Sequencing techniques and applications

Size: px

Start display at page:

Download "Sequencing techniques and applications"

Erica Wade
6 years ago
Views:

1 I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye School of Informatics & Computing, IUB

2 Contents Sequencing techniques Sanger sequencing Next generation sequencing (NGS) Third generation sequencing Base calling and PHRED quality score FASTQ format

Start with reads >read1 aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcgg ctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatga

3 Start with reads >read1 aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcgg ctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatga caatgcatgcggctatgctaatgaatggtcttgggatttaccttggaat >read2 gctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttg gaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaa tgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcg gctatgctaagctgggatccgatgacaatgca >read3 tgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtct tgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatg gtcttgggatttaccttggaatatgctaatgcatgcggctatgcta

4 DNA sequencing technology Sanger sequencing The main method for sequencing DNA for the past thirty years! 2 nd generation sequencing techniques (next generation sequencing) Differ from Sanger sequencing in their basic chemistry Massively increased throughput Smaller DNA concentration 454 pyrosequencing, Ilumina/Solexa, SOLiD 3 rd generation (single-molecule)

5 Next-generation sequencing transforms today's biology Genome sequencing Genome re-sequencing Metagenomics Transcriptomics (RNA-seq) Personal genomics ($1000 for sequencing a person s genome)

6 Next-generation sequencing transforms today's biology Sanger sequencers 454 sequencer Ref: Nature Methods - 5, (2008)

Gilbert method (1977): chemical method to cleave DNA at specific points (G,

7 DNA sequencing: history Sanger method (1977): labeled ddntps terminate DNA copying at random points. Gilbert method (1977): chemical method to cleave DNA at specific points (G, G+A, T+C, C). Both methods generate labeled fragments of varying lengths that are further electrophoresed (electrophoretic separation)

8 Sanger method: generating reads 1. Start at primer (restriction site) 2. Grow DNA chain 3. Include ddntps 4. Stops reaction at all possible points 5. Separate products by length, using gel electrophoresis Chain terminators: dideoxynucleotides triphosphates (ddntps)

9 Radioactive sequencing versus dyeterminator sequencing ddntps (chain terminators) are labeled with different fluorescent dyes, each fluorescing at a different wavelength.

10 Automatic DNA sequencing Output: chromatograms (fluorescent peak trace)

11 New sequencing techniques Next Generation Sequencing (NGS) (Second Generation) Pyrosequencing Illumina SOLiD Third generation sequencing single-molecule sequencing technologies NHGRI funds development of third generation DNA sequencing technologies More than $18 million in grants to spur the development of a third generation of DNA sequencing technologies was announced today by the National Human Genome Research Institute (NHGRI). The cost to sequence a human genome has now dipped below $40,000. Ultimately, NHGRI's vision is to cut the cost of whole-genome sequencing of an individual's genome to $1,000 or less, which will enable sequencing to be a part of routine medical care..

12 2013 NGS field guide Instrument Reagent Cost/run a Reagent Cost/MB Minimum Unit Cost (% run) b 3730xl (capillary) $144 $2,308 $6 (1%) 454 FLX Titanium $6,200 $12 $2,000 (12%) PacBio RS $300 c $2-17 $500 (100%) Ion Torrent 316 chip $739 $1.20 ~$1,000 (100%) Illumina MiSeq $1,040 $0.70 ~$1,400 (100%) Ion Torrent 318 chip $939 $0.60 ~$1,200 (100%) Ion Torrent Proton I $1,050 $0.09 d? (100%) SOLiD 5500xl $10,503 e < $0.07 $2,000 (12%) Illumina HiSeq 2500 rapid * $6,145 f $0.05? (50%)

13 Pyrosequencing Pyrosequencing principles the polymerase reaction is modified to emit light as each base gets incorporated.

14 Roche (454) GS FLX sequencer

15 Solexa/Illumina sequencing Ultrahigh-throughput sequencing Keys attachment of randomly fragmented genomic DNA to a planar, optically transparent surface solid phase amplification to create an ultra-high density sequencing flow cell with > 10 million clusters, each containing ~1,000 copies of template per sq. cm. Short reads Used for gene expression, small RNA discovery etc

16 Solexa/Illumina sequencing More details at pages.ilmn?id=203

17 Applied Biosystems SOLiD sequencer Commercial release in October 2007 Sequencing by Oligo Ligation and Detection ~5 days to run / produces 3-4Gb The chemistry is based on template-directed ligation of short, dinucleotide-encoding, 8-mer oligonucleotides. Dinucleotideencoding permits discrimination of SNP s from most chemistry and imaging errors, and subsequent in silico correction of those errors. Ref:

18 3 rd generation sequencing PacBio SMRT (Single-Molecule sequencing in Real Time) Helicos tsms

19 Single-cell sequencing These sequencing-based technologies are increasingly being targeted to individual cells, which will allow many new and longstanding questions to be addressed. single-cell genomics to uncover cell lineage relationships single-cell transcriptomics to supplant the coarse notion of marker-based cell types single-cell epigenomics and proteomics to allow the functional states of individual cells to be analysed. Ref: Nature Reviews Genetics 14, (2013)

20 Long-Read Sequencing Technology (Moleculo) Moleculo, acquired by Illumina in late 2012 The technology breaks DNA into large fragments that are sequenced on standard Illumina sequencing platforms for subsequent assembly into synthetic long reads. fragment genomic DNA to approximately 10 kilobases. the fragments are clonally amplified, sheared, and marked with a unique barcode, and are then sequenced with Illumina technology. the short sequence reads originating from each molecule (with a unique barcode) are assembled into synthetic longreads, or long fragments.

21 Nanopore-based Fourth-generation DNA sequencing There are many Nanopore technologies: biological vs solid-state A.S. Mikheyev, M.M.Y. TinA. First look at the Oxford Nanopore MinION sequencer Mol Ecol Resour, 14 (2014), pp Although the handheld MinION sequencer can generate more than 150 megabases of raw data in one run, at most a quarter of the resulting reads map to the reference, with less than average 10% identity.

22 Some video clips Ion Torrent ( v=mxkya9xcvbq) Illumina MiSeq ( 1 st, 2 nd, and 3 rd generation genome sequencing technologies (

23 Base calling Determine the sequence of nucleotides from chromatograms or flowgram (trace files often in SCF format) Peak detection Phrep quality score Q = -10log 10 (Pe)

24 Phred quality score Phred Quality Score Probability of incorrect base call 10 1/10 90% 20 1/100 99% Base call accuracy (for high values the two scores are asymptotically equal)

25 Relationship between Q and p using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates p = 0.05, or equivalently, Q 13. Source: wikipedia

26 FASTQ format FASTQ format is a text-based format for storing both a DNA sequence and its corresponding quality scores. The quality score for each base is encoded with a single ASCII character Phred quality score from 0 to 93 is encoded with ASCII 33 to 126 TCGAAAATTGTNAACCAGCTGGTAATCATTTTTCAATANAAGNTACTAGGTATAAAAACGAAACATTTACTGTAA! +Read_1! _SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR _SLXA- EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC!

27 Quality score encoding: Phred+33 or Phred+64? SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS......XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ... }~ S - Sanger Phred+33, raw reads typically (0, 40) X - Solexa Solexa+64, raw reads typically (-5, 40) I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) J - Illumina 1.5+ Phred+64, raw reads typically (3, 40) with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) (Note: See discussion above). L - Illumina 1.8+ Phred+33, raw reads typically (0, 41) Guess the encoding: head input-fastq-file awk '{if(nr%4==0) printf("%s",$0);}' od -A n -t u1 awk 'BEGIN{min=100;max=0;}{for(i=1;i<=NF;i++) {if($i>max) max=$i; if($i<min) min=$i;}}end{if(max<=74 && min<59) print "Phred+33"; else if(max>73 && min>=64) print "Phred+64"; else if(min>=59 && min<64 && max>73) print "Solexa+64"; else print "Unknown score encoding!";}'

28 Next generation sequencing as a public health tool ~0.25% of US women (375,000) carry a mutation in BRCA1/2 At very high risk of breast and ovarian cancer 85% lifetime breast cancer risk 25-50% lifetime ovarian cancer cancer Knowledge of risk allows prevention Currently we only can identify such women once several family members have developed cancer NGS allows population screening for high risk preventable disorders Cancer predisposition, cardiac disease, etc. ~1-2% of population carry such mutations 3-6 million individuals in the US with preventable disorders if identified Doctors Urge Women To Test For Breast Cancer Gene After Jolie s Mastectomy preventive double mastectomy---surgery to remove both breasts without a cancer diagnosis

29 Challenges to harnessing NGS in clinical Accuracy medicine & public health 99.99% accuracy x 3 billion nucleotides = 300,000 errors per patient Interpretation of the variants we find Storage and access in the medical record Education of patients and public Issues of consent and reporting Education of providers

30 Readings The next-generation sequencing revolution and its impact on genomics. Cell Sep 26;155(1):27-38 Next-generation sequencing in the clinic: are we ready?

Next Generation Sequencing (NGS)

Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next