Firefly luciferase mutants as sensors of proteome stress

Transcription

1 Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Note 1 Temperature dependent loss of functionality of FL mutants. Temperature dependent loss of functionality of wild-type FL-GFP, FL(R188Q)-GFP and FL(R188Q+R261Q)-GFP. Proteinase K sensitivity of FL and FL-GFP proteins. Low level expression of FL-GFP proteins in HeLa cells. Immunofluorescence of HeLa cells co-expressing luciferase under the hsp7.1 promoter and FL-GFP proteins. Cytosolic stress response in HeLa cells expressing the nongfp-tagged sensor proteins. Hsp7 levels in wild-type FL and mutant FL expressing Drosophila S2 cells. FL-GFP protein levels upon MG132 treatment. Primers used for FL mutant preparation and primers used for RT-PCR experiments in worms List of antibodies List of reagents Methods for Drosophila S2 cells

2 a K135Q K135M R188K R261Q R261K Supplementary Figure C C b C C K135Q, R188Q K135Q, R188K K135Q, R261Q K135Q, R261K K135M, R188Q K135M, R188K K135M, R261Q K135M, R261K R188Q, R261K R188K, R261Q R188K, R261K C C C C Supplementary Fig. 1 Temperature dependent loss of functionality of Fluc mutants. Luciferase single mutants (a) and double mutants (b) were translated in reticulocyte lysate (9 min at 3 o C), followed by inhibition of translation and incubation at 3 o C to 37 o C as in Figure 1b. Fluc activity was measured at the times indicated and expressed in % of the activity measured immediately after translation at 3 o C (set to 1%). Error bars indicate s. d., n = 3.

3 Supplementary Figure 2 Fluc-GFP FlucSM-GFP FlucDM-GFP C C C C Supplementary Fig. 2 Temperature dependent loss of functionality of Fluc-GFP, FlucSM- GFP and FlucDM-GFP. Proteins were translated in reticulocyte lysate (9 min at 3 o C), followed by inhibition of translation and incubation at 3 o C to 37 o C. Fluc activity was measured at the times indicated and expressed in % of the activity measured immediately after translation at 3 o C (set to 1%). Error bars indicate s. d., n = 3.

4 Supplementary Figure 3 a Fluc FlucSM FlucDM Solid lines: - Proteinase K Dashed lines: + Proteinase K Fluc-GFP FlucDM-GFP b Fluc FlucSM FlucDM Supplementary Fig. 3 Proteinase K sensitivity of Fluc and Fluc-GFP proteins. (a) Proteins were translated in reticulocyte lysate (9 min at 3 o C), followed by inhibition of translation. The newly-translated proteins were subjected to limited proteolysis by proteinase K at 2 C. Enzymatic activity was recorded at the times indicated and expressed in % of the activity measured immediately after translation (set to 1%). Error bars indicate s. d., n = 3. (b) Proteinase K digestion profiles of the Fluc proteins, as detected by immunoblotting with anti- Fluc antibody. Aliquots of protein samples from the time points above were analyzed by SDS- PAGE and Western blotting with polyclonal anti-fluc antibody (Promega).

5 Supplementary Figure 4 FP GFP ted ted P ted FP GFP FP GFP c c c G P G G e e e P F sf GF M- DMsf c-g M- Msf -GF SM DM n n n S D tra luc- lucs luc tra Flu luc luc tra luc Fluc Fluc n n n F F u F u F u F F kda Fluc-GFP GAPDH 26 Supplementary Fig. 4 Low level expression of Fluc-GFP proteins in HeLa cells. HeLa cells were transfected with Fluc-GFP, FlucSM-GFP and FlucDM-GFP. After 48 h cell extracts were prepared with RIPA buffer and analyzed by SDS PAGE, followed by Coommassie staining (left panel) or Western blotting with anti-gfp (Roche) and anti-gapdh (Millipore) antibodies. Note that the Fluc-GFP proteins are not visible by Coomassie staining.

6 Supplementary Figure 5 DAPI Heat stress Control Heat stress FlucDM-GFP FlucDM-GFP FlucSM-GFP FlucSM-GFP Fluc-GFP Control Fluc-GFP HSPA1A--Myc Fluc-GFP Control Heat stress Control Heat stress Supplementary Fig. 5 Immunofluorescence of HeLa cells co-expressing luciferase under the HSPA1A promoter and Fluc-GFP proteins. Cells were co-transfected with HSPA1A--Myc and Fluc-GFP constructs. After 36 h of transfection, cells were heat stressed for 2 h at 43 C followed by recovery for 2 h at 37 C. Control cells were incubated at 37 C (Control). luciferase was detected by immunocytochemistry against the Myc-tag with anti-myc antibody (Santa Cruz Biotechnology Inc.) followed by cy3 labeled secondary antibody (red) (Jackson ImmunoResearch). Fluc-GFP proteins were detected by GFP fluorescence (green). Scale bars, 1 µm.

7 Supplementary Figure 6 HSPA1A luciferase without heat stress heat stress, recovery 5 luciferase activity (RLU X 1 ) vector control Fluc FlucSM FlucDM Supplementary Fig. 6 Cytosolic stress response in HeLa cells expressing the nongfptagged sensor proteins. HeLa cells were transfected with the stress responsive HSPA1A- luciferase reporter (top) along with the Fluc variants or vector-only control, as in Fig. 3. luciferase activity was measured either without heat stress or after subjecting the cells to heat stress for 2 h at 43 C and recovery for 2 h at 37 C. Error bars indicate s. d., n = 3.

8 Supplementary Figure 7 Hsp7 Fluc Fluc(R188K, R261K) Fluc(R188K, K135M) Fluc(R188Q, R261Q) Fluc(R188Q, K135M) Fluc(R188K, R261K) Fluc(R188K, K135M) Fluc(R188Q, R261Q) Fluc(R188Q, K135M) Fluc(R188K, R261K) Fluc(R188K, K135M) Fluc(R188Q, R261Q) Fluc(R188Q, K135M) Recombinant Fluc Fluc Tubulin No Cu µm Cu ++ 7 µm Cu ++ Supplementary Fig. 7 Hsp7 levels in wild-type Fluc and mutant Fluc expressing Drosophila S2 cells. Wild-type Fluc and mutant pmt-fluc cell lines were pelleted and resuspended in media containing copper at µm, 44 µm or 7 µm to induce Fluc expression. After incubation for 24 h at 25 C, cells were counted and protein samples were prepared for immunoblotting. 3 µg of protein was loaded in each lane and Hsp7, Fluc and α-tubulin protein levels were detected using respective antibodies.

9 Supplementary Figure 8 MG Fluc-GFP GAPDH Fluc-GFP FlucSM-GFP FlucDM-GFP Supplementary Fig. 8 Fluc-GFP protein levels upon MG132 treatment. HeLa cells were transfected with Fluc-GFP, FlucSM-GFP or FlucDM-GFP for 36 h. Cells were incubated with.1% DMSO (-) or 5 µm MG132 in DMSO (+) for 8 h, as in Fig. 4a. Cell extracts were prepared by boiling in SDS PAGE loading buffer and analyzed by Western blotting with anti-gfp (Roche) and anti-gapdh (Millipore) antibodies.

10 Supplementary Tables Supplementary Table 1.1 Primers used for Fluc mutant preparation Position Forward primer Reverse Primer K135Q CCAAAAAGGGGTTGCAACAAATTTTGAACGTGCAA TTGCACGTTCAAAATTTGTTGCAACCCCTTTTTGG K135M CCAAAAAGGGGTTGCAAATGATTTTGAACGTGCAA TTGCACGTTCAAAATCATTTGCAACCCCTTTTTGG R188Q CGATTTTGTGCCAGAGTCCTTCGATCAGGACAAGACAATTGC GCAATTGTCTTGTCCTGATCGAAGGACTCTGGCACAAAATCG R188K CGATTTTGTGCCAGAGTCCTTCGATAAAGACAAGACAATTGC GCAATTGTCTTGTCTTTATCGAAGGACTCTGGCACAAAATCG R261Q CGGATATTTGATATGTGGATTTCAAGTCGTCTTAATG CATTAAGACGACTTGAAATCCACATATCAAATATCCG R261K CGGATATTTGATATGTGGATTTAAAGTCGTCTTAATG CATTAAGACGACTTTAAATCCACATATCAAATATCCG Luc stop removal GGAAAGATCGCCGTGAAACCCGGGATCCACCGGTC GACCGGTGGATCCCGGGTTTCACGGCGATCTTTCC Supplementary Table 1.2 Primers used for RT-PCR experiments in C. elegans Forward primer Reverse Primer Fluc-GFP AGATGACGGGAACTACAAGACACG GTGGTCTCTCTTTTCGTTGGGATC unc-54 ACGTGTTCGTGAGCTTCAATTCCAGG AGATGGCGATCTGATGACAGCGGC unc-119 AATGAGACGGAAGAGAATCTGC GATCATGTCGTCCATGAGTTGT act-1 AAGTGCGACATTGATATCCGTAAGG GGACTCGTCGTATTCTTGCTTGGA

11 Supplementary Table 2 List of antibodies Source Antibody Name Catalogue Species Number Produced in Type Promega Anti-Luciferase pab G7451 Goat Polyclonal Roche Anti-GFP Mouse Mixture of 2 monoclonal Abs Millipore Anti-GAPDH MAB374 Mouse Monoclonal Santa Cruz Biotechnology Inc. c-myc (9E1) sc- 4 Mouse Monoclonal Millipore Anti- Luciferase MAB441 Mouse Monoclonal Reference 4 Hsp7 monoclonal antibody 7FB, generated to Drosophila Hsp7 Rat Monoclonal Abcam Anti-Luciferase pab Ab21176 Rabbit polyclonal Sigma Anti-Mouse IgG (whole molecule) Peroxidase conjugate A4416 Goat Sigma Anti-Goat IgG (whole molecule) Peroxidase conjugate A542 Rabbit Jackson ImmunoResearch Cy3 labeled Goat anti-mouse IgG Goat

12 Supplementary Table 3 List of reagents Source Reagent Catalogue number Promega TnT T7 Quick Coupled Transcription/Translation System L117 Promega Steady-Glo Luciferase Assay System E251 Promega Luciferase Assay System E151 Promega Dual-Glo Luciferase Assay System, 1mL E292 Alexis Biochemicals 17-AAG M1 Biomol MG-132 BML-PI12-5 Sigma Cycloheximide C7698-5G Invitrogen DAPI D136

13 Supplementary Notes Methods for Drosophila S2 cells Cloning of wild-type Fluc and Fluc(double mutants) for expression in Drosophila S2 cells Wild-type Fluc, Fluc(R188K, K135M), Fluc(R188K, R261K), Fluc(R188Q, R261Q) and Fluc(R188Q, K135M) were cloned into the DES Inducible kit system with pcobast selection (Invitrogen). This inducible system uses the metallothionein promoter 1,2 for expression of proteins and can be regulated by varying the amounts of copper or cadmium in the media. All constructs were subsequently sequenced to validate mutations. Cell maintenance Drosophila S2 cells (Invitrogen) were cultured in Schneider s Drosophila medium (Invitrogen) supplemented with 1% heat-inactivated fetal bovine serum (Invitrogen) and containing 1% Penicillin-Streptomycin (Invitrogen). Cultures were maintained in a 25 C incubator without CO 2 and passaged every 3-5 days with a mixture of fresh and conditioned media. Transfections and generation of stable S2-luciferase Drosophila cell lines Cells were split the day before transfections. On the day of transfection, cells were centrifuged, media removed, and cells resuspended in fresh media. Cells were seeded at cells/ml in a 6-well format. Briefly, transfections were performed using the Effectene reagent 3 (Qiagen) as follows: 2 µg DNA (Qiagen maxiprep) was diluted in the DNA condensation buffer (Buffer EC) to a final volume of 1 µl, 16 µl of Enhancer was added to the DNA, vortexed, and incubated at RT for 5 min. Tubes were then centrifuged briefly, 5 µl of Effectene reagent

14 was added to each tube and samples were then incubated at RT for 1 min to allow for transfection-complex formation. At this time, 3 µl of growth media, containing serum and antibiotics, was added to the tubes containing transfection complexes and pipetted up and down to mix. The transfection complex was added drop wise onto the cells and then swirled gently. After 2 days, the transfected cells were put onto selection media containing Blasticidin (GIBCO) at 25 µg/ml for selection. Copper Induction and luciferase activity measurements Inductions of luciferase expression in the wild-type Fluc and mutant pmt-fluc cell lines were performed by pelleting the cells and resuspending them in media containing copper at final concentrations of 44 µm and 7 µm 1. Copper was used over cadmium since it is less toxic, avoiding a heat-shock response 1. After 24 h induction, cells were counted and plated at 3, cells per well into a 96-well plate (Costar) format for luciferase activity measurements. At this time, Bright-Glo reagent (an equal volume to medium, Promega) was added into each sample well, plates were placed on a shaker at RT for 5 min to allow for cell lysis to occur, and luminescence measured using a PerkinElmer Envision plate reader. Immunoblotting Hsp7 and luciferase protein was quantified in cell extracts by immunoblotting with anti- HSP7 4 (monoclonal rat) and anti-luciferase (Abcam, polyclonal rabbit) primary antibodies, used simultaneously overnight at 1:1 dilutions. Bands were visualized using ALEXA Fluor anti-rat 488 and ALEXA Fluor anti-rabbit 568 (Invitrogen) secondary antibodies and the Alpha Innotech FluorChem Q imaging system.

15 REFERENCES 1 Bunch, T. A., Grinblat, Y. & Goldstein, L. S. Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucl. Acids Res. 16, (1988). 2 Maroni, G., Otto, E. & Lastowski-Perry, D. Molecular and cytogenetic characterization of a metallothionein gene of Drosophila. Genetics 112, (1986). 3 Mosher, J. T. & Crews, S. T. Effectene Reagent yields high transfection efficiencies with Drosophila melanogaster S2 cells. Qiagen News 4, 7-9 (1999). 4 Velazquez, J. M. & Lindquist, S. Hsp7: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell 36, (1984).