Clarity BioSolutions For Synthetic DNA/RNA Advance Your. Oligonucleotide Work. From Sample Preparation to Analysis and Purification
|
|
- Sharlene Gray
- 6 years ago
- Views:
Transcription
1 Clarity BioSolutions For Synthetic DNA/RNA Advance Your Oligonucleotide Work From Sample Preparation to Analysis and Purification
2 Optimized Oligonucleotide Purification and Analysis Designed to efficiently and effectively purify or characterize synthetic oligonucleotides, the Clarity BioSolutions Sample Preparation and LC portfolio includes solutions for all aspects of the oligo purification process. From desalting and cleanup from biological samples to analytical and preparative LC analysis, Clarity BioSolutions will help advance your oligonucleotide analyses. Guarantee If analytical Clarity LC Products do not provide at least an equivalent separation as compared to a competing product of the same particle size, similar phase and dimensions, return the column with comparative data within 4 days for a FULL REFUND. 217 Phenomenex, Inc. All rights reserved.
3 Table of Contents Analysis of Bioanalytical Samples Sample Preparation...pp. 4-7 LC/MS Analysis...pp. 8-9 Oligonucleotide Synthesis Sample Preparation DMT On (Trityl On)... pp DMT Off (Trityl Off)... pp Analytical LC...p. 14 Purification... p. 1 Analyte Characterization Reversed Phase... pp Ion-Exchange... pp
4 Analysis of Bioanalytical Samples Sample Preparation Clarity OTX Extraction Kits Prior to LC/MS analysis, therapeutic oligonucleotides must be isolated from interferences such as salts, sugars, large proteins, and genomic DNA. Using a mixed-mode solid phase extraction (SPE) sorbent in conjunction with carefully formulated buffers, Clarity OTX consistently delivers greater than 8 % recoveries. Designed for Throughput MeOH 4 Steps and 1 Minutes, with No Liquid-Liquid Extraction (LLE) Required! Elution Buffer Equil. Buffer STEP 1 Preparation of SPE sorbent to selectively retain the oligo of interest and its metabolites. Load Sample STEP 4 The addition of the elution buffer releases the target oligo therapeutic and its metabolites. The elution volume can be dried down or lyophilized and reconstituted prior to LC/MS analysis. Wash Buffer STEP 3 The wash buffer is formulated to strip off lipids and proteins from the sorbent, while not disturbing the oligo therapeutics and its metabolites. STEP 2 Salts, sugars, large proteins and genomic DNA flow through the cartridge. The oligo of interest, proteins, and lipids bind to the sorbent via a mixed-mode, weak anionic interaction. Oligo & metabolites Salts Sugars Genomic DNA Lipids Proteins 4
5 Intensity Effective Recoveries 8 4 UV Recovery Data Eliminate MS Interfering Compounds 1.3E E+-6 8.E+- 6.E E+-.E+- MS Recovery Data % Recovery min App ID App ID Plasma extracted 27mer phosphorothioate (1 µg) Area: 278 Recovery: 9 % Standard 27mer phosphorothioate (1 µg) Area: 231 Effective removal of plasma contaminants for improved detection of target oligo therapeutics Analysis of Bioanalytical Samples
6 Analysis of Bioanalytical Samples Peak Area Sample Preparation Clarity OTX Extraction Kits Excellent Linearity 1.6E+7 1.2E+7 8.E+6 Liver Tissue Linearity Curve y = x + 2E+6 =.998 Accurate, reliable results from 1 µg to 1 µg 4.E+6.E µg/g Liver Detect Low Dosage Levels Liver Tissue Linearity Curve 1 μg oligo in 1 g liver tissue 19mer Oligo Internal Std. Accurately detect down to 1 µg min Peak Area 1 1 μg oligo in 1 g liver tissue min 1 1 μg oligo and 1 µg internal standard App ID min 6
7 Ordering Information Choose from 96-well plates or cartridges and stock up on 1L quantities of buffers. Part No. Description Unit Price KS-8494 Clarity OTX Starter Kit- Tubes Includes: 1 mg/3 ml cartridges (x) Lysis-loading buffer (6 ml) Equilibration buffer (2 ml) Wash buffer (3 ml) Elution buffer (6 ml) ea KS-923 Clarity OTX Starter Kit- 96-Well Plate 1 mg/ 96-well plate (x1) Lysis-loading buffer (6 ml) Equilibration buffer (2 ml) Wash buffer (3 ml) Elution buffer (6 ml) 8E-S13-EGA Clarity OTX Well Plate 1 mg/ well 1/box 8B-S13-EBJ Clarity OTX Cartridge 1 mg/3 ml /box AL-879 Clarity OTX Lysis-Loading Buffer V2. 1 L ea ea Flexible Formats Give it a Try Take Clarity OTX for a test run with a starter kit which includes either a 96-well plate or cartridges and all of the buffers you will need! Analysis of Bioanalytical Samples Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. Phenomenex l WEB: 7
8 Analysis of Bioanalytical Samples LC/MS Analysis Clarity Oligo-XT An increased need for TK and PK/PD studies for oligo therapeutics has lead to an increase in LC/MS/MS analysis because of the specificity, sensitivity, and shorter method development times as compared to ligand binding assays or ELISA. Because sensitivity is of the utmost importance, it is crucial to select an LC column that provides both separation and high efficiencies to ensure accurate results. The Core-Shell Advantage Unlike traditional fully porous oligo columns, Clarity Oligo-XT relies on the power of core-shell technology to provide extremely high efficiencies for both low and high oligo concentrations. Because the Clarity Oligo-XT particle is not fully porous, analytes spend less time diffusing into and out of the pores as they travel through the column, resulting in less band broadening for higher peak efficiencies. Clarity Core-Shell Conventional Fully Porous Less Band Broadening More Band Broadening Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * µm VS µm 9 % Higher 1.7 µm VS 1.7 µm 2 % Higher 3 µm VS 2.6 µm 8 % Higher * May not be representative of all applications 8
9 Area Ratio Sensitive, Reliable Analysis Calibration curve of BNA in mini pig liver homogenate Quadratic regression 1-1 ng/ml Consistently quantify oligos down to 1 ng/ml LC/MS/MS Conditions Column: Clarity μm Oligo-XT Dimensions: x 2.1 mm Part No.: B-474-AN HPLC system: Shimadzu Nexera X2 UHPLC Mobile Phase: A: 1. % HFIP &.1 % DIEA with 1 μm EDTA in Methanol B: 1. % HFIP &.1 % DIEA with 1 μm EDTA in Methanol Water (: v/v) Gradient: Time (min) B % Flow Rate: μl/min Inj. Volume: 1 μl Temperature: 4 C Detection: Thermo Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer, HESI, negative polarity Analysis of Bioanalytical Samples Ordering Information SecurityGuard 1.7 µm Minibore Columns (mm) ULTRA Cartridges Phase x x 2.1 3/pk Oligo-XT B-4747-AN D-4747-AN AJ-91 for 2.1 mm ID 2.6 µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 2.1 x x 4.6 3/pk 3/pk Oligo-XT B-4746-AN D-4746-AN B-4746-E D-4746-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 4.6 3/pk 3/pk Oligo-XT B-474-AN F-474-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID SecurityGuard µm Semi-Preparative Columns (mm) SemiPrep Cartridges* Phase x 1. 1 x 1. 1 x 1. 3/pk Oligo-XT B-474-N D-474-N F-474-N AJ-916 for 1 mm ID µm Axia Packed Preparative Columns (mm) SecurityGuard PREP Cartridges** SecurityGuard PREP Cartridges*** Phase 1 x x x x 3 /ea /ea Oligo-XT D-474-P-AX F-474-P-AX G-474-P-AX F-474-U-AX AJ-917 AJ-918 for 21.2 mm ID for 3 mm ID SecurityGuard ULTRA Cartridges require holder, Part No.: AJ-9 * SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 *** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 9
10 Oligonucleotide Synthesis Sample Preparation: DMT On (Trityl On) Clarity QSP The DNA and RNA synthesis process results in a solution that contains target oligos as well as impurities and failure sequences. Target oligos must then be isolated and purified for further analysis. Using a Quick, Simple, and Pure (QSP) protocol, Clarity QSP produces greater than 9 % recoveries of target oligos in less than 2 minutes. It s Quick, Simple, and Pure (QSP) Pre-treatment Trityl-on oligo sample preparation. Mix equal volume of loading buffer with cleavage/deprotection solution STEP 1 Load crude oligo cocktail All trityl-off impurities flow directly through; no wash required. DCA > 9 % recoveries in under 2 minutes! Organic Mixture STEP 2 Detritylate Less than 2 % depurination observed. A faint orange band will appear at top half of cartridge indicating DMT retention. STEP 3 Elute target oligo ph buffered solutions used to maintain safe ph for oligo; select elution buffer based on downstream requirements. Full Length Trityl-On Oligo Impurity N-1 Sequence Detritylated Failure Sequences Trityl Group Full Length Target Oligo Request Technical Note TN-1 Comparing Performance of High- Throughput, Trityl-on RNA/DNA Purification Products to see the benefits of using Clarity QSP over other trityl-on solutions. 1
11 Guaranteed Complete Discrimination between Full-Length Trityl-On Sequences and Impurities High-Throughput DNA Purification min App ID 1646 Sequence: GTGGATCTGCGCACTTCAGGCTCCTGGGCT Synthesis Scale: 2 nmole Format: 96-Well Plate ( mg / well) 1. Crude Trityl-on 2. Load fraction 3. Detritylated final elution Concentrated, full-length sequence that is free of impurities Oligonucleotide Synthesis Crude Trityl-on Load Fraction Detritylated Final Elution Recovery Purity (Peak area) % 92 % Ordering Information Part No. Description Unit Price Formats 8E-S12-DGB Clarity QSP Well Plate mg/well 1/box 8B-S12-UBJ Clarity QSP Cartridge 6 mg/3 ml /box 8B-S12-SBJ Clarity QSP Cartridge 1 mg/3 ml /box 8B-S42-LFF Clarity QSP Cartridge g/6 ml 16/box Buffers * AL-828 Clarity QSP DNA Loading Buffer 1 L ea AL-8282 Clarity QSP RNA-TBDMS Loading Buffer 1 L ea * RNA-TOM loading buffer available upon request Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. 11
12 Oligonucleotide Synthesis Sample Preparation: DMT Off (Trityl off) Clarity RP-Desalting Trityl-off synthetic oligo synthesis mixtures must undergo a desalting process to remove salts and buffers that are not amenable to LC/MS analysis. Clarity RP-Desalting tubes and 96-well plates provide a high capacity, fast and effective desalting solution that results in greater than 7 % purity and 8 % recovery of trityl-off synthetic oligos. Desalting of Dye-Labeled DNA Crude Load Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA, ph 7. / % Acetonitrile B: Methanol Gradient: A/B (9:1) to A/B (4:6) in 2 min Flow Rate: 1 ml/ min Detection: 26 nm Sample: 2nt DNA oligonucleotide Wash Final Elution Final Purity: 71 % Final Recovery: 94 % 4 2 App ID min A quencher-labeled sample of DNA (2nt) with the sequence FAMTTGACTTAGACTTAGA- CTTAGTTT was desalted using Clarity RP-Desalting tubes in the 2 mg/3 ml format. Collection fractions were then analyzed for purity and recovery using the above protocol. 12
13 Desalt Crude DNA Crude Load Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA, ph 7. / % Acetonitrile B: Methanol Gradient: A/B (9:1) to A/B (4:6) in 2 min Flow Rate: 1 ml/ min Detection: 26 nm Sample: 4nt DNA Oligonucleotide Synthesis 1 Wash Final Elution App ID min Ordering Information Tubes 2 mg/3 ml * mg/3 ml ** Phase /box /box C18 8B-S41-FBJ 8B-S41-HBJ 96-Well Plates * Part No. Description Unit Price 8E-S41-SGA Clarity RP Desalting 1 mg/well ea * For 2 µmole synthesis ** For 1 µmole synthesis Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. Phenomenex l WEB: 13
14 Oligonucleotide Synthesis Analytical LC Clarity Oligo-RP Clarity Oligo-RP columns have been specifically designed for the reversed phase purification of oligonucleotides with balanced hydrophobicity and polar selectivity. Available in 3,, and 1 µm particles, Clarity Oligo-RP allows for high capacity analysis and purification of oligos. A Highly Selective Analysis 4nt nt Separation of failure N-1 from target N sequence min App 1621 Clarity Oligo-RP successfully separates a 4mer from a 39mer DNA oligonucleotide due to its excellent efficiency and resolving power. Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA ph 7. B: Methanol Gradient: 1 % to 4 % B in 3 minutes Flow Rate: 1 ml/ min Detection: 26 nm Sample: 1. 4nt DNA with sequence CTTCTGAACAGTTGATCTATG- CACTTCAGACTTATGATCA (2. μg) 2. 39nt DNA with sequence TTCTGAACAGTTGATCTATGCAC- TTCAGACTTATGATCA (2. μg) Ordering Information Minibore Columns (mm) SecurityGuard Cartridges (mm) Phase x 2. 1 x 2. 1 x 2. 4 x 2. * /1pk 3 µm Oligo-RP C18 B-4441-B D-4441-B F-4441-B AJ-8134 /1pk µm Oligo-RP C18 F-4442-B AJ-8134 for ID: mm 14 Analytical Columns (mm) SecurityGuard Cartridges (mm) Phase x x x x x 3. * /1pk 3 µm Oligo-RP C18 B-4441-E D-4441-E F-4441-E AJ-813 /1pk µm Oligo-RP C18 B-4442-E F-4442-E G-4442-E AJ-813 for ID: mm * SecurityGuard Analytical Cartridges require universal holder, Part No.: KJ-4282
15 Purification Clarity Oligo-RP Clarity Oligo-RP columns allow for high loadability and deliver high recovery and purity, from HPLC to Preparative Purification. Easily Scale from HPLC to Preparative Purification DNA Purification (A) Preparative Successfully separate impurities from target sequences min App ID 1947 Column: Clarity 3 µm Oligo-RP C18 Dimensions: A: x 1. mm B: x 4.6 mm Part No.: A: B-4441-N B: B-4441-E Mobile Phase: A: mm TEAA ph 7./ % Acetonitrile B: Methanol Gradient: 1 % to 6 % B in 2 minutes Flow Rate: A: 4.7 ml/ min B: 1. ml/ min Detection: 26 nm Sample: 2nt DNA Oligonucleotide Synthesis 16 (B) Analytical QC % Purity and 8 % Yield min App ID 1948 Ordering Information Semi-Prep Columns (mm) SecurityGuard Cartridges (mm) Phase x 1. 1 x 1. 1 x 1. 2 x 1. 1 x 1 /3pk 3 µm Oligo-RP C18 B-4441-N AJ-8136 /3pk µm Oligo-RP C18 B-4442-N D-4442-N F-4442-N G-4442-N AJ-8136 /3pk 1 µm Oligo-RP C18 F-444-N G-444-N AJ-8136 for ID: 9-16 mm Prep and Axia Packed Preparative Columns (mm) SecurityGuard Cartridges (mm) Phase 1 x x x x 3 2 x 1 x 21.2 ** 1 x 3. /ea /ea µm Oligo-RP C18 D-4442-P-AX G-4442-P-AX AJ-821 AJ-831 /ea /ea 1 µm Oligo-RP C18 F-444-P-AX G-444-P-AX F-444-U-AX G-444-V-AX AJ-821 AJ-831 Bulk material available upon request. for ID: mm 3-49 mm SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 1
16 Analyte Characterization Reversed Phase LC Clarity Oligo-XT Analyte Characterization Clarity Oligo-XT columns have the selectivity and efficiency required for demanding oligonucleotide methods, including separation of n-1 sequences. The particle and stationary phase have also been optimized to withstand the high temperature and harsh solvents required for oligo analysis. The Core-Shell Advantage Unlike traditional fully porous oligo columns, Clarity Oligo-XT relies on the power of core-shell technology to provide extremely high efficiencies for both low and high oligo concentrations. Because the Clarity Oligo-XT particle is not fully porous, analytes spend less time diffusing into and out of the pores as they travel through the column, resulting in less band broadening for higher peak efficiencies. Clarity Core-Shell Conventional Fully Porous Less Band Broadening More Band Broadening Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * µm VS µm 9 % Higher 1.7 µm VS 1.7 µm 2 % Higher 3 µm VS 2.6 µm 8 % Higher * May not be representative of all applications 16
17 Relative Efficiency (%) Reliable Results Number of Cycles Achieve Consistently High Efficiencies Column: Clarity 2.6 µm Oligo-XT Dimensions: x 2.1 mm Part No.: B-4746-AN Guard Cartrdige: AJ-91 Guard Holder: AJ-9 Mobile Phase: A: H 2 O + mm HFIP + mm DIEA (ph 8.7) B: ACN + mm HFIP + mm DIEA Gradient: Time (min) % B Flow Rate:.3 ml/min Temperature: 6 C Detection: 24 nm Sample: Reversed Phase PTM 2 ( % dilution in Water) Analyte Characterization Ordering Information SecurityGuard 1.7 µm Minibore Columns (mm) ULTRA Cartridges Phase x x 2.1 3/pk Oligo-XT B-4747-AN D-4747-AN AJ-91 for 2.1 mm ID 2.6 µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 2.1 x x 4.6 3/pk 3/pk Oligo-XT B-4746-AN D-4746-AN B-4746-E D-4746-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 4.6 3/pk 3/pk Oligo-XT B-474-AN F-474-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID SecurityGuard µm Semi-Preparative Columns (mm) SemiPrep Cartridges* Phase x 1. 1 x 1. 1 x 1. 3/pk Oligo-XT B-474-N D-474-N F-474-N AJ-916 for 1 mm ID µm Axia Packed Preparative Columns (mm) SecurityGuard PREP Cartridges** SecurityGuard PREP Cartridges*** Phase 1 x x x x 3 /ea /ea Oligo-XT D-474-P-AX F-474-P-AX G-474-P-AX F-474-U-AX AJ-917 AJ-918 for 21.2 mm ID for 3 mm ID SecurityGuard ULTRA Cartridges require holder, Part No.: AJ-9 * SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 *** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 17
18 Analyte Characterization Ion-Exchange LC Clarity Oligo-SAX The characterization of synthetic oligos is important in the drug development process, and one common technique used is strong anion-exchange liquid chromatography. This high resolution technique is preferred when extensive characterization (i.e. LC/MS) is not necessary. Another valuable benefit is that n-1 failure sequences can still be separated without the use of an ion pair reagent. Clarity Oligo-SAX strong anion-exchange columns allow analysts to reliably characterize a variety of different sized synthetic oligos while providing excellent separation of oligos and synthesis impurities. A Sensitive Separation 2 Poly (dt) 12-18mer Excellent separation of 12-18mer oligos App ID min 2 Poly (dt) 19-24mer Reliably separate synthesis impurities from target oligos App ID min Column: Clarity μm Oligo-SAX Dimensions: 2 x 4.6 mm Part No.: G-4749-E Mobile Phase: See Table Flow Rate: 1.6 ml/ min Temperature: 3 C LC System: Agilent 12 Detection: 26 nm Oligo Type Mobile Phase A Mobile Phase B Gradient Program Poly (dt) 12-18mer 2 mm Tris, ph 8. 2 mm Tris M NaCl, ph % in 1 min Poly (dt) 19-24mer 2 mm Tris, ph 8. 2 mm Tris M NaCl, ph % in 1 min Poly (dt) 19/2mer, 39/4mer, 9/6mer 2 mm Tris, ph 8. 18
19 Go Beyond Traditional Oligo Analysis 3 2 Poly (dt) 19/2mer, 39/4mer, 9/6mer Analyze longer oligos, up to 6mer! Analyte Characterization App ID min Ordering Information Analytical Columns (mm) Phase x x x x 4.6 µm Oligo-SAX B-4749-E D-4749-E F-4749-E G-4749-E We re Here to Help on Live Chat! Request a Method Search Applications Download Resources Column Care Instructions Quality and Safety Documents Training and On-Site Support Do-it-Yourself Web Tools Live Chat with a Phenom Phenomenex.com/chat Phenomenex l WEB: 19
20 Clarity BioSolutions For Synthetic DNA/RNA Advance Your Oligonucleotide Work From Sample Preparation to Analysis and Purification Australia t: +61 () f: +61 () Austria t: +43 () f: +43 () Belgium t: +32 () (French) t: +32 () (Dutch) f: +31 () beinfo@phenomenex.com Canada t: +1 (8) f: +1 (31) info@phenomenex.com China t: f: +86 () phen@agela.com Denmark t: f: nordicinfo@phenomenex.com Finland t: +38 () f: nordicinfo@phenomenex.com France t: +33 () f: +33 () franceinfo@phenomenex.com Germany t: +49 () f: +49 () anfrage@phenomenex.com India t: +91 () f: +91 () indiainfo@phenomenex.com Ireland t: +33 () f: eireinfo@phenomenex.com Luxembourg t: +31 () f: +31 () nlinfo@phenomenex.com Mexico t: f: tecnicomx@phenomenex.com The Netherlands t: +31 () f: +31 () nlinfo@phenomenex.com New Zealand t: +64 () f: +64 () nzinfo@phenomenex.com Norway t: f: nordicinfo@phenomenex.com Puerto Rico t: +1 (8) 41-HPLC f: +1 (31) info@phenomenex.com Spain t: f: espinfo@phenomenex.com Sweden t: +46 () f: nordicinfo@phenomenex.com United Kingdom t: +44 () f: +44 () ukinfo@phenomenex.com USA t: +1 (31) 212- f: +1 (31) info@phenomenex.com All other countries Corporate Office USA t: +1 (31) 212- f: +1 (31) info@phenomenex.com Italy t: f: italiainfo@phenomenex.com Phenomenex products are available worldwide. For the distributor in your country, contact Phenomenex USA,International Department at international@phenomenex.com BR _W Terms and Conditions Subject to Phenomenex Standard Terms and Conditions, which may be viewed at Trademarks Clarity is a registered trademark and Axia, OTX, QSP, RP-Desalting, Oligo-RP, Presston, and SecurityGuard are trademarks of Phenomenex. Q Exactive and Orbitrap are trademarks of Thermo Fisher Scientific. Shimadzu and Nexera are registered trademarks of Shimadzu Corporation. Agilent is a registered trademark of Agilent Technologies, Inc. Disclaimer Comparative separations may not be representative of all applications. Phenomenex is in no way affiliated with Thermo or Agilent. Axia column and packing technology is patented by Phenomenex. U.S. Patent No. 7,674,383 Clarity Oligo-XT is patented by Phenomenex. U.S. Patent No. 7,63,367 and 8,68,38 and foreign counterparts. Clarity OTX and QSP are patented by Phenomenex. U.S. Patent No. 7,119,14. SecurityGuard is patented by Phenomenex. U.S. Patent No. 6,162,362 CAUTION: this patent only applies to the analytical-sized guard cartridge holder, and does not apply to SemiPrep, PREP, or ULTRA holders, or to any cartridges. 217 Phenomenex, Inc. All rights reserved.
BioSolutions for Synthetic DNA/RNA
DNA/RNA PURIFICATION & characterization CLARITY BIOSOLUTIONS Clarity U.S. Patent No. 7, 119, 14 Optimized Oligo Purification and Analysis RPC, HPLC, prep LC, desalting, and extraction solutions DNA, RNA/RNAi,
More informationAPPLICATIONS TN Automated Method Development of Oligonucleotide in Tissues Using Clarity OTX 96-Well Plate and High Resolution Mass Spectrometry
APPLICATIONS Automated Method Development of Oligonucleotide in Tissues Using Clarity OTX 96-Well Plate and High Resolution Mass Spectrometry Xianrong (Jenny) Wei 1, David M. Good 2, Sean Orlowicz 1, Michael
More informationCHARACTERIZATION & PURIFICATION
Ultra-High Efficiency GFC/SEC BIOMOLECULE CHARACTERIZATION & PURIFICATION AT EXTREMELY AFFORDABLE PRICES AGGREGATES ADC mab BIOSIMILARS NEW 1.8 µm SEC-X1 Replace Waters BEH 1.7 µm SEC columns to: Save
More informationpatent pending BioSolutions Purification solutions for synthetic RNA & DNA Clarity QSP (NEW) Oligo-RP Desalting
Clarity BioSolutions patent pending Purification solutions for synthetic RNA & DNA Clarity QSP (NEW) Oligo-RP Desalting A Demanding Industry Requires a Reliable Partner The increase in nucleotide demand,
More informationExtraction and Dispersive Kits User Guide
Extraction and Dispersive Kits User Guide QuEChERS Kits Selection Chart... p. 3 AOAC 2007.01 Method Protocol... p. 4 EN I5662 Method Protocol... p. 5 Original Non-Buffered Protocol... p. 6 Ordering Information...
More informationFinally an Easier Solution for Protein Precipitation
Revision: 0 PHEN-RUO-00052 Finally an Easier Solution for Protein Precipitation Rapid Protein Precipitation without the Complications Fast Analysis Save time and increase efficiency by performing precipitation
More informationThe New Standard in High Resolution Size Exclusion
The New Standard in High Resolution Size Exclusion Introducing Yarra, Ultra-High Resolution Size Exclusion Columns for Biomolecules 2012 Phenomenex, Inc. All rights reserved. EFFICIENT 3 µm particle size
More informationRapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge
Rapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge G. Scott*, H. Gaus #, B. Rivera*, and M. McGinley* *Phenomenex,
More informationNo Lab-Drama Llama is Here
1 No Lab-Drama Llama is Here To Help You Have an Awesome Year! Cool discounts! Details inside... Offers Expire: 29 March 2019 Offer code: CATAF19 HURRY! Place your order and mention the secret code to
More informationComparing Performance of High-Throughput, Trityl-on RNA/DNA Purification Products Author: Greg Scott
Application Note: TN-9 Comparing Performance of High-Throughput, Trityl-on RNA/DNA Purification Products Author: Greg Scott Introduction C larity QSP, which is part of Phenomenex s Clarity BioSolutions
More informationAPPLICATIONS TN Overview of Kinetex 2.6 µm Core-Shell Technology
TN-7 Determination of Impurities and Related Substances for Glibenclamide (EP Monograph 78). Increased Sensitivity, Improved Resolution and Faster Analysis Using Kinetex.6 µm Core-Shell LC Columns Elli
More informationPreparative / Process
Preparative / Process HPLC SFC SMB MPLC Capture Concentrate Purify Polish The Bulk Media Partner You Need Phenomenex USA Reception Trust Reliability Performance Welcome to Phenomenex Since 1982 we have
More information* Strata-X is patented by Phenomenex, Inc. Oasis is a registered trademark of Waters Corporation. Phenomenex is not affiliated with Waters
* Strata-X is patented by Phenomenex, Inc. asis is a registered trademark of Waters Corporation. Phenomenex is not affiliated with Waters Corporation. 2010 Phenomenex, Inc. All rights reserved. Fact: *Strata
More informationScaling from Analytical to Preparative Chiral Chromatography While Balancing Purity, Yield, and Throughput under HPLC and SFC Conditions
APPLICATINS Scaling from Analytical to Preparative Chiral Chromatography While Balancing Purity, Yield, and Throughput under HPLC and SFC Conditions J Preston, J.T. Presley III, Michael McCoy, Michael
More informationAPPLICATIONS TN Overview of Kinetex 2.6 µm Core-Shell Technology
Determination of Impurities and Related Substances for (Ph. Eur. Monograph 8): Increased Sensitivity, Improved Resolution and Faster Analysis Using Kinetex.6 µm Core-Shell LC Columns Ellie Abbasi, Jeff
More informationSee. Beyond HALO. and Sigma-Aldrich Biotechnology. Advanced Materials Technology. Ascentis. Express
See Beyond Advanced Materials Technology HALO and Sigma-Aldrich Biotechnology Ascentis Express See the Performance Difference Decreased secondary interactions with a more inert base material Sharper peaks
More informationLet s Clear the Air...
NEW LC SOLVENT SAFETY PRODUCTS Let s Clear the Air... Protect Your Lab Protect Your Results Reduce Costs LC SOLVENT SAFETY PRODUCTS Time to Make a Change The SecurityCAP mobile phase and solvent waste
More informationUser s Guide for Extracting Oligo Therapeutics from Biological Samples
User s Guide for Extracting Oligo Therapeutics from Biological Samples Terms and Conditions Subject to Phenomenex Terms and Conditions which may be viewed at www.phenomenex.com/termsandconditions Trademarks
More informationMartin Gilar Waters Corporation, Milford, MA, U.S. Origins of synthetic oligonucleotides impurities. Lab-scale isolation options
LIGNUCLETIDE SEPARATIN TECHNLGY: SYNTHESIS CHALLENGES AND HPLC ISLATIN PTINS Martin Gilar Waters Corporation, Milford, MA, U.S. INTRDUCTIN rigins of synthetic oligonucleotides impurities Use of synthetic
More informationLiner Style* Function Advantages Disadvantages Recommended For Straight Low surface area for less activity Least expensive Low activity
LINER SELECTION GUIDE Liner Style* Function Advantages Disadvantages Recommended For Straight Low surface area for less activity Simple to use Least expensive Low activity Possible inlet discrimination
More informationCLARICEP FLASH. Irregular & Spherical Silica Columns. Consistent High Performance. Wide Range of Selectivities. High Pressure Tolerance
CLARICEP FLASH Irregular & Spherical Silica Columns Consistent High Performance Wide Range of Selectivities High Pressure Tolerance Excellent Availability High Quality Switch to CLARICEP for IMMEDIATE
More informationOn-Line. User s Guide SPE CARTRIDGES. for Rapid Cleanup and Extraction of Analytes
On-Line SPE CARTRIDGES for Rapid Cleanup and Extraction of Analytes User s Guide What is the strata-x on-line SPE cartridge? The strata-x on-line cartridge combines the revolutionary benefits of the patent
More informationHigh Resolution LC or LC-MS Analysis of Oligonucleotides and Large DNA Fragments Using a New Polymer-Based Reversed Phase Column
High Resolution LC or LC-MS Analysis of Oligonucleotides and Large DNA Fragments Using a New Polymer-Based Reversed Phase Column 5/24/216 Julia Baek, Jim Thayer, Shanhua Lin, Yizhu Guo, Yoginder Singh,
More informationUser s Guide for. Extracting Oligo Therapeutics from Biological Samples
User s Guide for Extracting Oligo Therapeutics from Biological Samples Terms and Conditions Subject to Phenomenex Terms and Conditions which may be viewed at www.phenomenex.com/termsandconditions Trademarks
More informationInstructions for Capillary Electrophoresis Peptide Analysis Kit
Instructions for Capillary Electrophoresis Peptide Analysis Kit Catalog Number 148-4110 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723) Table of
More informationPurification of oligonucleotides by anion exchange chromatography
Purification of oligonucleotides by anion exchange chromatography APPLICATION NOTE AN 4 1 1 AA Solid-phase synthesis of oligonucleotides generally give material of rather high purity. However, for many
More informationNew Core-Shell Technology
New Core-Shell Technology Fortis Speedcore columns are the very latest in core-shell technology. Incorporating our optimised bonding and packing practices with a core-shell particle provides the analyst
More informationFast and High-Resolution Reversed-Phase Separation of Synthetic Oligonucleotides
Fast and High-Resolution Reversed-Phase Separation of Synthetic Oligonucleotides High-pH-stable, superficially porous particle columns for LC/UV and LC/MS Application Note Biologics and Biosimilars Authors
More informationUse of ScreenExpert RoboColumns u
Application Note USD 99 Use of ScreenExpert RoboColumns u for High Throughput Study of Loading Conditions on HyperCel STAR AX and MEP HyperCel Sorbents for MAb Purification in Flow-Through Mode Summary
More informationph Flexibility Expands Robustness and Reproducibility
ph Flexibility Expands Robustness and Reproducibility High Efficiency Excellent Lifetime ph Stable - www.phenomenex.com/gemini Setting the Standard for ph Method Development Gemini columns are rugged reversed
More informationfor water and beverage analysis
Thermo Scientific EQuan MAX Plus Systems Automated, high-throughput LC-MS solutions for water and beverage analysis Pesticides Pharmaceuticals Personal care products Endocrine disruptors Perfluorinated
More informationApplication Note USD Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent
Application Note USD 241 Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent What this Study Demonstrates T h i s s t u d y o n C a
More informationQIAcube Pure Efficiency
QIAcube Pure Efficiency Sample & Assay Technologies Walkaway spin-column processing The QIAcube automates your spin preps The revolutionary QIAcube makes automated sample prep available to all labs. The
More informationAPPLICATIONS TN Detection and Identification of Gulf Oil Dispersants (COREXIT 9527 and 9500) by GC/MS and LC/MS/MS
Detection and Identification of Gulf Oil Dispersants (COREXIT 9527 and 9500) by GC/MS and LC/MS/MS Sky Countryman, Matthew Trass, Seyed Sadjadi, and Jeff Layne Phenomenex, Inc., 411 Madrid Ave., Torrance,
More informationFood and Environmental Analysis. A Quicker. and Easier. Sample Preparation Choice.
A Quicker and Easier Sample Preparation Choice Food and Environmental Analysis /roq QuEChERS 1 What is QuEChERS? QuEChERS is a Sample Preparation Technique for: Complex sample matrices Wide range of compounds
More informationQuantitatitive Analysis of Phosphorothioate Oligonucleotide in Human Plasma Using LC-MS/MS with On-Line Extraction
Laixin Wang, Sherry Liu, Qiuying Zhu, Scott Reuschel and Min Meng Tandem Labs Quantitatitive Analysis of Phosphorothioate Oligonucleotide in Human Plasma Using LC-MS/MS with On-Line Extraction Introduction
More informationAgilent Prep LC Columns for Small Molecules and Biomolecules MAINTAIN RAPID, RELIABLE SEPARATIONS AS YOU SCALE-UP
Agilent Prep LC Columns for Small Molecules and Biomolecules MAINTAIN RAPID, RELIABLE SEPARATIONS AS YOU SCALE-UP AGILENT PREP COLUMNS FOR HPLC FLEXIBLE, COST-EFFECTIVE OPTIONS FOR SCALING AND PREPARATIVE
More informationAnalysis of Illegal Dyes in Food Matrices Using Automated Online Sample Preparation with Liquid Chromatography-Mass Spectrometry
Analysis of Illegal Dyes in Food Matrices Using Automated Online Sample Preparation with Liquid Chromatography-Mass Spectrometry Yang Shi, Catherine Lafontaine, and François A. Espourteille Thermo Fisher
More informationHyperCel STAR AX Ion Exchange Sorbent
USD 2831(2) HyperCel STAR AX Ion Exchange Sorbent Salt Tolerant Advanced Recovery Anion Exchange Chromatography Sorbent An industry-scalable anion exchange chromatography sorbent designed for high productivity
More informationThe Benefits of SOLAμ Technology in Sample Preparation. Jon Bardsley and Ken Meadows Thermo Fisher Scientific, Runcorn, UK
The Benefits of SOLAμ Technology in Sample Preparation Jon Bardsley and Ken Meadows Thermo Fisher Scientific, Runcorn, UK Introduction The modern bioanalytical and clinical research laboratory must provide
More informationFast mass transfer Fast separations High throughput and improved productivity Long column lifetime Outstanding reproducibility Low carryover
columns ProSwift Reversed-Phase Monolith Columns for Protein Analysis ProSwift reversed-phase columns use a unique monolith technology for fast, high-resolution HPLC and LC/MS separations of proteins.
More informationBIOANALYSIS CONSUMABLE SOLUTIONS. Sample Preparation and Liquid Chromatography Solutions for Quantitative BIOANALYSIS
BIOANALYSIS CONSUMABLE SOLUTIONS Sample Preparation and Liquid Chromatography Solutions for Quantitative BIOANALYSIS At Waters, we understand the unique challenges faced by the bioanalytical community,
More informationImproving Retention Time Precision and Chromatography of Early Eluting Peptides with Acetonitrile/Water Blends as Solvent B
Improving Retention Time Precision and Chromatography of Early Eluting Peptides with Acetonitrile/Water Blends as Solvent B Stephan Meding, Aran Paulus, and Remco Swart ¹Thermo Fisher Scientific, Germering,
More informationOligonucleotide Separation Technology
Oligonucleotide Separation Technology [ 1 ] Oligonucleotide Separation Technology Waters Oligonucleotide Separation Technology (OST) columns contain second-generation hybrid silica BEH Technology particles
More informationMethod Optimisation in Bottom-Up Analysis of Proteins
Method Optimisation in Bottom-Up Analysis of Proteins M. Styles, 1 D. Smith, 2 J. Griffiths, 2 L. Pereira, 3 T. Edge 3 1 University of Manchester, UK; 2 Patterson Institute, Manchester, UK; 3 Thermo Fisher
More informationDepurination in DNA and RNA sequences whether in nature or through fabrication is an alteration of the sugarphosphate
Application Note: TN-8 Avoiding Depurination During Trityl-on Purification Author: Greg Scott Introduction Depurination in DNA and RNA sequences whether in nature or through fabrication is an alteration
More informationPAGE Introduction to QSP (Quick, Simple, Pure) Technology 2. Components 5. RNA Sample Preparation 6. RNA Purification Protocols 9
TABLE OF CONTENTS PAGE Introduction to QSP (Quick, Simple, Pure) Technology 2 Components 5 Sample Preparation 6 0.2 µmole synthesis scale 6 1 µmole synthesis scale 7 10 50 µmole synthesis scale 8 Purification
More informationSean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION EXPERIMENTAL RESULTS AND DISCUSSION
UPLC Separation of DNA Duplexes Sean M. McCarthy and Martin Gilar Waters Corporation, Milford, MA, U.S. INTRODUCTION Over the past 2 years there has been a considerable amount of effort focused on the
More informationJonathan R. Beck and Charles T. Yang; Thermo Fisher Scientific, San Jose, CA
EPA Draft Method 543 Quantitation of Organic Pesticides in Drinking Water Using Online Pre-concentration/Solid Phase Extraction and Tandem Mass Spectrometry Jonathan R. Beck and Charles T. Yang; Thermo
More informationSimple Techniques for Improving the Isolation of Synthetic Peptides Jo-Ann Jablonski Principal Scientist Waters Corporation
Simple Techniques for Improving the Isolation of Synthetic Peptides Jo-Ann Jablonski Principal Scientist Waters Corporation 2016 Waters Corporation 1 Agenda Background Techniques Scaling a separation Focusing
More informationTN-014. A Simple Approach to Automated Solid Phase Extraction (SPE) with Strata -X Polymeric Sorbents
A Simple Approach to Automated Solid Phase Extraction (SPE with Strata -X Polymeric Sorbents Shahana Huq, Phenomenex, Torrance, CA, USA As more emphasis is being placed on higher throughput, many labs
More informationIdentification of RNA Linkage Isomers by Anion-Exchange Purification with ESI-MS of Automatically-Desalted Phosphodiesterase-II Digests
Identification of RNA Linkage Isomers by Anion-Exchange Purification with ESI-MS of Automatically-Desalted Phosphodiesterase-II Digests J.R. Thayer, 1 Nitin Puri, Chris Burnett, Mark Hail, 3 Srinivasa
More informationDNAPac PA200 and PA200 RS Columns Solutions for Nucleic Acid Analysis
CHMATGAPHY DAPac PA and PA S Columns Solutions for ucleic Acid Analysis Product Specifications Thermo Scientific DAPac PA HPLC and DAPac PA S (apid Separation) UHPLC columns for high-resolution separations
More informationAgilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis
Agilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis Technical Overview Introduction The physical stability of Agilent PL-SAX ensures rapid equilibration between separations,
More informationQIAcube HT Your Purification Expert
HT Your Purification Expert Fast and reliable 96-well nucleic acid purification Sample & Assay Technologies Economical, high-throughput nucleic acid purification from virtually all sample types enables
More informationTake A Deep Breath. Set down that multi-channel pipette. And let us take you to a new state of biologics Zen.
Take A Deep Breath Set down that multi-channel pipette And let us take you to a new state of biologics Zen Peptide Mapping Peptide Quantitation Intact Mass Intact and Fragment Analysis Aggregate Analysis
More information[ product solution ] Waters Oasis µ Elution PlateS. Patented Innovation. Elution volume as low as 25 μl. No evaporation and reconstitution
[ product solution ] Waters µ Elution PlateS Elution volume as low as 25 μl No evaporation and reconstitution Ideal for small sample volumes Up to a 15x increase in concentration Patented Innovation Now
More informationEVOLUTE ABN FOR EXTRACTION OF DRUGS FROM BIOLOGICAL FLUIDS
Technical ote 3 EVLUTE AB FR EXTRACTI F DRUGS FRM BILGICAL FLUIDS EVLUTE Sample Preparation Products are a new generation of advanced polymeric solid phase extraction sorbents for the high throughput extraction
More informationquantification of an oligonucleotide
Challenges with a LCMS method for quantification of an oligonucleotide Lieve Dillen Regulated Bioanalysis Pictured above: IV absorption utline Introduction to the compound Anticipated challenges LC-MS/MS
More informationAgilent SD-1 Purification System. Purify your way SD-1
Agilent SD-1 Purification System Purify your way SD-1 AGILENT SD-1 PURIFICATION SYSTEM PURIFY YOUR WAY WITH HIGH QUALITY SEPARATIONS AT ANY SCALE The Agilent SD-1 Purification System achieves better gradient
More informationBIOANALYTICAL STRATEGY FOR IN VITRO METABOLITE SCREENING WITH EXACT MASS USING THE Q-Tof micro. Jose M. Castro-Perez 1, Carina Leandersson 2
In metabolism studies, it is vital to understand how a particular drug is absorbed, distributed, metabolised, and eliminated by the body. Metabolite identification is a very important part of the drug
More informationAutomated pilot scale purification of synthetic phosphorothioate oligonucleotides
application note Automated pilot scale purification of synthetic phosphorothioate oligonucleotides Summary This application note describes a convenient d simple protocol for the purification of synthetic
More informationHyperCel STAR AX Ion Exchange Sorbent
USD 28312a HyperCel STAR AX Ion Exchange Sorbent Salt Tolerant Advanced Recovery Anion Exchange Chromatography Sorbent An industry-scalable anion exchange chromatography sorbent designed for high productivity
More informationQ and S HyperCel Sorbents
Product Note USD 9 () Q and S HyperCel Sorbents High Productivity Ion Exchangers for Protein Capture and Separations Product Description and Application Overview Introduction Q and S HyperCel sorbents
More informationStrategies for Phospholipid Removal using Polymer-based SPE
Strategies for Phospholipid emoval using Polymer-based SPE Lee Williams, Helen Lodder, Matthew Cleeve, Scott Merriman, Steve Jordan, ichard Calverley, Steve Plant, Joanna Smith Introduction Sample preparation
More informationUser Guide for the Fluorous Affinity Purification of Oligonucleotides
T A B L E O F C O N T E N T S User Guide for the Fluorous Affinity Purification of Oligonucleotides Fluoro-Pak Columns and Fluorous Phosphoramidites Table of Contents Introduction....................................................
More informationB r i n g i n g e x p e r t s t o g e t h e r TELOS neo Polymeric Solid Phase Extraction Columns Simple and Effective SPE
B r i n g i n g e x p e r t s t o g e t h e r Polymeric Solid Phase Extraction Columns Simple and Effective SPE www.kinesis-usa.com www.kinesis-australia.com.au www.abimed.de 4350 Overview PRP Non-polar
More informationSwitch to BioSep GFC Columns for Protein Analysis
Switch to BioSep GFC Columns for Protein Analysis Expanded Resolution Windows vs. Other GFC Columns Batch-to-Batch Reproducibility Highly Inert Material for Better Recovery and Quantitation Designed for
More informationPurification of Oligonucleotides by Ion-pair Chromatography on Hybrid Silica Particles
Purification of Oligonucleotides by Ion-pair Chromatography on Hybrid Silica Particles WCBP 2001, Washington DC, February 20, 2001 Poster #: P-03-F Paul Rainville, Martin Gilar, Jeff R. Mazzeo, and Reb
More informationBivalirudin Purification:
Bivalirudin Purification: Sorbent Screening and Overload Experiments Marc Jacob, Joshua Heng, and Tivadar Farkas Phenomenex, Inc., 411 Madrid Ave., Torrance, CA 90501 USA PO94190412_W Abstract In this
More information[ Care and Use Manual ] Waters AccellPlus QMA and CM Bulk Media. I. calculating bulk media needs. II. packed column use. IIi.
[ Care and Use Manual ] Waters AccellPlus QMA and CM Bulk Media I. calculating bulk media needs II. packed column use a. Slurry Column Packing b. Dry Column Packing c. Column Equilibration d. Packed Column
More informationEcono-Pac Serum IgG Purification Kit and Econo-Pac Serum IgG Purification Columns Instruction Manual Catalog Numbers and
Econo-Pac Serum IgG Purification Kit and Econo-Pac Serum IgG Purification Columns Instruction Manual Catalog Numbers 732-3037 and 732-2026 For Technical Service Call Your Local Bio-Rad Office or in the
More informationChromatography column for therapeutic protein analysis
PRODUCT SPECIFICATIONS ProPac Elite WCX Column Chromatography column for therapeutic protein analysis Benefits Superior resolution power for proteins, monoclonal antibodies, and associated charge variants
More informationThe Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
More informationReversed Phase Solutions for the Analysis of Proteins, Peptides, and Oligonucleotides
Reversed Phase Solutions for the Analysis of Proteins, Peptides, and Oligonucleotides The line, which includes and Proteo, offers various reversed phase solutions for biochromatography. With these two
More informationPuzzled About LCMS? Sample. Sensitivity in Mass Spec Analysis. Prep. Adapting LC-UV. Optimizing and Maintaining Your Mass Spec LCMS
Puzzled About LCMS? Sensitivity in Mass Spec Analysis Sample Prep Adapting LC-UV Optimizing and Maintaining Your Mass Spec To LCMS Paul Altiero Alex Ucci Applications Phone Support Chemistry and Supplies
More informationThermo Scientific Solutions for Intact-Protein Analysis. Better, Faster Decisions for. Biotherapeutic Development
Thermo Scientific Solutions for Intact-Protein Analysis Better, Faster Decisions for Biotherapeutic Development Quickly and Accurately Assess Product Quality and Safety Therapeutic proteins and monoclonal
More informationChromatography Column Performance and Data Analysis Success Guide. Hints and Tips for Better Purifications
Chromatography Column Performance and Data Analysis Success Guide Hints and Tips for Better Purifications This Chromatography Success Guide provides practical advice on preparative chromatography and protein
More informationZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063
INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,
More informationThank you for joining us! Our Webinar will begin shortly Principles of SPE: Troubleshooting Techniques
Thank you for joining us! Our Webinar will begin shortly Principles of SPE: Troubleshooting Techniques Using the Power of Chromatography to Solve Sample Preparation Challenges 2013 Waters Corporation 1
More informationZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067
INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,
More information10. Validated Normal Phase HPLC Method for the Determination. Fulvestrant is primarily used in the treatment of hormone receptor
229 10. Validated Normal Phase HPLC Method for the Determination of Fulvestrant in Pharmaceutical Dosage Forms 10.1 Introduction Fulvestrant is primarily used in the treatment of hormone receptor positive
More informationcolumns PepSwift and ProSwift Capillary Monolithic Reversed-Phase Columns
columns PepSwift and ProSwift Capillary Monolithic Reversed-Phase Columns PepSwift and ProSwift monolithic columns are specially designed for high-resolution LC/MS analysis in protein identification, biomarker
More informationAutomation for Improving the Workflows for LC-MS/MS. Francois Espourteille, Ph.D. Manager, Applications
Automation for Improving the Workflows for LC-MS/MS Francois Espourteille, Ph.D. Manager, Applications Discussion Overview Challenges of sample preparation in LC-MS analysis TurboFlow Technology Multiplexing
More informationCE Oligonucleotide Analysis Kit Instruction Manual
CE Oligonucleotide Analysis Kit Instruction Manual Catalog Number 148-4140 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723) Table of Contents Section
More informationHigh-speed, High-resolution Oligonucleotide Separations Using Small Particle Anion-Exchangers
High-speed, High-resolution Oligonucleotide Separations Using Small Particle Anion-Exchangers Shanhua Lin, 1 J.R. Thayer, 1 Ken Cook 2 and Srinivasa Rao 1 1 Thermo Fisher Scientific, Sunnyvale, CA, USA;
More informationQIAGEN Supplementary Protocol
Triplex to 5-plex real-time PCR analysis using the QuantiFast Pathogen PCR +IC Kit on the Rotor-Gene Q This protocol describes how to use the QuantiFast Pathogen PCR +IC Kit to perform real-time PCR analysis
More informationMAbPac RP Column. High-performance reverse phase chromatography column for monoclonal antibody analysis
CHROMATOGRAPHY MAbPac RP Column High-performance reverse phase chromatography column for monoclonal antibody analysis Product Specifications The Thermo Scientific MAbPac RP is a reverse phase (RP) liquid
More informationE.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps
E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3
More informationfor Acclaim Carbamate Column
for Acclaim Carbamate Column Product Manual for Acclaim Carbamate Page 1 of 13 Product Manual for Acclaim Carbamate Analytical Columns 5 µm, 4.6 x 250 mm, P/N 072924 3 µm, 4.6 x 150 mm, P/N 072925 3 µm,
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Oligo Clean & Concentrator Catalog Nos. D4060 & D4061 Highlights Quick (2 minute) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes, salts, enzymes, nucleotides,
More informationTOYOPEARL GigaCap Series
TOYOPEARL GigaCap Series INTRODUCTION Ion Exchange Chromatography (IEC) is one of the most frequently used chromatographic modes for the separation and purification of biomolecules. Compared with other
More informationTotal RNA and DNA Purification
Total RNA and DNA Purification User Manual NucleoSpin RNA/DNA Buffer Set October 2008/ Rev. 05 MACHEREY-NAGEL MN Total RNA / DNA Purification from Tissue / Plant Protocol-at-a-glance (Rev. 05) 1 Homogenize
More informationDNA PURIFICATION BY REVERSED PHASE AND ANION EXCHANGE HPLC
DNA PURIFICATION BY REVERSED PHASE AND ANION EXCHANGE HPLC Hamilton Company offers three HPLC columns for the separation and purification of synthesized DNA. Two for reversed phase gradient elution chromatography:
More informationGenomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationmrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification
mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification Ademtech * Bioparc BioGalien 27 Allée Charles Darwin * 33600 Pessac France Tel : + 33 (0) 57 02 02 01, Fax : + 33
More informationFastLane Kits from Sample Direct to Result
FastLane Kits from Sample Direct to Result New Sample & Assay Technologies Overview of FastLane technology Speed up and simplify your workflow FastLane Kits accelerate and streamline real-time RT-PCR analysis
More informationab Oligonucleotide Conjugation Kit
Version 2 Last updated 6 April 2017 ab218260 Oligonucleotide Conjugation Kit For the covalent conjugation of antibodies to oligonucleotides. This product is for research use only and is not intended for
More information