Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts: 1,4-Butanediol

Size: px

Start display at page:

Download "Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts: 1,4-Butanediol"

Jessie Carpenter
6 years ago
Views:

Engineering Conferences International ECI Digital Archives Metabolic Engineering IX Proceedings Summer 6-6-2012 Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts:

1 Engineering Conferences International ECI Digital Archives Metabolic Engineering IX Proceedings Summer Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts: 1,4-Butanediol mark Burk Genomatica Follow this and additional works at: Part of the Biomedical Engineering and Bioengineering Commons Recommended Citation mark Burk, "Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts: 1,4-Butanediol" in "Metabolic Engineering IX", E. Heinzle, Saarland Univ.; P. Soucaille, INSA; G. Whited, Danisco Eds, ECI Symposium Series, (2013). This Conference Proceeding is brought to you for free and open access by the Proceedings at ECI Digital Archives. It has been accepted for inclusion in Metabolic Engineering IX by an authorized administrator of ECI Digital Archives. For more information, please contact

2 Genomatica Sustainable Chemicals Sustainable chemicals Better economics Smaller footprint Mark J. Burk, CT Metabolic Engineering IX June 2012 Sustainable Production of Industrial Chemicals Using Microbial Biocatalysts: 1,4-Butanediol

3 Genomatica BD Team - Past and Present Molecular Biology Harry Yim Steve Van Dien Bob Haselbeck John Trawick Wei Niu Jeff Boldt Laura Peiffer Eric Van Name Chris Wilson Stephanie Culler Brandon Chen Kevin Hoff Ewa Lis Fannie Chau Hongmei He Shawn Bachan Jingyi Li Luis Reyes Microbiology Catherine Pujol- Baxley Jazell Estadilla Jesse Wooton Jabus Tyerman Jonathan Moore Lars Knutstad Paul Handke Jonathan Joaquin Analytical Sciences Julia Khandurina Rosary Stephen Lucy Zhao Ahmed Alanjary Blanca Ruvalcaba Rainer Wagester Korki Miller Enzymology Brian Steer Stefan Andrae Cara Tracewell Mike Kuchinskas Wayne Liu Brian Kinley Amit Shah Jacqueline Fritz Process Engineering Joe Kuterbach Michael Japs Janardhan Garikipati Fasil Tadesse Ben Adelstein Rachel Pacheco Daric Simonis Arvind Kaul Ishmael Sonico Christophe Schilling, CE Bill Baum, CB Nelson Barton, VP R&D Jeff Lievense, EVP, Process Development Computational Tony Burgard Priti Pharkya Robin sterhout Jun Sun Tae Hoon Yang Wyming "Lee" Pang Fermentation Dan Beacom Sy Teisan Brett Schreyer Laurie Romag Joseph Woodcock Don Miller Gian ddone Amruta Bedekar Rebecca Bratcher Jason Crater Akhila Raya Alex Navarro SAB Bernhard Palsson Sang Yup Lee Jens Nielsen George Church Lee Hood Harvey Blanch Bernhard Hauer

4 Genomatica s BD Process in Engineered E.coli Sugars 1,4-Butanediol (BD) 1.4 M ton/year Direct production Meets application specs BD-producing E. coli Strain, fermentation, process engineering deliver BEP

5 BD Strain Engineering Progress g/l 1.2 M 2011

6 Genomatica s Systems-Based Strain Engineering Product Feedstock rganism & Tools Select Parent strain Synthetic Biology Tools mics data Systems analysis Genomics Pathway & Strain Design Computational Technologies Metabolomics Proteomics Transcriptomics Analyze & Interpret Enzyme Evolution 13 C-Fluxomics Whole Cell Mutagenesis Iterative Strain Engineering LIMS Data HT Screening: In vivo assays Engineered strains Fermentation development/ scale-up >100 g/l BD In 3 years

Journey to a BD Production Strain sucroseex glucoseex rrnc::cscakb glk ATP frk ATP ADP ADP hexose-p ADP, NAD + ATP, NADH phosphoenolpyruvate ADP PTS system ATP renewable feedstock ldh adhe pflb

acn isocitrate gltar163l NAD(P) + quinol mdh oxaloacetate NAD(P)H quinone mqo C2 acea icda malate aceb C2 glyoxylate suca fumabc -ketoglutarate fumarate NAD + sucab, lpda sdhabcd ubiquinol NADH C2

7 Journey to a BD Production Strain sucroseex glucoseex rrnc::cscakb glk ATP frk ATP ADP ADP hexose-p ADP, NAD + ATP, NADH phosphoenolpyruvate ADP PTS system ATP renewable feedstock ldh adhe pflb pyruvate NAD + 1,4-butanediolex 1,4-butanediol sustainable chemicals adh NAD(P) + NAD(P)H NADH,C2 ADP ppc lpda 4-hydroxybutyrylaldehyde C2 lpda K.p.lpdD354K C2 acetyl-coa ATP citrate arca glta pcka acn isocitrate gltar163l NAD(P) + quinol mdh oxaloacetate NAD(P)H quinone mqo C2 acea icda malate aceb C2 glyoxylate suca fumabc -ketoglutarate fumarate NAD + sucab, lpda sdhabcd ubiquinol NADH C2 ubiquinone sucd succinate succinyl-coa NAD(P)H NAD(P) + ATP ADP CoA CoA Pi AMP ATP, CoA acs ald NAD(P)H NAD(P) + acetyl-coa acetate 4hbd cat2 succinate semialdehyde 4-hydroxybutyrate 4-hydroxybutyrylCoA NAD(P) +, CoA NAD(P)H Pathway Identification and Engineering Strain Design and Metabolic Engineering Commercial Strain for BD Production Fermentation Metrics Higher TRY = Lower CGS Titer (g/l) - Impacts equipment sizing and energy needs Rate (g/l/h) - Impacts # of fermentors, plant capacity Yield (g/g) - Impacts feedstock cost contribution TRY all inter-dependent reduce by-products, increase rate and yield

8 BD Pathway and Process E. coli Sugars Glycolysis TCA Cycle BD Pathway BD >100 g/l C 6 H C 4 H C 2 + H 2 Max yield = 1 mol/mol (0.50 g/g, 67 C-mol %) ATP = 0 NAD(P)H = +1 ATP via oxidative phosphorylation xidative TCA cycle flux required for redox needs of BD pathway BD pathway involves 4 reduction steps redox intensive BD pathway generates 1 extra NAD(P)H and no excess ATP Balance energy, redoxandmaintain high NAD(P)H/NAD(P) + ratio Microaerobic production (D 0) required for optimal performance

9 Increasing Rate and Lowering By-products Key Advances Backflux Enzymes Redox ATP supply Regulation Balanced expression Fermentation PD C 2 loss via oxidative TCA A 1 GLUCSE CIT G6P 2 PEP +ATP +NADH PYR ACCA TCA Cycle +ATP +2 NADH -2 NADH Ace C 2 loss Ethanol Acetate More metabolic steps in a pathway increases avenues for by-products ICIT SUCCA AKG +NADPH SUCSAL -ATP 4HB - NADH 4HBALD BD Glutamate - NAD(P)H - NAD(P)H GBL 4-HB

10 Sugar BD Biosynthetic Pathways Prioritized pathways proceed through 4-hydroxybutyrate Downstream enzymes function on non-natural substrates Cat2 ALD ADH Alternative routes 1. Developed enzyme assays and analytical methods for all metabolites 2. Screened libraries of gene candidates for each step >100 in some cases 3. Demonstrated seven different functional BD pathways in E. coli Yim et al., Nature Chem. Biol., 2011

11 mics Analysis of Reverse C-flux Sugar Endogenous genes responsible for reverse C-flux Cat2 ALD ADH 13 C-Flux analysis identified significant drain due to competing pathways Microarray analysis identified candidate genes involved in backflux Intracellular metabolite measurements indicated downstream bottleneck

12 Deletion of sad and gabd Deleted endogenous succinate semialdehyde dehydrogenases Sugar mm in Fermentation Broth Eckh-432 Eckh-432 sad gabd mmol C 2 per L fermentation sad gabd 30% increase in BD, 3 fold 4-hydroxybutyrate Significant decrease in pyruvate, acetate, C 2 Cat2 ALD ADH

13 Deletion of Endogenous Alcohol Dehydrogenases Fractionation/proteomics Deleted 4 ADH s All 4 backfluxadh s NADP + -dependent Sugar Backflux Activity E. coli ADH backflux eliminated K all 4 ADHs No Backflux Backflux from endogenous ADH s Cat2 ALD ADH

14 Improving the Downstream Pathway: Cat2 H H Cat2 or H SCoA ALD 4-HB BK/PTB 4-HB-CoA 4-HBal BD Cat2 inhibited >90% by high [BD] H H ADH H H Enzyme Discovery - Bioinformatics Directed Enzyme Evolution Specific Activity (µmol min -1 mg -1 ) Cat2 Activity in 1M BD New Cat2 riginal Cat2 s 6x 2.5x Cat2 Enzyme New discovered Cat2 has >6 X rate in 1M BD Evolution increased rate of X in 1M BD

15 Improving the Downstream Pathway: ADH H Cat2 H SCoA or H ALD H H 4-HB BK/PTB 4-HB-CoA 4-HBal BD ADH H H Screened over 200 ADH enzymes Evolved best ADH parent fold increase in k cat /K M

16 Improving the Downstream Pathway: ALD H Cat2 H SCoA or H ALD H H 4-HB BK/PTB 4-HB-CoA 4-HBal BD ADH H H Evolution Enzyme Discovery Combined discovery and evolution BD productivity improved 8 fold Evolved ALD uses NADH and NADPH

17 Constitutive Promoter Libraries (σ 70 ) Consensus σ 70 Promoter TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC -35* -10* *Sites randomized via degenerate primers Transform promoter variants into the BD production strain RPU = pconstitutive RFP RFP fluorescence of promoter RFP fluorescence of reference promoter p Control promoters (p100,p104,p111,p119) -10 Library variants -35 Library variants P200 P111 P119 P201 P104 P202 P203 P204 P205 P206 P207 P208 P209 P210 P211 P212 P213 P214 P215 P216 P217 P100 P218 P219 P220 P221 P222 P223 P224 P225 P226 P227 P228 P229 P230 P231 P232 P233 P234 P235 P236 P237 P238 P239 P240 P241 P242 P243 P244 P245 P246 P247 P248 P249 P250 Relative Promoter Units (RPU) Promoter Variants (M9 media, D600= 1.0)

18 ptimization of BD Pathway Gene Expression BD production influenced by promoter strength and ALD protein levels 100 Promoter strength [BD] g/l L Fermentations 0 p111 p104 p100 p108 p105 p115 ALD ALD levels determined by Western blot Higher soluble ac ve protein = higher BD not always strongest promoter

19 Lowering By-Products: γ-butyrolactone (GBL) H Cat2 H SCoA or H ALD H H 4-HB BK/PTB 4-HB-CoA 4-HBal BD ADH H H hydrolase GBL formed by cyclization of 4-HB-CoA (C-yield loss) GBL formation enzyme induced and spontaneous Enzymes identified by microarray experiments GBL mm BD mm GBL Two approaches to eliminate GBL by-product: 1. Delete genes responsible for GBL 2. ID and introduce new hydrolase BD K hydrolase GBL No GBL hydrolase

20 Lowering By-Products: Excess C 2 C 6 H C 4 H C 2 + H 2 1 GLUCSE +ATP +NADH G6P 2 PEP PYR A ACCA +2 NADH Excess C 2 from complete TCA Delete succdgene lose 1 ATP Eliminated futile energy drains C 2 loss via oxidative TCA CIT TCA Cycle ICIT XSUCCA +ATP succd AKG SUCSAL 4HB -ATP - NADH 4HBALD BD - NADH - NAD(P)H

21 In vivo Flux Distribution during BD Production 38 h timepoint 4 succd strain 13 C flux analysis demonstrates little oxidative TCA flux in succdstrain Irreversibility introduced between BD pathway and central metabolism

22 Lowering Excess C 2 via succd Deletion Parent Strain C 2 succd Strain C 2 BD BD succdstrain: higher BD, much lower C 2

23 BD Scale-up and Commercialization Joint Development Partnership with Tate & Lyle $4.3B per year perates four corn wet mills JV with DuPont: PD, M lb/yr Genomatica taking proven path: Same base organism Same scale-up factor Similar chemical Similar cost model Commercial 40M lb/yr 100M+ lb/yr per plant Demonstration 600,000L Lab 30L Pilot 3,000L 13,000L 240,000L 13,000 L fermentor in Decatur demo plant Non-integrated Integrated

24 Bio-BD Becoming a Commercial Reality first production of 1,4-BD from carbohydrates commercial scale production (40M lbs/yr)

Development of a Robust BD Production Strain Pathway Identification and Engineering Strain Design and Metabolic Engineering Commercial Strain for BD Production 2012 2011 108 g/l 1.

25 Development of a Robust BD Production Strain Pathway Identification and Engineering Strain Design and Metabolic Engineering Commercial Strain for BD Production g/l 1.2 M Systems-based approach ver 35 genetic manipulations Eliminated reverse C-flux Improved pathway enzymes Promoter libraries/expression tuning Eliminated/reduced by-products Fully integrated, constitutive strain Achieved commercial TRY targets Process scale-up to 13,000 L (1 ton/wk)

26 Questions? Thank you. Mark Burk

Mark Burk (PI), Nelson Barton, and John Trawick; Genomatica

Mark Burk (PI), Nelson Barton, and John Trawick; Genomatica Development of an Integrated Biofuel and Chemical Refinery Final report for public Recipient Organization: Genomatica Supported in part by the US DOE award DE- EE0005002 to Genomatica Mark Burk (PI), Nelson