Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Transcription

1 Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion using the RNase-Free DNase set. cdna was generated using the Superscript First-Strand Synthesis System for RT-PCR and random hexamer primers (Invitrogen), according to the manufacturer s protocol. cdna was used as a template for quantitative real-time PCR using SYBR Green Master Mix (BioRad), and gene-specific primers (Supplementary Table 1, online). PCR and analysis was performed using a MyiQ ICycler (BioRad). Gene expression was calculated relative to Gapdh. Stimulation of lymphocytes. In vivo: B6.PL (Thy.1 + ) recipient mice were reconstituted with 2.5 x 10 6 OT-II TCR transgenic CD4 + T cells (Thy1.2 + ) one day prior to receiving 2x10 6 OVA-pulsed splenic or LP CD11b + cells in the footpad. Four days later, DLN cells were counted, stained with antibodies and analyzed by flow cytometry. Data were acquired on a FACSCalibur (BD Biosciences) and analyzed with FlowJo software. In vitro recall responses were assayed by restimulating total LN cells (5x10 6 /ml) with relevant OVA peptides. In vivo depletion of LP DCs. CD11c-DTR mice were fed on day 0, 2, 4, 6, and 8 with 500ng/mouse of diptheria toxin (Sigma) and on day 10 small intestinal LP lymphocytes were isolated and either stained directly or stimulated in vitro for 5 h with PMA (50ng/ml) and ionomycin (500ng/ml) in the presence of GolgiStop (PharMingen) before staining and flow cytometric analysis.

2 Electron microscopy. For scanning electron microscopy analysis, sorted CD11b + CD11c splenic or intestinal cells were fixed with 2.5% (volume/volume) glutaraldehyde in PBS, ph 7.4, were processed and analyzed at the Histology and Electron Microscopy Core Lab at the Yerkes National Primate Research Center of Emory University. Cytokine detection. IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p40, IL-12p70, IL-17 and IFN-γ in culture supernatants were detected by a standard two-site sandwich ELISA for cytokines as described in the BD PharMingen protocol. For T cell cultures, supernatants were harvested after 72 h. For intracellular cytokine analysis, cells were stimulated with 10µg/ml plate-bound α CD3 and 1µg/ml α CD28 for 6 h in the presence of GolgiStop (PharMingen) and subsequently incubated with blocking 2.4G2 anti-fcγriii/ii (PharMingen) and stained with PerCP-conjugated anti-cd4. Cells were permeabilized by using Cytofix/Cytoperm and stained by using fluorochrome-conjugated antibodies (PharMingen) according to the manufacturer's protocol. Flow cytometry. Isolated splenocytes or small intestinal LP cells were resuspended in PBS containing 5% FBS. After incubation for 15 min at 4 C with the blocking 2.4G2 anti-fcγriii/i, the cells were stained at 4 C for 30 min with labeled antibodies. Samples were then washed two times in PBS containing 5% FBS. The samples were immediately analyzed at this point, or they were fixed in PBS containing 2% paraformaldehyde and stored at 4 C. Antibodies used for analysis: FITC-labeled anti-mouse CD1d, CD13, CD24, CD25, DEC205, ICAM2, VCAM1, Ly6C; PE-labeled anti-mouse CD19, B220,

3 Gr-1, I-A b, CD40, CD80, CD86, PD-L1, PD-L2, CD14, CD44, CD45RB, CD62L, CD69, CD103, 33D1, Fas, CD135; PerCP-labeled anti-mouse CD3ε, CD4, CD8α, CD45; APClabeled anti-mouse NK1.1, CD11c, TCRß (PharMingen), APC-labeled anti-mouse F4/80 (ebioscience), and PE-labeled anti-mouse CX 3 CR1 (MBL). Intracellular FoxP3 staining was performed using PE-labeled anti-mouse FoxP3 (clone FJK-16s; ebioscience). Flow cytometric analysis was performed on a Becton Dickinson FACSCaliber flow cytometer at the Emory Vaccine Center. Frozen section immunofluorescence analysis. Mice were sacrificed and spleens or small intestines were snap frozen in tissue-freezing medium (Triangle Biomedical Sciences). Immunofluorescence staining was carried out on 6-µm sections. Sections were air dried and fixed with a 1:1 acetone methanol mixture at 20 C for 10 min followed by blocking for 30 min with TNB buffer (PerkinElmer Life Sciences). Sections were incubated with a 1:100 dilution of APC-labeled anti-mouse CD11b (clone M1/70), FITClabeled anti-mouse E-cadherin, and PE-labeled anti-mouse CD11c (HM3) at 4C for 1 h (antibody dilutions were performed in PBS containing 1:200 Fc Block). Normal rabbit IgG (Santa Cruz Biotechnology.) was used as an isotype control. All slides were mounted in ProLong antifade medium (Molecular Probes). Images were acquired using a Zeiss LSM510 confocal microscope and image editing was done with Photoshop software (Adobe) and/or Spot Advanced software (Diagnostic Instruments). E-cadherin staining was pseudocolored in blue and CD11c and CD4 stainings were pseudocolored in red to enhance signal clarity in printed images.

4 Supplementary Figure 1 Phenotype of LP macrophages. Cells isolated from spleen and small intestine LP were stained with indicated antibodies and analyzed by flow cytometry. Pre-gated CD11b + CD11c /lo cells are shown. Solid black lines indicate staining with isotype control antibodies and shaded histograms represent specific stains. Data are representative of one of three independent experiments.

5 Supplementary Figure 2 LP macrophages express an anti-inflammatory gene expression signature. RNA was isolated from sorted splenic or intestinal CD11b + CD11c /dull cells, and expression of Il10, Tgfb1, and Tgfb3 was analyzed by quantitative real-time PCR. Values are expressed relative to Gapdh. Data are representative of one of two independent experiments.

6 Supplementary Figure 3 Effect of IL-10 on splenic or LP macrophage-induced T cell cytokine responses. Intestine (a) and spleen (b) CD11b + CD11c cells purified from Il10 +/+ or Il10 / B6 mice were cultured in with or without antibodies neutralizing IL-10 and IL- 10R in media alone ( ), E. coli lipopolysacchride (LPS; 1µg/ml), Pam3Cys (Pam; 10 µg/ml), yeast zymosan (Zymo; 10 µg/ml), or (CpG; 1µg/ml). After 24 h IL-12p40, and IL-12p70 in supernatants were measured by ELISA. Data are representative of one of two independent experiments.

7 Supplementary Figure 4 LP macrophages inhibit T H 1 polarization of CD4 + T cells. (a) B6.PL (Thy1.1 + ) recipient mice were reconstituted with OT-II T cells (Thy1.2 + ) one day prior to receiving OVA- or medium-pulsed splenic (spleen) or LP (intestine) CD11b + cells in the footpad. Four days later, the presence of transferred OT-II cells in draining lymph nodes was measured by flow cytometry. Data are representative of one of three independent experiments. (b) Draining lymph node cells were restimulated in vitro with OVA for 48 h and cytokines were measured by ELISA. *P < 0.05

8 Supplementary Figure 5 Retinoic acid is required for efficient generation of FoxP3 + T reg cells. (a) RNA was isolated from purified splenic or LP CD11b + cells, and expression of Aldh1a1 and Aldh1a2 were analyzed by quantitative real-time PCR. Values are expressed relative to Gapdh. (b) OT-II T cells were stimulated with LP macrophages for 4 days with OVA and TGF-β in the absence ( ) or presence of the RA receptor antagonist LE540. T reg cell differentiation was analyzed by intracellular staining and flow cytometry. Data are representative of one of two independent experiments.

9 Supplementary Figure 6 IL-10 does not inhibit IL-17 production induced by intestinal DCs. OT-II T cells were co-cultured with intestine DCs and OVA for 4 days in the absence ( ) or presence of IL-10 and were subsequently restimulated with plate-bound anti-cd3 and anti-cd28 for 6 h. Intracellular IL-17 and IFN-γ production was assayed by flow cytometry. Numbers indicate percentages of cells within quadrants. Data are representative of one of two independent experiments.

10 Supplementary Figure 7 In vivo depletion of LP DCs. CD11c-DTR mice were treated orally with diphtheria toxin for 10 days (every two days). (a) On day 10, intestines were removed and isolated cells were stained with indicated antibodies and analyzed by flow cytometry. Data are representative of one of three independent experiments. (b) On day 10, purified LP lymphocytes were stimulated in vitro with PMA and ionomycin for 5 h and subjected to intracellular staining for IL-17 (top) or left unstimulated and subjected to intracellular staining for FoxP3 (bottom). Pre-gated TCRβ + CD4 + cells are shown. Data are representative of one of three independent experiments.

11 Supplementary Figure 8 Model of APC function in the LP.

12 Supplementary Table 1. Real-time PCR Primers. Gene Name Gene Sequence (5-3 ) Gapdh Sense Gapdh Antisense Tgfb1 Sense Tgfb1 Antisense Tgfb3 Sense Tgfb3 Antisense Il10 Sense Il10 Antisense Aldh1a1 Sense Aldh1a1 Antisense Aldh1a2 Sense Aldh1a2 Antisense TGGCAAAGTGGAGATTGTTGCC AAGATGGTGATGGGCTTCCCG ACCATGCCAACTTCTGTCTG CGGGTTGTGTTGGTTGTAGA GGAAATGGGTCCACGAACCTA TCCAAGCACCGTGCTATGG CCCTTTGCTATGGTGTCCTT TGGTTTCTCTTCCCAAGACC ATGGTTTAGCAGCAGGACTCTTC CCAGACATCTTGAATCCACCGAA GACTTGTAGCAGCTGTCTTCACT TCACCCATTTCTCTCCCATTTCC