26.18 Kayla Nygaard Y2H - What is it? A method to screen for protein-protein interactions in yeast Capitalizes on GAL4 system in yeast. GAL4 has 2 domains DNA-Binding Domain (DB) Transcriptional
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Golden Gate TALEN assembly
Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18
Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do
Document S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
Nanopore sequencing How it works
1 Nanopore sequencing How it works Nanopore Reader DNA or RNA passes through a nano-scale hole. The fluctuations in current as it passes through are used to understand the DNA or RNA sequence. An electrically
Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
TECH NOTE SMARTer T-cell receptor profiling in single cells
TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells
PLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
Supplementary Protocol: CIRCLE-seq Library Preparation
Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation
Supplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
Single-Cell. Defy the Law of Averages
Single-Cell AnalysiS Defy the Law of Averages An entirely new approach Single-Cell AnalysiS that Defies the Law of Averages Get Accurate, Reliable Gene expression Data with the fluidigm Single-Cell Workflow
Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
Tutorial. In Silico Cloning. Sample to Insight. March 31, 2016
In Silico Cloning March 31, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com In Silico Cloning
Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
Genome Biology and Biotechnology
Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
Molecular Cloning TECHNICAL GUIDE
Molecular Cloning TECHNICL GUIDE 2 OVERVIEW Molecular Cloning Overview Molecular cloning refers to the process by which recombinant DN molecules are produced and transformed into a host organism, where
dbcamplicons pipeline Amplicons
dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:
Next Generation Sequencing Method for Illumina TruSeq DNA Sample Preparation Protocol on the Hamilton STAR
Next Generation Sequencing Method for Illumina TruSeq DNA Sample Preparation Protocol on the Hamilton STAR Authors Lance Larka 1, Bret Martin 2, Bronson Duck 2, Navjot Kaur 2, Bobby Chavli 2, 1 Oblique
Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
an innovation in high throughput single cell profiling
an innovation in high throughput single cell profiling www.dolomite-bio.com Why use high throughput single cell profiling? Techniques such as high throughput scrna-seq (single cell RNA sequencing) offer
Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
Lecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
XXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
dbcamplicons pipeline Amplicons
dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:
Supplementary Figure 1
Supplementary Figure 1 CITE-seq library preparation. (a) Illustration of the DNA-barcoded antibodies used in CITE-seq. (b) Antibody-oligonucleotide complexes appear as a high-molecular-weight smear when
NZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
Successful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation
DISTRIBUTION A. Approved for public release: distribution unlimited.
Contract No.: HR0011-13-C-0073 Institution: Title: SYNTHETIC GENOMICS, INC. DIGITAL BIOLOGICAL CONVERTER MILESTONE ACCEPTANCE REPORT Date of Report: 03 January 2014 DARPA Program Manager: Alicia Jackson
Nature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
Supporting Information. Sequence Independent Cloning and Posttranslational. Enzymatic Ligation
Supporting Information Sequence Independent Cloning and Posttranslational Modification of Repetitive Protein Polymers through Sortase and Sfp-mediated Enzymatic Ligation Wolfgang Ott,,, Thomas Nicolaus,,
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 1.1 July 2014 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and
Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
Enzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
RFC 38: Building Blocks - Standard Large DNA/Genome Construction. Jef Boeke, James DiCarlo. 7 October 2009
RFC 38: Building Blocks - Standard Large DNA/Genome Construction Jef Boeke, James DiCarlo 7 October 2009 1. Purpose The physical assembly of standard parts is currently a non-standard process, which can
Organization of the libraries. For PCR screening
Organization of the libraries For PCR screening Recall : Construction of a library (YAC and BAC) Genomic DNA Vector BAC YAC restriction enzyme digestion + PFGE BAC YAC ligation transformation Host-cells
Microarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
AAV vectors for gene therapy. Any Gene to Any Cell
AAV vectors for gene therapy Any Gene to Any Cell % Population WHY WORK WITH SIRION? OVERCOME MAJOR ROAD BLOCKS IN AAV GENE THERAPY Invent improved AAV vectors with optimized transduction and expression
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
Ligation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
Synthetic Biological Systems
Synthetic Biological Systems 2. Synthetic Life and Genome Engineering 27/05/2010 Dr Tom Ellis 1 The construction of synthetic organisms Synthesising biological life will be a 21 st Century Grand Challenge