Supplemental information Precise A T to G C base editing in the rice genome
|
|
|
- Claud Morrison
- 5 years ago
- Views:
Transcription
1 Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base editing lines (SG1-7 and SG1-15) containing prabesp-osu6 with sgrna1. Supplemental Figure 2. prabesp-osu6 can be used for multiplex base editing in rice. Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by prabesa-osu6sa. Supplemental Table 1. Base editing activity window for ABE-P1. Supplemental Table 2. Base editing frequency at potential off-target sites of sgrna1. Supplemental Table 3. Base editing activity window for ABE-P2. Supplemental Table 4. Base editing frequency at potential off-target sites of sgrna4. Supplemental Table 5. Primers used in this study. Supplemental Materials and Methods Supplemental References
2 Supplemental Figure 1. TA cloning results of two base editing lines (SG1-7 and SG1-15) containing prabesp-osu6 with sgrna1. Twenty clones from each line were randomly selected for sequencing. Representative sequence chromatograms for each genotype are shown. Arrows point to the positions with edited base.
3 Supplemental Figure 2. prabesp-osu6 can be used for multiplex base editing in rice. (A) sgrna3 was designed for simultaneous editing of three genes in the rice genome. The OsmiR156 binding sites in the three genes are highlighted in red. (B) Representative sequence chromatograms at the target sites are shown. Note that in lines SG3-11 and SG3-12, the target sites in OsSPL16 and OsSPL18 were
4 simultaneously edited. Arrows point to the positions with edited base. Supplemental Figure 3. Multiplex base editing at OsSPL16 and OsSPL18 by prabesa-osu6sa. (A) The sgrna5 was designed for simultaneous editing of OsSPL16 and OsSPL18. (B) Representative sequence chromatograms for the two
5 target sites in three transgenic lines, SG5-7, SG5-18, and SG5-44. Both target genes were edited in the three lines. Arrows point to the positions with edited base. Supplemental Table 1. Base editing activity window for ABE-P1 sgrna Target Line number Baseediting position Editing form sgrna1 OsSPL14 SG1-11, SG T-C conversion SG1-10, SG1-15 5,7 T-C conversion SG1-7, SG1-23 5,10 T-C conversion sgrna2 SLR1 SG2-4, SG2-18, SG2-19, SG2-26, SG T-C conversion sgrna3 OsSPL16 SG3-3, SG3-11, SG3-12, SG T-C conversion OsSPL18 SG3-11, SG T-C conversion SG3-15 7,9 T-C conversion SG3-19 5,7 T-C conversion LOC_Os02g24720 SG3-6 5 T-C conversion Note: Base editing position was counted from the PAM-distal end, scoring the PAM as positions Supplementary Table 2. Base editing frequency at potential off-target sites of sgrna1 Site Chromosome Position Guide-PAM sequence Mismatch numbers Editing efficiency On target AGAGAGAGCACAGCTCGAGTCGG 0 26% Off-target AGAGAGAGCACAGCTgGAGTCGG 1 0 Off-target tgatcgggcacagctcgcgtcgg 5 0 Off-target AGAaAGAGCAtgGgTCGAGTCGG 4 0 Off-target AGAGtGAGCACAGCggGAGaCGG 4 0 Off-target ggagagcgcgcggctcgaggcgg 5 0 Off-target AGAGtGtGCAgAGtTCGAGTCGG 4 0 Off-target AGAGAGAGCtCgGCTCGgcTCGG 4 0 Off-target AGAGAGAtCtCAGaTCGAGgCGG 4 0 Off-target AGAcAGAGCACAGCaaGAaTCGG 4 0 Note: Nucleotides of the PAM sequence are written in bold, and the mismatch bases in potential off-targets are shown in lowercase. Supplementary Table 3. Base editing activity window for ABE-P2 sgrna Target Line number Base editing position Editing form sgrna4 OsSPL14 SG4-6, SG4-11, SG T-C conversion SG4-2, SG4-5, SG4-17, SG T-C conversion SG4-4 6, 10 T-C conversion SG4-1, SG4-24, SG4-27 8, 10 T-C conversion SG4-7, SG4-10 6, 8, 10 T-C conversion SG , 12 T-C conversion OsSPL17 SG4-2, SG4-7 8 T-C conversion
6 SG T-C conversion SG4-12, SG T-C conversion SG4-1, SG4-5, SG4-6, SG4-10, SG4-16, 8, 10 T-C conversion SG4-18, SG4-24, SG4-26 SG4-11, SG4-19 8, 10, 12 T-C conversion SG4-27 8, 10,14 T-C conversion SG-3 6, 10, 12, 14 T-C conversion SG17, SG4-25 8, 10, 12, 14 T-C conversion sgrna5 OsSPL16 SG5-18, SG5-30, SG T-C conversion SG5-7, SG5-23, SG5-32, SG5-33, SG T-C conversion OsSPL18 SG5-18, SG5-21, SG5-29, SG5-37, SG5-38, SG5-40, SG5-44, SG T-C conversion SG5-7 10, 12 T-C conversion SG5-23 8, 10, 12 T-C conversion SG , 12, 14 T-C conversion Note: Base editing position was counted from the PAM-distal end, scoring the PAM as positions Supplemental Table 4. Base editing frequency at potential off-target sites of sgrna4 Site Chromosome Position Guide-PAM sequence Mismatch numbers Editing efficiency On target ACAGAAGAGAGAGAGCACAGCTCGAGT % On target ACAGAAGAGAGAGAGCACAGCTGGAGT % Off-target ACAGAAGAGAGAGAGCACAat CGGAGT 2 0 Off-target ACAGAAGAGAGAGAGCACAct CCGGGT 2 0 Off-target ACAGAAGAGAGAGAGCACAct CCGGGT 2 0 Off-target ACgGAAGAGAaAGAGCAtgGg TCGAGT 5 0 Note: Nucleotides of PAM sequence are written in bold, and the mismatch bases in potential off-targets are shown in lowercase. Supplemental Table 5. Primers used in this study Primer name Primer sequence 5-3 Purpose sgrna1-f TGTGAGAGAGAGCACAGCTCGAGT sgrna1vector construction sgrna1-r AAACACTCGAGCTGTGCTCTCTCT sgrna2-f sgrna2-r sgrna3-f sgrna3-r sgrna4-f sgrna4-r sgrna5-f sgrna5-r TGTGAGTGCACGGTGTCCGTGGCC AAACGGCCACGGACACCGTGCACT TGTGCAGAAGAGAGAGAGCACAAT AAACATTGTGCTCTCTCTCTTCTG TGTGTGACAGAAGAGAGAGAGCACAGC AAACGCTGTGCTCTCTCTCTTCTGTCA TGTGTGACAGAAGAGAGAGAGCACAAT AAACATTGTGCTCTCTCTCTTCTGTCA sgrna2 vector construction sgrna3 vector construction sgrna4 vector construction sgrna5 vector construction
7 SPL14-seq-F SPL14-seq-R SLR-seq-F SLR-seq-R SPL16-seq-F SPL16-seq-R 02G-seq-F 02G-seq-R SPL17-seq-F SPL17-seq-R SPL18-seq-F SPL18-seq-R sgrna1m1-f sgrna1m1-r sgrna1m2-f sgrna1m2-r sgrna1m3-f sgrna1m3-r sgrna1m4-f sgrna1m4-r sgrna1m5-f sgrna1m5-r sgrna1m6-f sgrna1m6-r sgrna1m7-f sgrna1m7-r sgrna1m8-f sgrna1m8-r sgrna1m9-f sgrna1m9-r sgrna4m1-f sgrna4m1-r sgrna4m2-f sgrna4m2-r sgrna4m3-f sgrna4m3-r sgrna4m4-f sgrna4m4-r AGGGTTCCAAGCAGCGTAAGGA TGGTGCTGGGGCTGGACCGTTC GCGCAATTATTACTAGCTATAGC AGCCGTCGCCACCACCGGTAAGG CAGCTGCTGCTGCTGCTTCAGTGTG ACATCCCATTGTAGTTCATCTCATTG GCCTGCAGGCGGAGGAGTGG AGTTCATCTCATTGTCATTGGA GGACCTCGTTCAGCACAACCC GGGTTCCAAGCAGTGTGAGGGA TGGGATCATCAAATCCGAGGAG CTGTCCATGCTCGGGCAGGCG GGGACCTCGTTCAGCACAACCCC GCAGGTCCAGAAGCTTTGTGGTA TTGCTCCCTAAACAACTCCCAG CCTGGTGCAGAGAGTACAAATG TGCAATGCATCTACTCCCTCAG GATCACACTAGCGACAGCGAGC ACGAGAGCTTCGACTGAACGCA AATCTGCCGCGTGTCAGCAGAG TGCAGGTGGTCGGCGATCGCG AGCGCGCGCAGCTTGGCCT GATCACAACTGCTCGTAAGCTA ATATGTCCTTATCGGACACGAC CCAAACTCTATCTTGAGCCTTC GAGTTCGACGAGGGAGAGAGA ATATTCATAATCCCCCTAGAA CCCCAACGCTTCGCGAATCGCA CAGAGCCTGGACGGGTTCTAC ACAGTACAGCAAATCGCACGT GCAACAAGATGTTCTCCTCCG CTGCCGCCGAACTGCTGCTGC ACACCTGCCAAGAGAATGGCA CCGATAGCTGATCAGAACGC TTGGCATCAGCAGCAGGCAGCA GAACCAGGCTGAGCTGCCGCC TATTATTCGTGCAATGCATCTA ATGCGAGCGGTCTAACCGACGA Genotyping the target sites in OsSPL14 Genotyping the target site in SLR1 Genotyping the target sites in OsSPL16 Genotyping the target site in LOC_Os02g24720 Genotyping the target site in OsSPL17 Genotyping the target sites in OsSPL18 Off target site 1 detection for sgrna1 Off target site 2 detection for sgrna1 Off target site 3 detection for sgrna1 Off target site 4 detection for sgrna1 Off target site 5 detection for sgrna1 Off target site 6 detection for sgrna1 Off target site 7 detection for sgrna1 Off target site 8 detection for sgrna1 Off target site 9 detection for sgrna1 Off target site 1 detection for sgrna4 Off target site 2 detection for sgrna4 Off target site 3 detection for sgrna4 Off target site 4 detection for sgrna4 Materials and methods Vector construction The mammalian codon-optimized wild type E. coli trna adenine deaminase
8 ectada(wt) and its mutated form ectada*(7.10) with a 96 bp linker were synthesized by GENEWIZ (Suzhou, China) as described in Gaudelli et al (Gaudelli et al., 2017). Two AarI sites with appropriate overhangs were added at both ends of edtada(wt) and ectada*(7.10). The vector pcas9(osu6), containing a Cas9 gene driven by the maize ubiquitin promoter, was modified to construct adenine base editing vectors. First, SpCas9 (D10A) nickase and SaCas9 (D10A) nickase flanked by two AarI sites at 5 terminal and VirD2 nuclear localization signal (NLS) at 3 terminal were amplified from pcas9(osu6) and px600 (Addgene, #61592) to replace the Cas9 gene in the pcas9(osu6) vector to form intermediate vectors prsp-osu6 and prsa-osu6, respectively. Then, the edtada(wt) and ectada*(7.10) with 96 bp linker were inserted between two AarI sites of prsp-osu6 and prsa-osu6 by the Golden Gate method, leading to prabesp-osu6 and prabesa-osu6. A fragment comprised of the OsU6 promoter, two BsaI sites and the sgrna scaffold matching SaCas9 was obtained by overlap PCR. Then it was used to replace the OsU6-spsgRNA cassette in prabesp-osu6 to form prabesa-osu6sa. The backbone of the final vectors, prabesp-osu6 and prabesa-osu6sa, contains the hygromycin B phosphotransferase (hpt) gene for transgene selection. The 20 bp (for SpCas9) or 21 bp (for SaCas9) sgrna target sequences were synthesized and annealed on a PCR machine. The annealed oligo adaptors were inserted into the BsaI digested prabesp-osu6 and prabesa-osu6sa vectors. The accuracy of vectors was confirmed by Sanger sequencing. Primers used for vector construction are listed in Supplemental Table 5. Rice transformation All binary vectors were transformed into the A. tumefaciens strain EHA105 by the freeze/thaw method. Transformation of embryogenic calli induced from mature seeds of Nipponbare rice (Oryza sativa L. japonica. cv. Nipponbare) was performed as described previously with minor modifications (Nishimura et al., 2007). Briefly, two days after Agrobacterium infection, calli were transferred onto selection media for one round of selection for two weeks. Then, the resistant calli were directly transferred to regeneration media for shoot regeneration. After the shoots grew to 4-5
9 cm in length, the plantlets were transferred to MS media for root induction. Two weeks later, the plantlets were transplanted to soil pots and grew in a greenhouse under standard conditions (12-h light 28 C and 12-h darkness at 22 C). Genotyping editing events Genomic DNA was extracted from the leaves of all T0 transgenic lines. Each target locus was amplified by PCR and the PCR products were purified for Sanger sequencing. Some PCR sequencing results were further confirmed by TA cloning and sequencing. Base editing ratio was calculated by scoring the number of plants with base editing events divided by the total number of genotyped transgenic lines. Primers for genotyping each target site are shown in Supplemental Table 5. Off-target detection Off-target sites prediction was done by the online tool CRISPR-GE (Xie et al., 2017). Homologous sequences with up to 5 bp mismatches to target sites were listed as potential off-target sites. The potential off-target sites were each amplified from base edited lines for Sanger sequencing. Primers for off-target amplification are listed in Supplemental Table 5. Supplemental References Gaudelli, N.M., Komor, A.C., Rees, H.A., Packer, M.S., Badran, A.H., Bryson, D.I., and Liu, D.R. (2017). Programmable base editing of A T to G C in genomic DNA without DNA cleavage. Nature 551: Nishimura, A., Aichi, I., and Matsuoka, M. (2007). A protocol for Agrobacterium-mediated transformation in rice. Nat. Protoc. 1: Xie, X., Ma, X., Zhu, Q., Zeng, D., Li, G., and Liu, Y.-G. (2017). CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 10:
Expanding the base editing scope in rice by using Cas9 variants. Sciences, Chinese Academy of Sciences, Shanghai , China
PROF. JIAN-KANG ZHU (Orcid ID : 0000-0001-5134-731X) Accepted Article Article type : Research Article Expanding the base editing scope in rice by using Cas9 variants Kai Hua 1,3, Xiaoping Tao 1, Jian-Kang
Supplementary information, Data S1 MATERIALS AND METHODS. Growth of Arabidopsis and rice plants
Supplementary information, Data S1 MATERIALS AND METHODS Growth of Arabidopsis and rice plants Arabidopsis thaliana ecotype Columbia (Col-0) was used in all experiments. Seeds were sown on MS plates and
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2*
Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* 1 Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University,
Supplementary Information
Supplementary Information Generation of inheritable and transgene clean targeted genome-modified rice in later generations using the CRISPR/Cas9 system. Rong-Fang Xu, Hao Li, Rui-Ying Qin, Juan Li, Chun-Hong
Boosting CRISPR/Cas9 multiplex editing capability with the. endogenous trna processing system
Supporting Information Boosting CRISPR/Cas9 multiplex editing capability with the endogenous trna processing system Kabin Xie, Bastian Minkenberg and Yinong Yang Department of Plant Pathology and Environmental
Barley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION High-efficiency TALEN-based gene editing produces disease-resistance rice Ting Li 1, Bo Liu 1, Martin H. Spalding 1, Donald P. Weeks 2, Bing Yang 1 * 1 Department of Genetics,
A universal chassis plasmid pwh34 was first constructed to facilitate the
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction
Protocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
Targeted Protein Degradation
The PITCh dtag vectors for rapid protein degradation of endogenous targets The dissection of complex biological systems requires target-specific control of protein function or abundance. Genetic perturbations
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice
Genetics, Development and Cell Biology Publications Genetics, Development and Cell Biology 9-2014 Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice Martin H.
Gene Editing in Cereals. Emma Wallington
Gene Editing in Cereals Emma Wallington emma.wallington@niab.com NIAB Group NIAB established in 1919 by charitable donations for the improvement of crops.. with higher.. genetic quality A charitable company
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
Data Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the
CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations Changtian Pan 1,2, Lei Ye 1,2, Li Qin 2, Xue Liu 2, Yanjun He 2, Jie wang 2, Lifei
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
Supplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
Supplementary Figure 1
Supplementary Figure 1 Product purity of cytosine base editing for the wheat genomic loci tested. Product distributions and indels frequencies at four representative wheat genomic DNA sites in wheat protoplasts
Supplementary Information
Supplementary Information This Supplementary Information file contains the following contents: Supplementary Methods, Supplementary Discussion, Supplementary Figures (S1~S9), Supplementary Tables (1~3)
Plant Cell, Tissue and Organ Culture
Supplementary materials for Plant Cell, Tissue and Organ Culture Article tile: Agrobacterium mediated Genetic Transformation of Miscanthus sinensis Authors: Ok-Jin Hwang 1, Mi-Ae Cho 1, Yun-Jeong Han 1,
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
Supplementary information
Supplementary information Exploiting the CRISPR/Cas9 System for Targeted Genome Mutagenesis in Petunia Bin Zhang+, Xia Yang+, Chunping Yang, Mingyang Li*, Yulong Guo* Supplementary Table S1 PCR primers
Supplementary Information
Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.
Protocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. Overview SapTrap (Schwartz and Jorgensen,
Allele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors
Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram
Workshop prepared by Dr Nicola Patron_ Head of Synthetic Biology at The Sainsbury Lab, Norwich.
Workshop prepared by Dr Nicola Patron_ Head of Synthetic Biology at The Sainsbury Lab, Norwich. PART 1 SELECTING GUIDES a) The single guide RNA (sgrna) consists of a guide sequence (purple) linked to a
Supplementary Materials. China
Supplementary Materials An Efficient Genotyping Method for Genome-modified Animals and Human Cells Generated with CRISPR/Cas9 System Xiaoxiao Zhu 1,2 *, Yajie Xu 1 *, Shanshan Yu 1 *, Lu Lu 1,2, Mingqin
Construct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
Guangdong Province Key Laboratory of Pharmacodynamic Constituents of TCM and New Drugs Research, Jinan University, Guangzhou, , China
Development of a versatile and conventional technique for gene disruption in filamentous fungi based on CRISPR-Cas9 technology Yan-Mei Zheng, 1, + Fu-Long Lin, 1, + Hao Gao, 1, * Gen Zou, 2 Jiang-Wei Zhang,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Genome-scale engineering of Saccharomyces cerevisiae with single nucleotide precision Zehua Bao, 1 Mohammad HamediRad, 2 Pu Xue, 2 Han Xiao, 1,7 Ipek Tasan, 3 Ran Chao, 2 Jing
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
A protocol for the assembly of 2 or 3 sgrnas. Table of contents
A protocol for the assembly of 2 or 3 sgrnas Table of contents Simplified protocol... 2 Table 1 Nomenclature of PCR products/primers... 3 Table 2 Structure features of primers... 3 Sequence of DT1T2-PCR
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
Applications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
CRISPR AgBio Workshop London Vladimir Nekrasov
CRISPR AgBio Workshop London 2017 Vladimir Nekrasov Applying CRISPR-Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana benthamiana Tomato Barley Arabidopsis thaliana Maize Brassica
3 -end. Sau3A. 3 -end TAA TAA. ~9.1kb SalI TAA. ~12.6kb. HindШ ATG 5,860bp TAA. ~12.7kb
Supplemental Data. Chen et al. (2008). Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. A pcam-cah/cah Sau3A Promoter
Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA
Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
domain. Bottom panel: hybrid surface/ribbon structure (PDB ID: 4UN3) of SpCas9 in complex with sgrna and target DNA. The REC3
Supplementary Figure 1 Yeast screening for high-specificity SpCas9 variants (a) Top panel: scheme of SpCas9 domains. The REC3 domain is part of the recognition lobe. BH: bridge helix. PI: PAM-interacting
SUPPLEMENT MATERIALS FOR CURTIN,
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SUPPLEMENT MATERIALS FOR CURTIN, et al. Validating genome-wide association candidates: Selecting, testing, and characterizing
Chapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes
Rice Science, 2004, 11(3): 81 85 81 http://www.ricescience.info cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes CHEN Xiu-hua 1, LIU Qiao-quan 1,2, WU Hsin-kan 1, WANG Zong-yang 3, GU Ming-hong
Supplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
TALENs and CRISPR/Cas9 for Rice-Genome Editing
TALENs and CRISPR/Cas9 for Rice-Genome Editing Bing Yang Iowa State University Ames, Iowa byang@iastate.edu Rice, Oryza sativa L., is an important staple crop that feeds more than half of the world s population.
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells.
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells. Base editing efficiencies of ABEs with extended sgrnas at Site 18 (a), Site 19 (b), the HBB-E2 site (c), and the HBB-E3
CRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
ProductInformation INTRODUCTION TO THE VECTORETTE SYSTEM
INTRODUCTION TO THE VECTORETTE SYSTEM ProductInformation The following is background information on the Vectorette System, included to familiarize the researcher with the Vectorette Unit and its function
Optimization of Agrobacterium tumefaciens mediated genetic transformation protocol for aromatic rice
J. Bangladesh Agril. Univ. 7(2): 235 240, 2009 ISSN 1810-3030 Optimization of Agrobacterium tumefaciens mediated genetic transformation protocol for aromatic rice M. R. Hossain, L. Hassan, A. K. Patwary
Improved base editor for efficiently inducing genetic variations in rice with CRISPR/ Cas9-guided hyperactive haid mutant
Accepted Manuscript Improved base editor for efficiently inducing genetic variations in rice with CRISPR/ Cas9-guided hyperactive haid mutant Bin Ren, Fang Yan, Yongjie Kuang, Na Li, Dawei Zhang, Xueping
Genetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
CRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced
3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
Supplemental Information
Supplemental Information Improved base editor for efficiently inducing genetic variations in rice with CRISPR/Cas9-guided hyperactive AID mutant Bin Ren, Fang Yan, Yongjie Kuang, Na Li, Dawei Zhang, Xueping
Nature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
Soyeong Jun 1, 3, Hyeonseob Lim 1, 3, Hoon Jang 1, Wookjae Lee 1, Jinwoo Ahn 1, Ji Hyun Lee 2,*, Duhee Bang 1,* Korea
Straightforward Delivery of Linearized Double-stranded DNA Encoding sgrna and Donor DNA for the Generation of Single Nucleotide Variants Based on the CRISPR/Cas9 System Soyeong Jun 1, 3, Hyeonseob Lim
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
Hmgr1 gene integrated Hevea - future GM rubber to the field
Hmgr1 gene integrated Hevea - future GM rubber to the field Jayashree, R., Venkatachalam, P., Thulaseedharan, A., Kala, R.G., Leda, P. and Nazeem, P.A Rubber Research Institute of India, Kottayam 686 009,
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
Molecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
Factors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter SUPPLEMENTARY DATA See Supplementary Sequence File: 1 Supplementary Figure S1: The total protein was extracted from
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
CRISPR/Cas9-mediated viral interference in plants
CRISPR/Cas9mediated viral interference in plants Item Type Article Authors Ali, Zahir; Abulfaraj, Aala A.; Idris, Ali; Ali, Shawkat; Tashkandi, Manal; Mahfouz, Magdy M. Citation CRISPR/Cas9mediated viral
Generation of targeted mutant rice using a CRISPR-Cpf1 system
Plant Biotechnology Journal (2017) 15, pp. 713 717 doi: 10.1111/pbi.12669 Generation of targeted mutant rice using a CRISPR-Cpf1 system Rongfang Xu, Ruiying Qin, Hao Li, Dongdong Li, Li Li, Pengcheng Wei*
CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
Bart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
PLNT2530 (2018) Unit 9. Genome Editing
PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Introduction. Lance Martin, BIOFAB Operations
Introduction Lance Martin, BIOFAB Operations Several capacities needed to support EOU engineering Design Libraries Feature 1 Variants Feature 2 Variants Assemble Clone Assay Analyze Feature 1 Feature 2
Development of High Quality CRISPR/Cas9 Agents
Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled
7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
TYPE IIS MEDIATED PARALLEL DNA ASSEMBLY THE ONE STEP DIGESTION-LIGATION PROTOCOL
TYPE IIS MEDIATED PARALLEL DNA ASSEMBLY THE ONE STEP DIGESTION-LIGATION PROTOCOL 1. REFERENCES Patron et al (2015) Standards for Plant Synthetic Biology: A Common Syntax for Exchange of DNA Parts Patron
Ben- Shahar Lab CRISPR/RMCE Protocol May 2015
Ben- Shahar Lab CRISPR/RMCE Protocol May 2015 1. Before you begin a. Useful CRISPR overview for beginners: https://www.addgene.org/crispr/guide/ b. This protocol combines techniques described in these
File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.
1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly
Multiplex and homologous recombination-mediated plant. genome editing via guide RNA/Cas9
Li et al. 1 Multiplex and homologous recombination-mediated plant genome editing via guide RNA/Cas9 Jian-Feng Li, John Aach, Julie E. Norville, Matthew McCormack, Dandan Zhang, Jenifer Bush, George M.
Supplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)
Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 1.1 July 2014 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and
S1: MATERIALS AND METHODS TALEN
Supplemental File S1: MATERIALS AND METHODS TALEN design and synthesis TALEN target sites within the tomato PRO gene (Solyc11g011260.1) were identified using TAL Effector Nucleotide Targeter (TALE-NT)