What is Bioinformatics?

Size: px
Start display at page:

Download "What is Bioinformatics?"

Transcription

1 What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is to enable the discovery of new biological insights as well as to create a global perspective from which unifying principles in biology can be discerned. - NCBI

2 DNA Sequencing 5 CHAIN TERMINATOR 3 A 3 hydroxyl group 2005 is Prentice essential Hall Inc. / for A Pearson chain Education elongation Company / Upper Saddle River, New Jersey 07458

3 Capillary Gel Electrophoresis The sequencing reaction is run out in a single capillary gel. The gel is scanned by a laser. The sequence is read automatically using computer software from the pattern of different wavelengths emitted by the fluorescent dyes.

4 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

5 Automated sequencers: ABI 3700 Made by Applied Biosystems Most widely used automated sequencers: 96 capillaries robot loading from 384- well plates Two to three hours per run bases per run robotic arm and syringe 96 glass capillaries 96 well plate load bar

6 Workflow of conventional vs. second-generation sequencing High-throughput shotgun Sanger sequencing Cyclic array shotgun sequencing Template amplification (Template amplification) Sanger cycle seq Capillary electrophoresis 96 or 384 long reads per run Template immobilization Seq by synthesis or hybridization Millions of short reads per run 6

7 Illumina Figure from M. Metzker, Nat Rev Genet, Jan

8 Cost of Sequence per megabase

9 Benefits of Next-gen sequencing

10 Why do we sequence? Genome Annotation: A complete genome sequence provides us with the raw data to construct a "parts list". Comparative Genomics: Conserved regions in the genome are more likely to play an important role in biology of the species. Functional Genomics: Sequencing the RNA provides us with an insight into the transcriptionally active regions of the genome. Population Genetics and Genomics: Genetic structure and diversity reveals history and distribution of phenotypic traits (e.g. disease susceptibility alleles) Genetic Analysis: Map and characterize molecular basis of allelic variants 10

11 We have the genome sequence, now what? Well...! We don t know how many genes there are!! We don t know where they are!! We don t know what they do!!

12 Definitions of Annotation Interpreting raw sequence data into useful biological information Information attached to genomic coordinates with start and end point, can occur at different levels Addition of as much reliable and up-to-date information as possible to describe a sequence Identification, structural description, characterization of putative protein products and other features in primary genomic sequence

13 Genome annotation Two Main Levels Structural annotation = Nucleotide-Protein level annotation. Finding genes and other biologically relevant sites thus building up a model of genome as objects with specific locations Functional annotation = Objects are used in database searches (and experiments) aim is attributing biologically relevant information to whole sequence and individual objects Large-scale genome analysis projects Rate-limiting step is annotation

14 How do we get from here 14

15 to here,

16 Summary of gene annotation steps

17 Gene prediction through comparative genomics Highly similar (Conserved) regions between two genomes are useful or else they would have diverged If genomes are too closely related all regions are similar, not just genes If genomes are too far apart, analogous regions may be too dissimilar to be found 17

18 Mouse-human comparison 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

19 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey From: J.W. Thomas et al - Nature 14 August 2003

20 The ENCODE Project Consortium (2011) A User s Guide to the Encyclopedia of DNA Elements (ENCODE). PLoS Biol 9(4)

21 Automated Manual Merged

22

23 Basic Distributed Annotation Systems (DAS)

24 Contents of an Integrated Database Experimental Data Microarray Chip-Chip Genome and Functional Annotation: Predicted genes, GO, MIPSFuncat Data to support modeling efforts Protein-protein interactions Protein-DNA interactions Pathways (KEGG, AraCyc)

25 Bioinformaticians integrate the data into one database 1) Find the data. Decentralized databases Data in different formats Experiments Function Models 2) Convert to a common format XML is a good idea (SBML) 3) Data integration. Manual: Excel sheet comparisons (Biologists) Automated: Perl Scripts (Informatician) Database: Queries e.g. SQL (High-production labs) 4) Gene list intersect. Annotation 5) Modeling Biological function in Gene list Need visualization and network modeling tools

26 UCSC browser

27 Examples of Large Genome Projects 1000 Genomes Project ( An effort to sequence the genome of 1000 people to identify genetic variants that affect 1% of the human population Arabidopsis thaliana Genomes Project ( Study the genomes and phenotypes of 1001 strains that can explain difference in phenotype caused by adaptation of different conditions. Metagenomics ( Sequencing of DNA samples from environments, for example mouth, skin, and digestive system, to identify the different bacterial species present.

28 Your genome Personal Genome Sequencing: Several companies provide a service where you can submit your DNA to get sequenced. This can help you learn more about your heritage and also which diseases you are susceptible to. Medical Genomic Studies: There are already a collection of genetic testing procedures that look for specific genes. Unfortunately they are not accurate which can result in individuals making bad decisions. But hope is that with more genes, we can make better and more informed decisions.

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

NGS Approaches to Epigenomics

NGS Approaches to Epigenomics I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic

More information

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing

Functional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Advanced Technology in Phytoplasma Research

Advanced Technology in Phytoplasma Research Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Biochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014

Biochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014 Biochemistry Dr. Shariq Syed Shariq AIKC/FinalYB/2014 What is DNA Sequence?? Our Genome is made up of DNA Biological instructions are written in our DNA in chemical form The order (sequence) in which nucleotides

More information

Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento

Next generation sequencing techniques Toma Tebaldi Centre for Integrative Biology University of Trento Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Gene-centered databases and Genome Browsers

Gene-centered databases and Genome Browsers COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Introduction to Next Generation Sequencing (NGS)

Introduction to Next Generation Sequencing (NGS) Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it

More information

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Wheat CAP Gene Expression with RNA-Seq

Wheat CAP Gene Expression with RNA-Seq Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular

More information

Deep Sequencing technologies

Deep Sequencing technologies Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

DNA METHYLATION RESEARCH TOOLS

DNA METHYLATION RESEARCH TOOLS SeqCap Epi Enrichment System Revolutionize your epigenomic research DNA METHYLATION RESEARCH TOOLS Methylated DNA The SeqCap Epi System is a set of target enrichment tools for DNA methylation assessment

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand

More information

Gene expression microarrays and assays. Because your results can t wait

Gene expression microarrays and assays. Because your results can t wait Gene expression microarrays and assays Because your results can t wait A simple path from data to decision-making The power of expression microarrays Transcriptome-wide analysis can be complex. Matching

More information

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun

The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

Overview of Next Generation Sequencing technologies. Céline Keime

Overview of Next Generation Sequencing technologies. Céline Keime Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing

More information

BGGN 213: Foundations of Bioinformatics (Fall 2017)

BGGN 213: Foundations of Bioinformatics (Fall 2017) BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on

More information

BENG 183 Trey Ideker (the details )

BENG 183 Trey Ideker (the details ) BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and

More information

NextGen Sequencing and Target Enrichment

NextGen Sequencing and Target Enrichment NextGen Sequencing and Target Enrichment Laurent FARINELLI 7 September 2010 Agilent 3rd Analytic Forum Basel, Switzerland Outline The illumina HiSEQ 2000 system Applications Target enrichment Outlook 7

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

Frequently asked questions

Frequently asked questions Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Sequencing techniques and applications

Sequencing techniques and applications I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014

Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014 Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?

More information

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future.

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Evidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab)

Evidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab) Evidence of Purifying Selection in Humans John Long Mentor: Angela Yen (Kellis Lab) Outline Background Genomes Expression Regulation Selection Goal Methods Progress Future Work Outline Background Genomes

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Genome Analysis. Bacterial genome projects

Genome Analysis. Bacterial genome projects Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Single-Cell Whole Transcriptome Profiling With the SOLiD. System

Single-Cell Whole Transcriptome Profiling With the SOLiD. System APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Executive Summary. Technologies

Executive Summary. Technologies First-generation DNA sequencing, dominated by the Sanger method, reached its peak with the introduction of automated capillary electrophoresis-based instruments, which facilitated the timely completion

More information

From Proteomics to Systems Biology. Integration of omics - information

From Proteomics to Systems Biology. Integration of omics - information From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What

More information

Integrative Genomics 1a. Introduction

Integrative Genomics 1a. Introduction 2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

LECTURE-3. Protein Chemistry to proteomics HANDOUT. Proteins are the most dynamic and versatile macromolecules in a living cell, which

LECTURE-3. Protein Chemistry to proteomics HANDOUT. Proteins are the most dynamic and versatile macromolecules in a living cell, which LECTURE-3 Protein Chemistry to proteomics HANDOUT PREAMBLE Proteins are the most dynamic and versatile macromolecules in a living cell, which regulates essential activities of the cell. The classical protein

More information

Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057

Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057 Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Reviewing sites: affinity and specificity representation binding

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Next Generation Sequencing (NGS)

Next Generation Sequencing (NGS) Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next

More information

Applications of HMMs in Epigenomics

Applications of HMMs in Epigenomics I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:

More information

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

Lecture 2: High-Throughput Biology

Lecture 2: High-Throughput Biology Lecture 2: High-Throughput Biology COMP 465 Fall 2013 Study Chapter 3.8-3.11 8/27/2013 Comp 465 Fall 2013 1 Analyzing DNA Recall DNA is the essential information determining the function of living organisms

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away

Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc

More information

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Megan Schmidt Vice President of Product Management, CompuGroup Medical

Megan Schmidt Vice President of Product Management, CompuGroup Medical Thursday April 6, 2017 A01 Molecular and Genetic Testing: How to Position your Laboratory for New Technology Megan Schmidt Vice President of Product Management, CompuGroup Medical DESCRIPTION: Molecular

More information

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency

More information