Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect

Transcription

1 Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect RESEARCH ARTICLE Bacterial artificial chromosome library construction of root-knot nematode resistant pepper genotype HDA149 and identification of clones linked to Me3 resistant locus GUO Xiao 1*, YANG Xiao-hui 1*, YANG Yu 1*, MAO Zhen-chuan 2, LIU Feng 2, MA Wei-qing 1, XIE Bing-yan 2, LI Guang-cun 1,2 1 Institute of Vegetables and Flowers, Shandong Academy of Agricultural Sciences/Molecular Biology Key Laboratory of Shandong Facility Vegetable, Jinan , P.R.China 2 Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing , P.R.China Abstract Pepper (Capsicum annuum.l) is a widely cultivated vegetable crop worldwide and has the second largest planting area and the first largest vegetable output and value in China. Pepper root-knot nematode (Meloidogyne spp.) is one of the most serious pests of pepper, which caused huge losses every year. Previous studies showed that the Me3 gene is resistant to a wide range of Meloidogyne species, including M. arenaria, M. javanica, and M. incognita. HDA149, a double haploid pepper genotype, harboring the root-knot nematode resistance gene Me3, was used to construct bacterial artificial chromosome library (BAC) via the vector of CopyControl TM pcc1 in this study. The library consists of BAC clones and is equivalent to 5.3 pepper genomes. The average insert size is 95 kb, and most of them are kb. But the empty clones are less than 3%. In order to screen the BAC library easily, 550 super pools with 384 BAC clones of each pool were further developed in this study. Specific primers from Me3 gene locus were used for BAC library screening, and more than 20 positive BAC clones were obtained. Then the selected positive BAC clones were analyzed by restriction enzyme digestion, BAC-end sequencing, marker development, and new positive BAC clones exploration, respectively. Finally, the contig with total length of about 300 kb linked to the Me3 locus was constructed based on chromosome walking strategy, which made a solid foundation for the cloning of the important root-knot nematode resistance gene Me3. Keywords: pepper, bacterial artificial chromosome library (BAC), root-knot nematode, Me3 gene, contig 1. Introduction Received 1 December, 2015 Accepted 23 June, 2016 GUO Xiao, guoxiaogzj@163.com Correspondence XIE Bing-yan, Tel: , Fax: , xiebingyan@caas.cn; LI Guang-cun, Tel: , Fax: , liguangcun@caas.cn * These authors contributed equally to this study. 2016, CAAS. All rights reserved. Published by Elsevier Ltd. doi: /S (16) Pepper (Capsicum annuum. L) is an important vegetable crop in the world, while suffers from several diseases and insect pests. Root-knot nematode (Meloidogyne spp.) is a major plant pathogen causing huge losses to Solanaceous crops every year. Several genes were found to be resistant to nematodes in the wild species and relative species of pepper (Hendy et al. 1985). Two of these genes, Me1 and Me3,

2 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): have been shown to control a wide range of Meloidogyne species, including M. incognita (Mi), M. javanica (Mj), and M. arenaria (Ma), the three major root-knot nematodes, but induced very different response patterns. The resistance response of Me1 is slow, started after the larvae are fixed at the feeding site, mainly occurred in the giant cell formation process, and the resistance will be partially lost at high temperature. While the expression of Me3 occurred in the early stage of root-knot nematode infection, and will produce hypersensitive reaction immediately when the larvae are in contact with root, and still maintain the fully activity even at 42 C (Teresa et al. 1998; Pegard et al. 2005). Therefore, localization and cloning of Me3 gene should have more important application value for the resistance breeding of pepper to root-knot nematode. In pepper, six Me genes clustered in a single genomic region within a 28 cm interval on chromosome P9. Ten markers were used to anchor this cluster, of those one AFLP marker was located 0.9 cm from the Me3 gene (Kruijt et al., 2004; Djian-Caporalino et al., 2007). Later, the Me3 gene was delimited to a interval of two markers SSCP_B322 and EPMS658 with the genetic distance of 0.56 cm and 1.33 cm, respectively (Xu et al. 2011). Pepper has been sequenced and has a big genome of about 3.8 Gb (Kim et al., 2014; Qin et al., 2014), approximately four-fold larger than that of its close relative tomato, which indicated 1 cm may be equal to a big physical distance in pepper genome. So, cloning of functional genes from pepper using classical genetic methods is still very difficult. Genomic library is an important technology platform for the genomics study of various kinds of organisms, and it is also the basis for the analysis of genome structure and function. Bacterial artificial chromosome library (BAC) has advantages of large insert fragments, strong stability and easy operation, which plays an important role in the research of gene mapping, physical mapping, map-based cloning, genome sequencing and comparative genomics. Since the first BAC library, a human genomic library, was constructed in 1992 (Shizuya et al., 1992), the BAC system has been widely used in genomic library construction of various organisms for different biological research purpose, including the important Solanaceous vegetable crops like tomato, potato and tobacco (Sierro et al., 2013; Zhang et al., 2014; Yang et al., 2015). In 2001, the first BAC library for pepper was constructed using CM334 variety, a material conferring resistance to Phytophthoa capsici, Tobacco mosaic virus (TMV) and Potato virus Y (PVY). While this library is far from meeting the need of map-based cloning and physical map construction due to the short average insert size and low coverage ratio of the genome (Yoo et al., 2001). So in 2003, another BAC library was constructed using the same material CM334 with the average insert size of 150 kb and about 12 times coverage of pepper genome. The new library had been used in studying resistance to root-knot nematode and Rhizoctonia solani in pepper, four QTLs resistant to root-knot nematode and three QTLs resistant to R.solani had been identified (Yoo et al., 2001; Kim et al., 2008). HDA149, a double haploid pepper genotype harboring a single dominant gene Me3, is an ideal resistant resource to root-knot nematode. In order to clone the resistance gene Me3 and other excellent functional genes, and study gene-gene interaction, the double haploid pepper genotype HDA149 would be used to construct a BAC library, which would be further screened with molecular markers linked to Me3 gene locus to construct a contig of the Me3 gene region. All the work above would make a solid foundation for the resistance gene Me3 cloning and other further uses. 2. Materials and Methods 2.1. Plant material The material used in this study is a double haploid pepper cultivar HDA149 that harbored the root-knot nematode resistance gene Me3 and conferred resistance to Mi, Mj and Ma. After surface sterilization and germination at 28 C, the HDA149 seeds were sowed in sterilized soil and cultivated in the growth room at C until three euphylla stage. After another 3 d of dark cultivation, the fresh stem tips were harvested and used to extract high molecular weight genomic DNA for the construction of BAC library Identification and evaluation of resistance to root-knot nematode of HDA149 The identification and evaluation of resistance to root-knot nematode were performed according to the references (Djian-Caporalino et al.,1999, 2007). Pepper seedlings with four euphylla were transplanted to the growth room and inoculated after 10 d cultivation. Three 1 cm-deep holes distributed uniformly in the rhizosphere soil of seedling were dug and the second-stage juveniles of root-knot nematode were placed in the holes (600 plant -1 ). Ten plants of each treatment and each treatment was repeated 3 times with the susceptible pepper Qiemen as control. After inoculation 6 weeks, the roots were washed gently. Then the symptoms was observed and egg nubmers were counted. Thus, the resistance of root-knot nematode for pepper HDA149 was determined Construction of BAC library Preparation of high molecular weight (HMW) genomic

3 4 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): DNA The fresh etiolated stem tips of pepper HDA149 were used to prepare DNA plugs embedded in low melting agarose gel (1.4%)(Zhang et al., 1995; Ma et al., 2000). Twenty grams of stem tips were ground in liquid nitrogen and transferred to four 50 ml tubers, add 50 ml pre-cold nuclear segregation liquid containing 0.1% beta mercaptoethanol and 10% Triton X-100 to each tuber, gently rocked for 15 minutes, and then filtered with Micro cloth to remove impurities. Precipitation was collected through twice centrifugal filtrate and then rinsed with nuclear segregation liquid without beta mercaptoethanol and Triton X-100, suspended once again and mixed with low melting agarose gel (1.4%) of equal volume to make plugs. The plugs digested by proteinase K, washed with TE (Tris-ethylene diamine tetraacetie acid (EDTA)) buffer, and stored in 0.5 mol L 1 EDTA (ph 8.0) at 4 C for the following study. Partial digestion and selection of HMW DNA A few DNA plugs were partially digested with Hind III at different concentrations and reaction time. The digestion was fractioned on 1% agarose gels by pulsed field gel electrophoresis (PFGE)(CHEF-DR II System, Bio-Rad, USA) in 0.5% TBE buffer using the following parameters: 6 V cm 1, 50 s initial pulse, 50 s terminal pulse, 16 h at 14 C. The optimum enzyme concentration and reaction time were selected as those in which the digested DNA fragments were mainly distributed in kb. Under the optimum conditions, plenty of DNA plugs were digested and fractioned. The target large DNA fragments were recovered with electro elution and quantified with λdna as control. Ligation and transformation The recovered large DNA fragments were ligated with CopyControl TM pcc1bac TM vector (Epicentre, USA) at a molar ratio of 10 : 1 using T4 ligase (New England Biolabs, USA) at 16 C overnight. The ligation mix were desalinated, transferred into Escherichia coli competent cell DH10B (Invitrogen, USA) by electroporation, and then paved on Luria-Bertani (LB) medium containing 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, 50 mg ml -1 ), isopropyl-β-d-thiogalactopyranoside (IPTG, 25 mg ml 1 ), and chloramphenicol (12.5 μg ml 1 ). The plates were incubated at 37 C overnight and the recombinant white colonies were then picked up to be used to do insert size test, empty estimation, etc. BAC DNA isolation and insert size estimation A total of randomly selected 192 white colonies were cultured overnight. Plasmid was isolated using alkaline method and digested with the restriction enzyme NotI to test the insert size and empty clones. Meanwhile, five BAC clones were selected randomly and cultured for 5 d consecutively. DNAs was isolated from day 1, 3, 5 cultures and digested with Hind III. The digestion was analyzed by PFGE to inspect the stabilization of BAC clones in DH10B. Then a plenty of transformation were performed to obtain enough BAC clones. The BAC clones were stored in 384-well plates in monoclonal form, and the super pools were Table 1 Overview of primers used in mapping Me3 locus Primer name Orientation Sequence (5 3 ) Annealing temperature ( C) Product size (bp) PMe3 F ATCAGCAGAAGTTGGACGC R CAAGTGGATGAGTAGAAGATGC PE11F6F F TGACTCGCGCAAATACAAG R GAAGATTTCCTTAAGTCCGGC PE11F6R F TATTCCCATGCAAGCTGC R GCAGGGAATTCATGGCAC PE25F15F F TCCCTCCTTGCTGTCATCAC R TGTTGTCTGCACATGCCTTG PE25F15R F CATAAGCCATAGATGTATCCGC R AAACGAATGCCTTCCAAACG PE43N9R F AGATTTGGCTCACCTGACC R GATGGCATAAGAGGGCTTTAGA PE242G21F F AGAAAAGGAGGTAGGTTCAG R ACCTAGCAGCAGTCTTCAGAG PE242G21R F GGTTGTTAATATTATACTATC R ACAACAACACACGGTTACAAG PE316P15T F AAACCAAGAAGTTGCGAGGC (PE43N9F) R ACCATTTCCACCCGAGAGAG PE316P15R F CAGGGCTTGTGTGTGTGTA R CAATGTGTTCGCTGTAGGC PE357M11T F TAGTTGCCGATGCTTTGTCC R ATTCCGAGGGTCTTCTTGAC PE357M11R F AAGAAACAAGTGCCAGCGTC R ACCCAGCGAAACAATCAACG

4 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): further developed BAC library screening and construction of physical map linked to Me3 locus Screening of BAC library According to the expressed sequence tag (EST) sequence of the candidate Me3 gene from NCBI, a special primer PMe3 (Table 1) was designed and used to screen the whole BAC-pool mixture DNA extracted from BAC plate pools using alkaline method, and the positive BAC-pool was obtained (Mao et al. 2007). Then making every adjoining four clones of corresponding positive 384-well plate as a mixture, a total of 96 DNA mixture samples were transferred into a 96-well plate and further amplified with PMe3 primer to identify positive mixture. Once the positive mixture was identified, the positive monoclone can be found through amplifying the samples of each single clone. Plasmid DNA of positive monoclone was isolated and confirmed by PCR and PCR product sequencing. Construction of physical map linked to Me3 locus The BAC-end of positive clones was sequenced to design primers (Table 1). The PCR amplification was carried out to determine the direction and relationship among BAC clones and the representative BAC clones were chosen. The BAC library was screened again using the representative BAC-end primers to obtain more positive monoclones. Additional BAC-end primers were designed according to BAC-end sequences of these new positive BAC clones, and used to carry out mutual PCR amplification to determine the direction and relationship among these new positive BAC clones, and then the physical map linked to Me3 locus was finally constructed. Plasmid DNAs of all positive clones in the physical map were also digested with Hind III to further confirm the accuracy of the physical map. 3. Results 3.1. HDA149 is an excellent root-knot nematode resistant resource Pepper HDA149 and the susceptible pepper Qiemen were inoculated for 6 weeks using the second-stage juveniles of root-knot nematode. There was little root knots and egg mass on HDA149 roots (Fig. 1). While, a large number of root knots and egg masses were found on the Qiemen s roots, with an average of 124 root knots and 103 egg masses per plant (Fig. 1). This indicated that HDA149 was highly resistant to root-knot nematode Construction and evaluation of the HDA149 BAC library In this study, a BAC library of the double haploid pepper genotype HDA149 was constructed through high molec- HDA149 Qiemen Fig. 1 Phenotypic result of HDA149 and Qiemen inoculated with root-knot nematode. A kb M B Insert size (kb) Fig. 2 Insert size of bacterial artificial chromosome library (BAC) clone in the HDA149 BAC library. A, fraction size of BAC clones by pulsed field gel electrophoresis (PFGE). M represents λdna ladder; lanes 1-12 represent the DNA fraction digested with NotI, which were picked form the recombinant BAC randomly. B, size distribution of the clones of the HDA library. Number of clones < >120

5 6 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): ular weight DNA extraction, Hind III partial digestion, DNA recovery and purification, and ligation and transformation. The library contained BAC clones, and was stored in well plates in the form of monoclonal. In order to screen the library easily, 550 super pools with each pool consists of 384 BAC clones were developed. DNAs were isolated from 192 randomly picked BAC clones, and digested with the restriction enzyme Not I, and separated on 1% agarose gel under PFGE. The electrophoresis results showed that the insert size of the BAC clones ranged from 90 to 120 kb, averaged 95 kb with about 3% of empty clones, and 75% BAC clones contained inserts of more than 90 kb with a good homogeneity (Fig. 2). In order to test the stability of BAC clones in DH10B, five BAC clones were selected randomly and cultured for 5 d consecutively. Then DNAs were isolated from day 1, 3, 5 cultures, respectively. And they were digested with Hind III and separated on 1% agarose gel. The results showed that each BAC clone had the same fingerprints during the continuous cultivation of 5 d (Fig. 3). This indicated that the BAC plasmid could be inherited stably in DH10B. Then a plenty of transformation were performed to obtain enough BAC clones, and the BAC library was constructed Physical map of Me3 locus PMe3 primer (Table 1) was used to screen the HDA149 BAC library and seven positive BAC clones were obtained. New BAC-end primers were designed according to the BACend sequences of the seven clones and used to carry out PCR amplify reaction with seven clones as templates. The results showed that PE25F15 and PE11F6 were partially overlapped and could cover all seven BAC clones. Then the BAC-end primers of PE25F15 and PE11F6 were used d 3d 5d 1d 3d 5d 1d 3d 5d 1d 3d 5d 1d 3d 5d Fig. 3 Stability analysis of five BAC clones. A B Chr 357M11T 316P15T 43N9TT 25F15R 316P15R 357M11R 11F6F Me3-F/R 25F15F 11F6R M RP PE25F15 (100 kb) FP PE149C16 (160 kb) T7 PE357M11 (100 kb) RP FP PE11F6 (90 kb) RP T7 PE43N9 (100 kb) RP PE221A21(100 kb) T7 PE316P15 (75 kb) RP RP PE242G21 (90 kb) FP 242G21F 242G21R 43N9R Fig. 4 Physical map of Me3 locus and restriction pattern of the BAC clones. A, physical map of the Me3 region. Vertical, gray, hatched lines indicate physical positions of markers in the contig. Gray rectangles represent BAC clones in Me3 region. T7, FP and RP indicate the orientation of BACs. B, restriction pattern of the eight BAC clones in Me3 region. M represents DNA ladder. Lanes 1-8 represent different BAC clones of PE357M11, PE316P15, PE43N9, PE25F15, PE11F6, PE242G21, PE221A21, PE149C16, respectively.

6 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): to screen HDA149 BAC library again, and other 21 positive BAC clones were obtained. Additional BAC-end primers were designed according to these new BAC clone end sequences, and mutual PCR amplification was carried out to determine the direction and relationship among these new BAC clones. Finally, eight representative BAC clones were obtained and the contig linked to Me3 locus of about 300 kb was constructed (Fig. 4-A). The BAC-end primers of the eight BAC clones were showed in Table 1. In order to verify the relationship among the positive clones and accuracy of physical map of Me3 region, plasmid DNA of the eight positive BAC clones were digested with Hind III and distributed in 1% agarose gel by PFGE. The results showed that the digested bands of PE357M11 and PE11F6, PE43N9 and PE149C16 clones had no correlation, which indicated that each clone was independent. While the digested bands of BAC clones PE357M11 and PE25F15, PE25F15 and PE11F6, PE11F6 and PE149C16 had different degree of consistency, which indicated that they should be overlapping. Meanwhile all the digested bands of PE316P15 were exactly the same as that of the BAC clone PE43N9, which indicated that PE316P15 was embedded in PE43N9 (Fig. 4-B). The digestion result was consistent with that of PCR, which further confirmed the accuracy of the physical map. The construction of physical map linked to Me3 region would provide a good basis for the genetic analysis of the root-knot nematode resistance and Me3 gene cloning of pepper. 4. Discussion With the development of biology genomics, the using of important functional genes cloned from organism has become one of the hot spots in the field of genetics. BAC library has become an important tool to study the gene structure and function of eukaryotic organism, comparative genomics, and construction of physical map in recent years due to its advantages such as good genetic stability, low chimericrate, high conversion efficiency, easy separation of the recombinant DNA, etc. The CopyControl TM pcc1bac TM vector (Epicentre, USA), derived from the pbelobacll and plndigobac5, harbored not only the blue-white screening system (lacz) and chloramphenicol resistance gene loci that can be as the resistance selection marker, but also the high copy replication origin, oriv, which permits copy-number of BAC plasmid to be induced transiently when propagated in a suitable host strain. Some factors influencing the efficiency of BAC library concstruction had been optimized, which included vector preparation, homogeneity and insert size (Osoegawa et al. 1998; Ma et al. 2000; Chalhoub et al. 2004). But there are still some obstacles in BAC library construction. And the preparation of high molecular weight (HMW) genomic DNA was the first crucial step (Biradar et al. 2014). In this study, using the etiolated stem tip of pepper seedling to extract DNA could reduce the influence of chloroplast and phenolic compounds on DNA efficiently. Meanwhile, the pre-electrophoresis of the DNA plug could further reduce the residual impurities and small DNA fragments. Moreover, the ligation mix dialyzed with 30% PEG8000 at 4 C for 30 min to increase the DNA concentration before desalting could also greatly improve the transformation efficiency. The whole modified procedure could improve the transformation efficiency to at least 10 times (data not shown). Finally, the HDA149 BAC library would cover pepper genome approximately 5.3 times, and the probability to find a single-copy gene in this library was up to 99.9%, which would build a solid foundation for the physical map construction of Me3 locus. There are two different approaches in BAC library screening, the hybridization-based and the PCR amplification-based approaches (Ariyadasa et al. 2012). The hybridization-based approach is based on probes hybridizing with high-density BAC library screening membranes to identify the BAC clones that have homologies with the specific probes. Unfortunately, some middle homologies could also hybridize with the probe. Therefore, one probe may hybridize with several clones in different locus on chromosome, and several probes may hybridize with the same one, which would result in the false positives. Meanwhile, the difference of the carrying capacity of each sample DNA on high-density hybrid membrane would lead to a different strength of hybrid signal, which would also cause the inaccurate screening. Furthermore, it is also difficult to repeat the experiment. In order to get positive clones rapidly, PCR-based approach combined with BAC-pools was used to screen HDA149 BAC library in this study, and the physical map of Me3 gene locus was rapidly finished respectively. The PCR-based approach combined with BAC-pools has many advantages. Firstly, the DNAs of BAC-pools can be easy to store and used many times due to the rarely need of DNA template in PCR amplification. Secondly, only three-round PCR amplification was needed to finish the whole BAC library screening, and could get the positive single clone accurately. If making BAC library into 3- or 5-dimensional pool, BAC library screening could be carried out by only one-round PCR. Thirdly, the positive clones could be further confirmed based on conventional sequencing of PCR products. Hence, this strategy not only uniquely defines individual clones and efficiently eliminates false positives, but also reduces the tedious task of individual clone verification with good repeatability. During the process of physical map construction in this study, each positive clone in the map was confirmed by routine sequencing of PCR products to ensure the map accuracy.

7 8 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): In the process of HDA149 BAC library screening, we found that the numbers of BAC clones screened by PMe3 primer and BAC-end primers ranged from six to nine, which was consistent with that of genome coverage of the library, indirectly indicated that the PCR-amplified sequence was a single copy in HDA149 genome. In the construction of physical map, some BAC-end sequences were repetitive sequence or transposon, such as BAC clone PE221A21, and could not be further used to develop BAC-end markers to extend the physical map by chromosome walking. Anyway, the physical map of Me3 locus about 300 kb was constructed successfully in this study, which will make a solid foundation for genetic analysis and final cloning of Me3 gene. 5. Conclusion The double haploid pepper HDA149 is an excellent resistant resource to root-knot nematode, which harbored a broad-spectrum resistance gene Me3. A high quality HDA149 BAC library was constructed, which consisted of BAC clones with an average insert size of 95 kb. Then the library was stored in well plates in the form of monoclonal and 550 super pools, with 384 BAC clones of each pool were further developed. Moreover, the physical map with total length of about 300 kb linked to Me3 gene locus was also constructed through chromosome walking via BAC library screening, BAC-end sequencing, marker development and restriction enzyme digestion analysis of positive clones. These results would provide good basis for the genetic analysis of root-knot nematode resistance and Me3 gene cloning. Acknowledgments This work was Supported by the National High Tech Research Development Program in China (2013AA ), the Natural Science Funds of Shandong Province, China (ZR2014YL014), the Youth Scientific Research Foundation of Shandong Academy of Agricultural Sciences, China (2014QNZ03), the Taishan Scholars Program of Shandong Province, China ( ), and the National Natural Science Fund of China ( ). Special thanks to Prof. Alain Palloxin, French National Institute for Agricultural Research (INRA), for kindly providing the pepper genotype HDA149. References Ariyadasa R, Stein N Advances in BAC-based physical mapping and map integration strategies in plants. Journal of Biomedicine and Biotechnology, 23, Biradar S S, Nie X, Feng K, Weining S Preparation of high molecular weight gdna and bacterial artificial chromosome (BAC) libraries in plants. Methods in Molecular Biology, 1099, Bleve-Zacheo T, Bongiovanni M, Melillo MT, Castagnone- Sereno P The pepper resistance genes Me1 and Me3 induce differential penetration rates and temporal sequences of root cell ultrastructural changes upon nematode infection. Plant Science, 133: Chalhoub B, Belcram H, Caboche M Efficient cloning of plant genomes intobacterial artificial chromosome (BAC) libraries with larger and more uniform insert size. Plant Biotechnology Journal, 2, Djian-Caporalino C, Pijarowski L, Januel A, Lefebvre V, Daubèze A, Palloix A, Dalmasso A, Abad P Spectrum of resistance to root-knot nematodes and inheritance of heat-stable resistance in in pepper (Capsicum annuum L.). Theoretical and Applied Genetics, 99: Djian-Caporalino C, Fazari A, Arguel M J, Vernie T, Vande Casteele C, Faure I, Brunoud G, Pijarowski L, Palloix A Root-knot nematode (Meloidogyne spp.) Me resistance genes in pepper (Capsicumannuum L.) are clustered on the P9 chromosome. Theoretical and Applied Genetics, 114, Djian-Caporalino C, Pijarowski L, Fazari A, Samson M, Gaveau L, Byrne C O, Lefebvre V, Caranta C, Palloix A, Abad P High-resolution genetic mapping of the pepper (Capsicum annuum L.) resistance loci Me3 and Me4 conferring heat-stable resistance to root-knot nematodes (Meloidogynespp.). Theoretical and Applied Genetics, 103, Hendy H, Dalmasso A, Cardin M C Differences in resistant Capsicum annuum attacked by different Meloidogyne species. Nematologica, 31, Kim H J, Nahm S H, Lee H R, Yoon G B, Kim K T, Kang B C, Choi D, Kweon O Y, Cho M C, Kwon J K, Han J H, Kim J H, Park M K, Ahn J H, Choi S H, Her N H, Sung J H, Kim B D BAC-derived markers converted from RFLP linked to Phytophthoracapsici resistance in pepper (Capsicum annuuml.). Theoretical and Applied Genetics, 118, Kruijt M, Brandwagt B F, de Wit P J G M Rearrangements in the Cf-9 disease resistance gene cluster of wild tomato have resulted in three genes that mediate Avr9 responsiveness. Genetics, 168: Mao Z C, Xie B Y, Yang Y H, Feng D X, Feng L X, Yang Z W Analysis of pepper Me3 gene resistance to root knot nematodes by SSH.Acta Horticulturae Sinica, 34, (in Chinese) Ma Z, Weining S, Sharp P J, Liu C Non-gridded library: a new approach for BAC (bacterial artificial chromosome) exploitation in hexaploid wheat (Triticumaestivum). Nucleic Acids Research, 28, E106. Osoegawa K, Woon P Y, Zhao B, Frengen E, Tateno M, Catanese J J, de Jong P J An improved approach for construction of bacterial artificial chromosome libraries. Genomics, 52, 1 8. Pegard A, Brizzard G, Fazari A, Soucaze O, Abad P,

8 GUO Xiao et al. Journal of Integrative Agriculture 2016, 15(0): Djian-Caporalino C Histological characterization of resistance to different root-knot nematode species related to phenolics accumulation in Capsicum annuum. Phytopathology, 95, Qin C, Yu C, Shen Y, Fang X, Chen L, Min J, Cheng J et al Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proceedings of the National Academy of Sciences, 111: Shizuya H, Birren B, Kim U J, Mancino V, Slepak T, Tachiiri Y, Simon M Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proceedings of the National Academy of Sciences of the United States of America, 89, Sierro N, van Oeveren J, van Eijk M J, Martin F, Stormo K E, Peitsch M C, Ivanov N V Whole genome profiling physical map and ancestral annotation of tobacco Hicks Broadleaf. Plant Journal, 75, Teresa B Z, Michel B, Maria T M, Philippe C S The pepper resistance genes Me1 and Me3 induce differential penetration rates and temporal sequences of root cell ultrastructural changes upon nematode infection. Plant Science, 133, Xu X, Liu F, Kang H, Zhang Z, Zou X, Xie B Fine mapping of the root-knot nematode resistance gene Me3 in pepper. Acta Horticulturae Sinica, 38, (in Chinese) Yang Y, Yang X H, Li C H, Guo X, Shan W W, Ma W Q, Huang S W, Li G C Construction and characterization of a bacterial artificial chromosome library of potato cultivar C88. Acta Horticulturae Sinica, 42, (in Chinese) Yoo E Y, Kim S, Kim J Y, Kim B D Construction and characterization of a bacterial artificial chromosome library from chili pepper. Molecular Cells, 12, Yoo E Y, Kim S, Kim Y H, Lee C J, Kim B D Construction of a deep coverage BAC library from Capsicum annuum CM334. Theoretical and Applied Genetics, 107, Zhang C Z, Liu L, Wang X X, Vossen J, Li G C, Li T, Zheng Z, Gao J C, Guo Y M, Visser R, Li J M, Bai Y L, Du Y C The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS- LRR protein conferring resistance to Phytophthora infestans. Theoretical and Applied Genetics, 127, Zhang M, Zhang Y, Scheuring C F, Wu C C, Dong J J, Zhang H B Preparation of megabase-sized DNA from plant nuclei. Plant Journal, 7: (Managing editor WENG Ling-yun)