Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Size: px
Start display at page:

Download "Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis"

Transcription

1 Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017

2 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads processing Variant calling, de novo methods count matrix,...

3 What is sequence data? Sequences are stored in fasta-files Header Sequence >gi ref NC_ Escherichia coli chromosome, complete genome GTAAGTATTTTTCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGT GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAA ATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACG CATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAA ACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCAT GCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTG GAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGG TGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTT TGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTC GATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCA E.coli ~ Mbases Human ~ 3.2 Gbases

4 Then what is NGS data? Fastq Sequence ATTCCCGGCCTTTTTCCAGGCCTGCCTGCTCGAGC + BAAAGECEE<EEDFEDF3DBDBB=A+==>9>>88? Qualities (prob. that base call is wrong) Millions to billions of these

5 Quality score encoding Quality score is the combination of these two (Illumina): Quality predictor values of clusters: Intensity profiles and signal-to-noise ratios Quality model/table: Pre-calculated combinations of the above Depend on machine, chemistry, software

6 A closer look at the qualities Sequence ATTCCCGGCCTTTTTCCAGGCCTGCCTGCTCGAGC + BAAAGECEE<EEDFEDF3DBDBB=A+==>9>>88? Qualities (prob. that base call is wrong) One character encodes a number Phred-scale using ascii table (0-255) Q = -l0 * log10 P This number (Q) can be converted to P P = 10^(-Q/10)

7 Phred ATTCCCGGCCTTTTTCCAGGCCTGCCTGCTCGAGC + BAAAGECEE<EEDFEDF3DBDBB=A+==>9>>88? ~1e-6 Q ~ Prob 10 ~ ~ ~ ~

8 Phred-scaled probabilities Base qualities, read mapping qualities, variant qualities,... Straight-forward, except for when they are used in reads! Offset: Sanger = 33, Illumina = ATTCCCGGCCTTTTTCCAGGCCTGCCTGCTCGAGC + BAAAGECEE<EEDFEDF3DBDBB=A+==>9>>88? Q ~ Prob Phred: ~1e-6 Sanger: ~0.001 HUGE difference! 10 ~ ~ 0.01 Illumina: ~1 Exercise today 30 ~ ~

9 Sanger vs. Illumina vs. Solexa 454, Ion Torrent, Pac Bio, Sanger: Sanger encoding Illumina reads: Illumina or Sanger encoding. New reads are all Sanger Solexa data: Solexa encoding (bought by Illumina) All data from SRA: Sanger

10 Read types Fragment DNA: Single end Paired end Ins: bp Mate pair Ins: 2kb - 40kb (~5kb) Protocol/technology dependent

11 Read orientation Single end Forward Paired end Illumina: Forward - Reverse Mate pair Illumina: Reverse - Forward Different for other technologies!

12 Single end reads: Mate pairs: Special applications Sometimes the only possibility (small DNA fragments / ancient DNA) Paired end reads: More precise mapping/alignment/variation calls Medium/Large indels (insertion/deletion) Structural variations Scaffolding in de novo assembly Scaffolding in de novo assembly Structural variations

13 Question What does it mean to have paired end reads? Discuss with neighbor for 2-3 mins, we discuss

14 Paired end reads x2 Illumina Paired End sequencing video

15 Exercise Data_basics_exercise.php

NEXT GENERATION SEQUENCING. Farhat Habib

NEXT GENERATION SEQUENCING. Farhat Habib NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp

More information

DATA FORMATS AND QUALITY CONTROL

DATA FORMATS AND QUALITY CONTROL HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)

More information

Lecture 7. Next-generation sequencing technologies

Lecture 7. Next-generation sequencing technologies Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction

ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June Introduction INTERNATIONAL ORGANISATION FOR STANDARDISATION ORGANISATION INTERNATIONALE DE NORMALISATION ISO/IEC JTC 1/SC 29/WG 11 CODING OF MOVING PICTURES AND AUDIO ISO/IEC JTC 1/SC 29/WG 11 N15527 Warsaw, CH June

More information

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio

More information

Illumina Sequencing Error Profiles and Quality Control

Illumina Sequencing Error Profiles and Quality Control Illumina Sequencing Error Profiles and Quality Control RNA-seq Workflow Biological samples/library preparation Sequence reads FASTQC Adapter Trimming (Optional) Splice-aware mapping to genome Counting

More information

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

More information

Read Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

Read Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical

More information

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next

More information

Introduction to CGE tools

Introduction to CGE tools Introduction to CGE tools Pimlapas Leekitcharoenphon (Shinny) Research Group of Genomic Epidemiology, DTU-Food. WHO Collaborating Centre for Antimicrobial Resistance in Foodborne Pathogens and Genomics.

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

NGS sequence preprocessing. José Carbonell Caballero

NGS sequence preprocessing. José Carbonell Caballero NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality

More information

Francisco García Quality Control for NGS Raw Data

Francisco García Quality Control for NGS Raw Data Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

Introduction to NGS. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Introduction to NGS. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis Introduction to NGS Josef K Vogt Slides by: Simon Rasmussen 2017 Life science data deluge Massive unstructured data from several areas DNA, patient journals, proteomics, imaging,... Impacts Industry, Environment,

More information

2nd (Next) Generation Sequencing 2/2/2018

2nd (Next) Generation Sequencing 2/2/2018 2nd (Next) Generation Sequencing 2/2/2018 Why do we want to sequence a genome? - To see the sequence (assembly) To validate an experiment (insert or knockout) To compare to another genome and find variations

More information

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

Sequencing techniques

Sequencing techniques Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing

More information

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%

More information

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

14 March, 2016: Introduction to Genomics

14 March, 2016: Introduction to Genomics 14 March, 2016: Introduction to Genomics Genome Genome within Ensembl browser http://www.ensembl.org/homo_sapiens/location/view?db=core;g=ensg00000139618;r=13:3231547432400266 Genome within Ensembl browser

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion

More information

De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa

More information

Normal-Tumor Comparison using Next-Generation Sequencing Data

Normal-Tumor Comparison using Next-Generation Sequencing Data Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

RADseq Data Analysis Workshop 3 February 2017

RADseq Data Analysis Workshop 3 February 2017 RADseq Data Analysis Workshop 3 February 2017 Introduction to Galaxy (thanks to Simon Gladman for slides) What is Galaxy? A web-based scalable workflow platform for genomic analysis Designed for biologists

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, March 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 1: Introduction into high-throughput

More information

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines

More information

Introduction to Next Generation Sequencing (NGS)

Introduction to Next Generation Sequencing (NGS) Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it

More information

Next Generation Sequencing. Tobias Österlund

Next Generation Sequencing. Tobias Österlund Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

More information

Deep Sequencing technologies

Deep Sequencing technologies Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

More information

Introduction to Next Generation Sequencing

Introduction to Next Generation Sequencing The Sequencing Revolution Introduction to Next Generation Sequencing Dena Leshkowitz,WIS 1 st BIOmics Workshop High throughput Short Read Sequencing Technologies Highly parallel reactions (millions to

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

Using New ThiNGS on Small Things. Shane Byrne

Using New ThiNGS on Small Things. Shane Byrne Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion

More information

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10

More information

Quality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta

Quality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence

More information

Next-generation sequencing and quality control: An introduction 2016

Next-generation sequencing and quality control: An introduction 2016 Next-generation sequencing and quality control: An introduction 2016 s.schmeier@massey.ac.nz http://sschmeier.com/bioinf-workshop/ Overview Typical workflow of a genomics experiment Genome versus transcriptome

More information

IDENTIFYING A DISEASE CAUSING MUTATION

IDENTIFYING A DISEASE CAUSING MUTATION IDENTIFYING A DISEASE CAUSING MUTATION Targeted resequencing MARCELA DAVILA 3/MZO/2016 Core Facilities at Sahlgrenska Academy Statistics Software bioinformatics@gu.se www.cf.gu.se/english// Increasing

More information

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in

More information

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454

More information

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017

Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet May 2013 Standard sequence library generation Illumina

More information

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis -Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification

More information

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as

More information

NGS technologies approaches, applications and challenges!

NGS technologies approaches, applications and challenges! www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques

More information

Quality assurance in NGS (diagnostics)

Quality assurance in NGS (diagnostics) Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product

More information

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure

More information

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read

More information

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

Alignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

DNA Sequencing by Ion Torrent. Marc Lavergne CHEM 4590

DNA Sequencing by Ion Torrent. Marc Lavergne CHEM 4590 DNA Sequencing by Ion Torrent Marc Lavergne CHEM 4590 OVERVIEW History DNA Synthesis and First-Gen Sequencing Technology Sequencing Signal Detection Advantages/Disadvantages Applications Current Research

More information

Next Generation Sequencing Technologies

Next Generation Sequencing Technologies Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters

More information

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer. DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.

More information

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Molecular Diagnostics Molecular Diagnostics? Molecular Diagnostics FISH or CISH techniques FISH or CISH techniques FISH or CISH

More information

Reference genomes and common file formats

Reference genomes and common file formats Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

Introduction to the MiSeq

Introduction to the MiSeq Introduction to the MiSeq 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, BeadArray, BeadXpress, cbot, CSPro, DASL, Eco, Genetic Energy, GAIIx, Genome Analyzer, GenomeStudio, GoldenGate,

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018

Introduction to NGS. Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Introduction to NGS Simon Rasmussen Associate Professor DTU Bioinformatics Technical University of Denmark 2018 Life science data deluge Massive unstructured data from several areas DNA, patient journals,

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)

Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD) Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your

More information

SEQUENCING. M Ataei, PhD. Feb 2016

SEQUENCING. M Ataei, PhD. Feb 2016 CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,

More information

Sequencing techniques and applications

Sequencing techniques and applications I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation

More information

Structural variation analysis using NGS sequencing

Structural variation analysis using NGS sequencing Structural variation analysis using NGS sequencing Victor Guryev NBIC NGS taskforce meeting April 15th, 2011 Scale of genomic variants Scale 1 bp 10 bp 100 bp 1 kb 10 kb 100 kb 1 Mb Variants SNPs Short

More information

De Novo and Hybrid Assembly

De Novo and Hybrid Assembly On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the

More information

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014

Alignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided

More information

02 Agenda Item 03 Agenda Item

02 Agenda Item 03 Agenda Item 01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS. Strand Genomics, Inc All rights reserved. About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

More information

A step-by-step guide to ChIP-seq data analysis

A step-by-step guide to ChIP-seq data analysis A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience

More information

Next Generation Sequencing: An Overview

Next Generation Sequencing: An Overview Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation

More information

Quality control for Sequencing Experiments

Quality control for Sequencing Experiments Quality control for Sequencing Experiments v2018-04 Simon Andrews simon.andrews@babraham.ac.uk Support service for bioinformatics Academic Babraham Institute Commercial Consultancy Support BI Sequencing

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Resolution of fine scale ribosomal DNA variation in Saccharomyces yeast

Resolution of fine scale ribosomal DNA variation in Saccharomyces yeast Resolution of fine scale ribosomal DNA variation in Saccharomyces yeast Rob Davey NCYC 2009 Introduction SGRP project Ribosomal DNA and variation Computational methods Preliminary Results Conclusions SGRP

More information

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency

More information

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,

More information

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden

More information

NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.

NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2

More information

Wet-lab Considerations for Illumina data analysis

Wet-lab Considerations for Illumina data analysis Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina

More information

Analysis of structural variation. Alistair Ward - Boston College

Analysis of structural variation. Alistair Ward - Boston College Analysis of structural variation Alistair Ward - Boston College What is structural variation? What differentiates SV from short variants? What are the major SV types? Summary of MEI detection What is an

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information