The comet assay for DNA damage and repair. Applications in genotoxicity testing and human biomonitoring

Size: px
Start display at page:

Download "The comet assay for DNA damage and repair. Applications in genotoxicity testing and human biomonitoring"

Transcription

1 The comet assay for DNA damage and repair Applications in genotoxicity testing and human biomonitoring Andrew Collins Department of Nutrition, University of Oslo

2 Introduction measuring DNA damage Increasing throughput Genotoxicity testing DNA repair Applications in human biomonitoring

3 The comet assay (single cell gel electrophoresis) a simple and versatile method for measuring DNA breaks. Widely used in genotoxicity testing, human biomonitoring, ecogenotoxicology, and fundamental research into mechanisms of DNA damage and repair.

4 Introduction The comet assay is a quantitative method for measuring DNA damage - primarily strand breaks. Few genotoxic agents break DNA directly, but many lesions can be converted to breaks, and DNA repair pathways involve breaks as intermediates. DNA damage is a precursor of cancer, but the link is a weak one, as almost all damage is repaired

5 DNA damage can arise from exposure of cells to environmental mutagens/carcinogens. It can also occur as a consequence of endogenous processes notably oxidation. OH C N H 2 NC N HOH 2 C O N N C OH O DNA is readily oxidised most commonly by endogenous reactive oxygen (free radicals) released from mitochondria or as part of the inflammatory response. 8-oxoguanine potentially mutagenic, easily measured; a popular biomarker. 8-oxoguanine For an index of antioxidant status, cells are treated with H 2 O 2 and resulting strand breaks are measured.

6 % DNA in tail Visual score (arb. units) The comet assay (single cell gel electrophoresis) Cells embedded in agarose on microscope slide Lysis: Triton X-100, 2.5 M NaCl Nucleoids; supercoiled DNA ) s t i n u Alkaline incubation: 0.3 M NaOH, 10 mm EDTA l i a t n i A N D % y r a r t i b r a ( e r o c s l a u s i V % of DNA in tail depends on DNA break frequency Electrophoresis: 0.8 V/cm, 30 min Neutralisation, DAPI stain, fluorescence microscopy DNA breaks per 10 9 daltons

7 The comet assay (single cell gel electrophoresis) a simple and versatile method for measuring DNA breaks. Widely used in genotoxicity testing, human biomonitoring, ecogenotoxicology, and fundamental research into mechanisms of DNA damage and repair. The assay is made more sensitive and specific by incorporation of DNA repair enzymes that convert damaged bases to breaks (endonuclease III for oxidised pyrimidines, formamidopyrimidine DNA glycosylase [FPG] for oxidised purines, T4endoV for UV damage, AlkA for alkylated purines)

8 The comet assay (modified with lesion-specific enzymes) Cells embedded in agarose on microscope slide Lysis: Triton X-100, 2.5 M NaCl Nucleoids; supercoiled DNA Digestion with lesion-specific endonuclease Alkaline incubation: 0.3 M NaOH, 10 mm EDTA The frequency of damaged bases is given by the increase in DNA breaks in the presence of the specific endonuclease Electrophoresis: 0.8 V/cm, 30 min Neutralisation, DAPI stain, fluorescence microscopy This assay allows us to estimate the level of base damage in cells (e.g. lymphocytes)

9 D N A breaks (arbi trary uni ts) D N A breaks (arbi trary uni ts) The frequency of damaged bases is given by the increase in DNA breaks in the presence of the specific endonuclease Lymphocytes from ~30 healthy subjects: measurement of strand breaks ± FPG-sensitive sites pl us FPG no FPG net FPG - sensi t i ve si t es Subj ects Subj ects Net FPG-sensitive sites are calculated from the difference (± enzyme)

10 Increasing throughput A limitation of the standard comet assay is the number of samples that can be analysed in a single experiment; around 40 gels in a standard tank.

11 High throughput methods were developed in the recent COMICS project: Twelve mini-gels on a standard glass slide or a GelBond film with up to 96 mini-gels.

12 For the 12-gel system, we developed a chamber device (now commercially available) that allows individual treatment of gels with reagents or enzymes: The slide is clamped under a gasket with holes matching the gel positions.

13

14 Genotoxicity testing

15 Enhancing sensitivity FPG is widely used in human biomonitoring to measure oxidised purines. However, the enzyme recognises other kinds of damage - either directly, or via secondary oxidative damage. It can greatly increase the sensitivity of detection of various lesions in genotoxicity testing. We carried out a trial with TK-6 cells treated with cytotoxic and non-cytotoxic chemicals, and with known genotoxins (+ S9 if necessary) at ~non-cytotoxic concentrations. [Azqueta et al. (2013) Mutagenesis 28, ]

16 Non-cytotoxic: Broken line: proliferation index Strand breaks (lysis only) FPG-sites (net) No strand breaks, and no FPG-sensitive sites

17 Cytotoxic: Broken line: proliferation index Strand breaks (lysis only) FPG-sites (net) DNA strand breaks, but at cytotoxic concentrations

18 Genotoxic: Broken line: proliferation index Strand breaks (lysis only) FPG-sites (net)

19 Genotoxic: Broken line: proliferation index Strand breaks (lysis only) FPG-sites (net) The use of FPG in the comet assay should significantly reduce the risk of false negatives when testing novel chemicals

20 DNA repair

21 DNA repair DNA damage as measured in cells represents a dynamic steady state a balance between input of damage and its repair. Input (free radicals) antioxidants apoptosis mutation Oxidised bases? in DNA DNA repair So DNA repair is an important factor in defining an individual s genetic stability status.

22 DNA repair DNA damage is the first step in carcinogenesis; but almost all damage that occurs is repaired. DNA repair capacity is regarded as an intrinsic biomarker of individual susceptibility; the higher the repair rate, the lower the cancer risk. It is likely that repair rates are influenced by genetic polymorphisms, but also by environmental factors exposure to DNA-damaging agents (inducing appropriate DNA repair pathways), and perhaps micronutrients.

23 DNA repair pathways that can be studied with the comet assay: Strand break (SB) rejoining insertion of missing nucleotide and ligation. Base excision repair (BER) (oxidised or alkylated DNA) a specific glycosylase removes the base, leaving an AP site, which is then cleaved. A DNA polymerase fills the gap; finally, ligation. Nucleotide excision repair (NER) (bulky adducts, UV-induced pyrimidine dimers) a repair protein complex removes an oligonucleotide containing the damage; gap-filling by DNA polymerase is followed by ligation.

24 The simplest approach to measuring DNA repair is to treat cells with a DNA-damaging agent, incubate the cells, and measure remaining damage at intervals. To measure SB rejoining, cells were treated with H 2 O 2. For BER of oxidised bases, cells were irradiated with visible light in the presence of photosensitiser Ro to induce 8- oxogua. Remaining damage was detected with FPG. SB rejoining Blue: HeLa cells Red: Caco2 cells BER of 8-oxoGua

25 For BER and NER, we developed an alternative in vitro assay, suitable for assaying repair capacity in samples of lymphocytes from human trials. A cell extract is incubated with nucleoids containing specific DNA damage - 8-oxoGua for BER, and UV-induced pyrimidine dimers for NER. Strand breaks (incision events incomplete repair sites) accumulate and are measured with the comet assay.

26 In vitro assay for BER DNA damage to substrate cells Lymphocytes Cell-free extract Incubation with extract: DNA substrate incised. Cells damaged with Ro (photosensitiser) + light, to induce 8-oxoGua, provide substrate nucleoids to measure activity of 8-oxoGua DNA glycosylase (OGG). Alkaline treatment Electrophoresis % DNA in comet tail indicates break frequency. Rate of accumulation of breaks is a measure of OGG repair activity. No extract Plus extract

27 DNA repair measured in humans Lymphocyte samples taken from ~30 subjects on two occasions. Assayed for BER and NER Correlation between 2 samples; i.e. subjects have characteristic repair rates. Wide range of values for different subjects; plenty of scope for investigating environmental and A promising biomarker assay genetic influences. [Gaivão et al. (2009) Cell Biol Toxicol 25, 45-52]

28 Applying the comet assay in human biomonitoring An example nutritional effects on DNA damage and repair

29 Kiwifruit intervention trial I II III Samples: * * * * * * Kiwifruit 3 weeks of supplementation 14 volunteers, in 3 groups. Crossover design, different doses, with washout periods between. [Collins et al. (2003) Carcinogenesis, 24, 511]

30 H 2 O 2 -induced breaks (arb. units) Ex vivo H2O2 challenge i n u y r a r t i b r a ( H 2 O 2 -induced DNA breaks decreased s k a e r b d e c u d n i - 2 O H P<0.001 P=0.05 P= Kiwifruits per day

31 FPG sites (arbitrary units) EndoIII sites (arbitrary units) ) s t i n u y r a r t i b r a ( s e t i s Endogenous damage Oxidised pyrimidines decreased P=0.04 t i b r a ( s e t i s I I I o d n E P<0.01 P<0.01 P= Kiwifruits per day G P F Kiwifruits per day Oxidised purines decreased

32 mrna ratio DNA repair rate (arb. units) DNA repair (BER) Base excision repair (OGG) enhanced y r a r t i b r a ( e t a r r i a p e r P=0.001 Before After P=0.03 P<0.001 A N D Kiwifruits per day but no effect at level of gene expression (APE1, OGG1)

33 A recent application in ophthalmology Lens epithelium from 11 cataract patients. FPG-sites were relatively high and endoiii-sites relatively low, compared with lymphocytes. [Osnes-Ringen et al. (2013) Acta Ophthalm. 91, ]

34 Leukocytes from frozen blood Till now, human biomonitoring has depended on isolation of peripheral blood mononuclear cells ( lymphocytes ). But it was recently shown that the comet assay could be performed on whole blood after freezing at -20 C (in small volumes). We improved this procedure by isolating leukocytes from the frozen/thawed blood. After thorough washing, the cells perform well in the comet assay, with or without FPG. This procedure has substantial advantages for biomonitoring: quick freezing, no need for -70 C freezer, small volumes of blood. How reliable is it?

35 Leukocytes from frozen blood Ten subjects, whole blood frozen for ~1 year, then leukocytes isolated. SBs, FPG-sites, and H 2 O 2 -induced breaks measured. SBs FPGsites H 2 O 2 - breaks [Akor-Dewu, MB et al. (2014) Cell Biochem. Funct. 32, ]

36 Leukocytes from frozen blood There was a good correlation between FPG-sites and H 2 O 2 -induced breaks both reflecting individual redox status. This concordance suggests that what we are measuring has real biological significance.

37 Summary: the comet assay in 2015 The assay of choice for specific DNA damage High throughput, miniaturisation Genotoxicity testing with extra sensitivity DNA repair - useful in vitro biomarker assays Ongoing applications, in nutrition, occupational and environmental exposure, ecogenotoxicology etc. Assays possible on leukocytes from frozen blood Novel clinical applications, e.g. in ophthalmology

38 Thanks to: Amaya Azqueta, Sergey Shaposhnikov, Isabel Gaivão, Torgrim Langleite, Yolanda Lorenzo, Maryam Dewu, Lena Bilyk, Naouale El-Yamani (Nutrition, University of Oslo) Bjørn Nicolaissen, Øyvind Ringen (Ophthalmology, University Hospital, Oslo) Maria Dusinska (NILU, Norway) Former colleagues in Aberdeen (Rowett Research Institute, Aberdeen, UK)

COMICS: developing high throughput comet assays for DNA damage and DNA repair

COMICS: developing high throughput comet assays for DNA damage and DNA repair COMICS: developing high throughput comet assays for DNA damage and DNA repair Amaya Azqueta, on behalf of COMICS partners Department of Nutrition University of Oslo is an EC strategic targeted project

More information

Using the comet assay to study DNA repair: progress in the past decade.

Using the comet assay to study DNA repair: progress in the past decade. Using the comet assay to study DNA repair: progress in the past decade. Dr. Sabine A.S. Langie Flemish Institute for Technological Research (VITO) UKEMS Young Scientist Award 2014 DNA Repair NER UV BER

More information

Single cell gel electrophoresis: Detection of DNA damage at different levels of sensitivity. Nucleic acids. 1 Introduction

Single cell gel electrophoresis: Detection of DNA damage at different levels of sensitivity. Nucleic acids. 1 Introduction Electrophoresis 1999, 20, 2133±2138 2133 Karel J. Angelis 1 Mµria DusÏinskµ 2 Andrew R. Collins 3 Single cell gel electrophoresis: Detection of DNA damage at different levels of sensitivity 1 Institute

More information

High throughput comet assay to study genotoxicity of nanomaterials

High throughput comet assay to study genotoxicity of nanomaterials High throughput comet assay to study genotoxicity of nanomaterials Naouale EL Yamani Health Effects Laboratory, GLP certified Department of Environmental Chemistry, ISO certified Norwegian Institute for

More information

Use of Single Cell Gel Electrophoresis (Comet Assay) Modifications for Analysis of DNA Damage

Use of Single Cell Gel Electrophoresis (Comet Assay) Modifications for Analysis of DNA Damage 70 Gen. Physiol. Biophys. (1999), 18, Focus Issue, 70 74 Use of Single Cell Gel Electrophoresis (Comet Assay) Modifications for Analysis of DNA Damage E. HORVÁTHOVA, D. SLAMEŇOVÁ AND A. GÁBELOVÁ Cancer

More information

Tecniche di biodosimetria: COMET ASSAY. Giorgia Aversa Mail: om

Tecniche di biodosimetria: COMET ASSAY. Giorgia Aversa Mail: om Tecniche di biodosimetria: COMET ASSAY Giorgia Aversa Mail: giorgiaversa@gmail.c om The Comet Assay, also known as the Single Cell Gel Electrophoresis Assay, is a rapid, sensitive and relatively simple

More information

Does the duration of lysis affect the sensitivity of the in vitro alkaline comet assay?

Does the duration of lysis affect the sensitivity of the in vitro alkaline comet assay? Mutagenesis, 2015, 30, 21 28 doi:10.1093/mutage/geu047 Original Article Original Manuscript Does the duration of lysis affect the sensitivity of the in vitro alkaline comet assay? José Manuel Enciso, Oscar

More information

Zhor Senhaji Mouhri PhD Student Cancer Drug Discovery Lab, RI MUHC

Zhor Senhaji Mouhri PhD Student Cancer Drug Discovery Lab, RI MUHC The Comet Assay: DNA damage and beyond Molecular and Clinical Radiobiology Workshop McGill University Health Centre, June 17-19, 2015 Zhor Senhaji Mouhri PhD Student Cancer Drug Discovery Lab, RI MUHC

More information

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) HTS Comet Assay with and without FPG - 20 wells Comet assay with and without FPG using Trevigen 20-well slides

More information

The Need for a PARP Pharmacodynamic Assay

The Need for a PARP Pharmacodynamic Assay The Need for a PARP Pharmacodynamic Assay Version 05/07/09 amsbiotechnology(europe)ltd info@amsbio.com www.amsbio.com (UK)+44(0)1235828200 (CH)+41(0)916045522 (DE)+49(0)69779099 DNA Repair Pathways Base

More information

hogg1 recognizes oxidative damage using the comet assay with greater specificity than FPG or ENDOIII

hogg1 recognizes oxidative damage using the comet assay with greater specificity than FPG or ENDOIII Mutagenesis vol. 21 no. 3 pp. 185 190, 2006 Advance Access Publication 5 April 2006 hogg1 recognizes oxidative damage using the comet assay with greater specificity than FPG or ENDOIII doi:10.1093/mutage/gel019

More information

GENETICS - CLUTCH CH.17 MUTATION, REPAIR, AND RECOMBINATION

GENETICS - CLUTCH CH.17 MUTATION, REPAIR, AND RECOMBINATION !! www.clutchprep.com CONCEPT: TYPES OF MUTATIONS There are many different types of The first way to classify mutations is to describe how they arise - Spontaneous mutations are changes that randomly occur

More information

Gene Mutation, DNA Repair, and Transposition

Gene Mutation, DNA Repair, and Transposition Gene Mutation, DNA Repair, and Transposition Mutations Are Classified in Various Ways Spontaneous mutations happen naturally and randomly and are usually linked to normal biological or chemical processes

More information

Genetics and Genomics Chapter 4 Questions

Genetics and Genomics Chapter 4 Questions Genetics and Genomics Chapter 4 Questions Multiple Choice Questions Question 4.1 Which, if any, of the following statements is false? a) Most of the inherited changes in our DNA arise because of exposure

More information

Single Cell Microarray for High Throughput Detection of DNA Damage

Single Cell Microarray for High Throughput Detection of DNA Damage Single Cell Microarray for High Throughput Detection of DNA Damage Example data Jing Ge, Jessica Fessler, Danielle Chow, and Bevin Engelward MIT Biological Engineering, Cambridge, MA Measuring DNA Damage

More information

OxiSelect Cellular UV-Induced DNA Damage ELISA Kit (CPD)

OxiSelect Cellular UV-Induced DNA Damage ELISA Kit (CPD) Product Manual OxiSelect Cellular UV-Induced DNA Damage ELISA Kit (CPD) Catalog Number STA-326 STA-326-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry!

Welcome to Class 18! Lecture 18: Outline and Objectives. Replication is semiconservative! Replication: DNA DNA! Introductory Biochemistry! Lecture 18: Outline and Objectives Welcome to Class 18! Introductory Biochemistry! l DNA Replication! l DNA polymerase! l the enzymatic reaction! l proofreading and accuracy! l DNA synthesis! l origins

More information

NEUTRAL COMET PROFILES: RELIABLE SYSTEM FOR ANALYSES OF DNA STRAND BREAKS DISTRIBUTION

NEUTRAL COMET PROFILES: RELIABLE SYSTEM FOR ANALYSES OF DNA STRAND BREAKS DISTRIBUTION Genetics and Plant Physiology 2015, Volume 5(1), pp. 10 14 Special Issue Project BG051PO001-3.3.06-0025 Support for training and development of young competitive experts in the field of physiology, phytochemistry,

More information

Genetic variations and Gene Rearrangements. Mutation

Genetic variations and Gene Rearrangements. Mutation Genetic variations and Gene Rearrangements Mutation Def.: It is a physical change of one or more nucleotide pairs in the DNA of a cell. The change is inherited by every descendant of the mutant cell. Classification:

More information

Aldehyde Site Detection Kit

Aldehyde Site Detection Kit Aldehyde Site Detection Kit Catalog Number KA1295 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

DNA Repair and Cancer

DNA Repair and Cancer DNA Repair and Cancer RPN 530 Oncology for Scientists Lecture: Oct 9, 2014 Thomas Melendy, PhD Depts: Microbiology & Immunology, and Biochemistry, UB SOM Office: 213 BRB, UB SOM TMelendy@buffalo.edu DNA

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

The Comet Assay How to recognise Good Data

The Comet Assay How to recognise Good Data The Comet Assay How to recognise Good Data William Barfield 4 th September 2015 ICAW Content Regulatory Genetic Toxicology JaCVAM trial overview and results Protocols Historical control data Statistics

More information

CometAssay Control Cells

CometAssay Control Cells Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay Control Cells CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4256-010-CC For Single Cell

More information

Nutritional modulation of DNA repair in a human intervention study

Nutritional modulation of DNA repair in a human intervention study Carcinogenesis vol.24 no.3 pp.511 515, 2003 Nutritional modulation of DNA repair in a human intervention study Andrew R.Collins 1 4, Vikki Harrington 2,3, Janice Drew 2 and Rachel Melvin 2 1 Institute

More information

CometAssay Control Cells

CometAssay Control Cells Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4256-010-CC Sufficient materials for 10 assays. i i

More information

The Ames test indicates the mutagenic potential of a compound

The Ames test indicates the mutagenic potential of a compound The Ames test indicates the mutagenic potential of a compound Developed by Bruce Ames Uses Salmonella strain with a mutation that makes bacterium unable to synthesize His Add compound to plate of Salmonella,

More information

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA

Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA 1 Biochemistry 302, February 11, 2004 Exam 1 (100 points) Name I. Structural recognition (very short answer, 2 points each) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed

More information

DNA damage - AP site- Assay Kit (Cell-Based)

DNA damage - AP site- Assay Kit (Cell-Based) ab133076 DNA damage - AP site- Assay Kit (Cell-Based) Instructions for Use For the detection of aldehyde sites in cells. This product is for research use only and is not intended for diagnostic use. 1

More information

S ingle cell gel electrophoresis, or the comet assay, continues to attract growing interest as a tool to study the

S ingle cell gel electrophoresis, or the comet assay, continues to attract growing interest as a tool to study the OPEN SUBJECT AREAS: CELL CULTURE BIOMARKER RESEARCH Received 11 September 2014 Accepted 5 November 2014 Published 26 November 2014 Correspondence and requests for materials should be addressed to M.S.C.

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

15.4 Single-Gene Mutations Cause a Wide Range of Human Diseases. Copyright 2009 Pearson Education, Inc.

15.4 Single-Gene Mutations Cause a Wide Range of Human Diseases. Copyright 2009 Pearson Education, Inc. 15.4 Single-Gene Mutations Cause a Wide Range of Human Diseases 1 2 Muscular dystrophy results from mutation in the gene encoding dystrophin. The more severe Duchenne muscular dystrophy (DMD) is typically

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

Neutral CometAssay Control Cells

Neutral CometAssay Control Cells Instructions For Research Use Only. Not For Use In Diagnostic Procedures Neutral CometAssay Control Cells Neutral CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4257-010-NC

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski

More information

Road to the Double Helix

Road to the Double Helix Road to the Double Helix Watson and Crick Missing layer means alternating pattern (major & minor groove) Hydrogen bonding A pairs with T G pairs with C Double helix fits the data! Franklin and Wilkins

More information

Figure 1: Genetic Mosaicism

Figure 1: Genetic Mosaicism I. Gene Mutations a) Germinal Mutations: occur w/in the DNA of stem cells that ultimately form gametes. These are the only mutations that can be transmitted to future generations. b) Somatic Mutations:

More information

MCB 110 SP 2005 Second Midterm

MCB 110 SP 2005 Second Midterm MCB110 SP 2005 Midterm II Page 1 ANSWER KEY MCB 110 SP 2005 Second Midterm Question Maximum Points Your Points I 40 II 40 III 36 IV 34 150 NOTE: This is my answer key (KC). The graders were given disgression

More information

Neutral CometAssay Control Cells

Neutral CometAssay Control Cells Instructions For Research Use Only. Not For Use In Diagnostic Procedures Neutral CometAssay Control Cells For Single Cell Gel Electrophoresis Assay Catalog # 4257-010-NC Sufficient materials for 10 assays.

More information

DNA Damage & Repair Reagents

DNA Damage & Repair Reagents DNA Damage & Repair Reagents Fpg FLARE Assay Kit Catalog Number 4040-100-FK Fpg FLARE Assay Kit Catalog Number: 4040-100-FK Reagent Kit for the Analysis of DNA Damage in Single Cells Using the CometAssay

More information

LECTURE 26. a) A light-independent repair mechanism that involves three steps:

LECTURE 26. a) A light-independent repair mechanism that involves three steps: LECTURE 26 DNA REPAIR A. The capability for repair of damaged DNA is found in one form or another in all organisms. Prokaryotes (e.g., E. coli) have five repair systems, whereas higher organisms (e.g.,

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

DNA replication. - proteins for initiation of replication; - proteins for polymerization of nucleotides.

DNA replication. - proteins for initiation of replication; - proteins for polymerization of nucleotides. DNA replication Replication represents the duplication of the genetic information encoded in DNA that is the crucial step in the reproduction of living organisms and the growth of multicellular organisms.

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

3/31/11. UV-Induced DNA Damage and Repair

3/31/11. UV-Induced DNA Damage and Repair UV-Induced DNA Damage and Repair Bacteriologists discovered in the 19 th Century that direct sunlight exposure was lethal to bacteria and other microorganisms. Subsequent studies showed the lethal action

More information

Chapter 10: Gene mutation 2002 by W. H. Freeman and Company Chapter 10: Gene mutation 2002 by W. H. Freeman and Company

Chapter 10: Gene mutation 2002 by W. H. Freeman and Company Chapter 10: Gene mutation 2002 by W. H. Freeman and Company Chapter 10 Gene Mutation: Origins and Repair Processes GAATTC GTATTC A a Overview Mutation changes one allelic form to another and is the ultimate source of genetic variation. Mutational variation underlies

More information

Three recently approved in vivo genotoxicity test guidelines

Three recently approved in vivo genotoxicity test guidelines Three recently approved in vivo genotoxicity test guidelines (Revised in February 2018) a. Title of the test guideline (year of original adoption, year of update) In Vitro Mammalian Cell Gene Mutation

More information

ELECTRONIC SUPPLEMENTARY INFORMATION (ESI)

ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 ELECTRONIC SUPPLEMENTARY INFORMATION (ESI) Naringin ameliorates radiation-induced hepatic damage

More information

Instructions. Starter Kit. CometChip Electrophoresis Starter Kit. Table of Contents. Cat# ESK. Catalog# ESK

Instructions. Starter Kit. CometChip Electrophoresis Starter Kit. Table of Contents. Cat# ESK. Catalog# ESK Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometChip Electrophoresis Starter Kit CometChip Electrophoresis Starter Kit Cat# 4260-096-ESK Catalog# 4260-096-ESK Table of Contents

More information

Cellular UV-Induced DNA Damage Staining Kit (CPD)

Cellular UV-Induced DNA Damage Staining Kit (CPD) Cellular UV-Induced DNA Damage Staining Kit (CPD) For the rapid detection of CPDs in genomic DNA of cultured cells Cat. No. KT-918 For Research Use Only. Not for use in diagnostic procedures. Page 1 of

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into

More information

OxiSelect Cellular UV-Induced DNA Damage Staining Kit (6-4PP)

OxiSelect Cellular UV-Induced DNA Damage Staining Kit (6-4PP) Product Manual OxiSelect Cellular UV-Induced DNA Damage Staining Kit (6-4PP) Catalog Number STA-329 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Absorption of ultraviolet

More information

UV-Induced DNA Damage ELISA (CPD Quantitation)

UV-Induced DNA Damage ELISA (CPD Quantitation) KAMIYA BIOMEDICAL COMPANY UV-Induced DNA Damage ELISA (CPD Quantitation) For the rapid detection and quantitation of CPD in any DNA samples Cat. No. KT-914 For Research Use Only. Not for use in diagnostic

More information

CELL BIOLOGY - CLUTCH CH CELL DIVISION.

CELL BIOLOGY - CLUTCH CH CELL DIVISION. !! www.clutchprep.com CONCEPT: OVERVIEW OF THE CELL CYCLE There are three classes of cells based on whether they divide CELL TYPE Cells that do not divide Cells that normally do not divide, but can when

More information

Methods for Working with DNA and RNA

Methods for Working with DNA and RNA Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are

More information

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The

More information

Instructions. CometChip Electrophoresis Starter Kit. Catalog# ESK. High-throughput platform to treat and measure DNA damage on a single slide

Instructions. CometChip Electrophoresis Starter Kit. Catalog# ESK. High-throughput platform to treat and measure DNA damage on a single slide Instructions For Research Use Only. Not For Use In Diagnostic Procedures CometChip Electrophoresis Starter Kit Catalog# 4260-096-ESK High-throughput platform to treat and measure DNA damage on a single

More information

OxiSelect Cellular UV-Induced DNA Damage Staining Kit (CPD), Trial Size

OxiSelect Cellular UV-Induced DNA Damage Staining Kit (CPD), Trial Size Product Manual OxiSelect Cellular UV-Induced DNA Damage Staining Kit (CPD), Trial Size Catalog Number STA-327-T 32 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Absorption

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

ab Comet Assay Kit (3- well slides)

ab Comet Assay Kit (3- well slides) Version 1 Last updated 2 November 2018 ab238544 Comet Assay Kit (3- well slides) For the measurement of cellular DNA damage. This product is for research use only and is not intended for diagnostic use.

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,

More information

dna damage and repair

dna damage and repair 1 D N A D A M A G E A N D R E PA I R dna damage and repair The scope of this introductory chapter is to provide the reader a brief introduction on the topics discussed in this thesis: the molecular mechanisms

More information

Answer Key. Microbial Genetics, BIO 410/510 Winter Quarter 2015 Exam III. Name. Student ID# p

Answer Key. Microbial Genetics, BIO 410/510 Winter Quarter 2015 Exam III. Name. Student ID# p Answer Key Name Student ID# p 1.) For a typical lytic phage, describe two types of gene products that you would expect to be expressed early after infection? (2pts) Gene products that are associated directing

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Oligo Clean & Concentrator Catalog Nos. D4060 & D4061 Highlights Quick (2 minute) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes, salts, enzymes, nucleotides,

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation)

OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation) Product Manual OxiSelect Nitrosative DNA/RNA Damage ELISA Kit (8- Nitroguanine Quantitation) Catalog Number STA- 825 STA- 825-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

Chapter 5. New Methods for Measuring Somatic Mutations

Chapter 5. New Methods for Measuring Somatic Mutations Chapter 5 New Methods for Measuring Somatic Mutations Contents Page Introduction............................................................ 73 Detection of Somatic Mutations in White Blood Cells.......................

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

OxiSelect 96- Well Comet Assay Kit

OxiSelect 96- Well Comet Assay Kit Product Manual OxiSelect 96- Well Comet Assay Kit Catalog Number STA- 355 STA- 355-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction DNA damage, due to environmental

More information

BIOMONITORING in Terra dei Fuochi

BIOMONITORING in Terra dei Fuochi HUMAN WELFARE BIOMONITORING in Terra dei Fuochi NEW MANHATTAN PROJECT- SCIENCE FOR PEACE THE WORLD OVER International Seminars 49 Session PROJECT- 17 COORDINATOR: Prof. F. Buonaguro BIOMONITORING 1 BIOMONITORING

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Research Article Is the Comet Assay a Sensitive Procedure for Detecting Genotoxicity?

Research Article Is the Comet Assay a Sensitive Procedure for Detecting Genotoxicity? SAGE-Hindawi Access to Research Journal of Nucleic Acids Volume, Article ID 54, 8 pages doi:.61//54 Research Article Is the Comet Assay a Sensitive Procedure for Detecting Genotoxicity? Satomi Kawaguchi,

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Antigen-Antibody reactions

Antigen-Antibody reactions Antigen-Antibody reactions Ag Ab reactions in vitro are known as Serological reactions. Help in :- 1. In the diagnosis of infections 2. Epidemiological surveys 3. Identification of infectious and noninfectious

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

MIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V

MIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V MIDTERM I NAME: Student ID Number: Question Maximum Points Your Points I 32 II 33 III 24 IV 30 V 31 150 Please write your name/student ID number on each of the following five pages. This exam must be written

More information

THE BASICS OF IMMUNOHISTOCHEMISTRY

THE BASICS OF IMMUNOHISTOCHEMISTRY THE BASICS OF IMMUNOHISTOCHEMISTRY Introduction Immunohistochemistry (IHC) identifies specific tissue components by means of a specific antigen/antibody reaction tagged with a visible label. IHC makes

More information

Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions

Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog #8928 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect chromosomes

More information

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures

More information

Loss of Cul3 in Primary Fibroblasts

Loss of Cul3 in Primary Fibroblasts PSU McNair Scholars Online Journal Volume 5 Issue 1 Humans Being: People, Places, Perspectives and Processes Article 15 2011 Loss of Cul3 in Primary Fibroblasts Paula Hanna Portland State University Let

More information

AP Biology. Scoring Guidelines

AP Biology. Scoring Guidelines 2017 AP Biology Scoring Guidelines College Board, Advanced Placement Program, AP, AP Central, and the acorn logo are registered trademarks of the College Board. AP Central is the official online home for

More information

Competency 1: The student will demonstrate knowledge of the safety regulations that must be implemented at the biotechnology laboratory by:

Competency 1: The student will demonstrate knowledge of the safety regulations that must be implemented at the biotechnology laboratory by: Common Course Number: BSC-4420-L Course Title: Biotechnology Laboratory Catalog Course Description: This course provides students with practical, hands-on laboratory experiences to supplement the BSC-4330

More information

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene Mutations Mutation The term mutation is derived from Latin word meaning to change.! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene!

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Electronic Supplementary Information. Simultaneously sensitive detection of multiple DNA glycosylases from lung

Electronic Supplementary Information. Simultaneously sensitive detection of multiple DNA glycosylases from lung Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Simultaneously sensitive detection of multiple DNA

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

The flow of Genetic information

The flow of Genetic information The flow of Genetic information http://highered.mcgrawhill.com/sites/0072507470/student_view0/chapter3/animation dna_replication quiz_1_.html 1 DNA Replication DNA is a double-helical molecule Watson and

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

ATPlite Assay Performance in Human Primary Cells

ATPlite Assay Performance in Human Primary Cells A P P L I C AT I O N N O T E Cell Viability Assays Author: Verena Brucklacher-Waldert Crescendo Biologics Cambridge, UK Assay Performance in Human Primary Cells Introduction In vitro assays using primary

More information

The comet assay, DNA damage, DNA repair and cytotoxicity: hedgehogs are not always dead

The comet assay, DNA damage, DNA repair and cytotoxicity: hedgehogs are not always dead Mutagenesis vol. 28 no. 4 pp. 427 432 Advance Access publication 29 April 2013 doi:10.1093/mutage/get018 The comet assay, DNA damage, DNA repair and cytotoxicity: hedgehogs are not always dead Yolanda

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

TUNEL Apoptosis Detection Kit (Green Fluorescence)

TUNEL Apoptosis Detection Kit (Green Fluorescence) TUNEL Apoptosis Detection Kit (Green Fluorescence) Item NO. KTA2010 Product Name TUNEL Apoptosis Detection Kit (Green Fluorescence) ATTENTION For laboratory research use only. Not for clinical or diagnostic

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

OxiSelect ROS Assay Kit

OxiSelect ROS Assay Kit Product Manual OxiSelect ROS Assay Kit Catalog Number STA-342 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Accumulation of reactive oxygen species (ROS) coupled with

More information

BCMB Chapters 34 & 35 DNA Replication and Repair

BCMB Chapters 34 & 35 DNA Replication and Repair BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair

More information