Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam I October 11, Secondary Structure and Thermodynamics (25 pts):
|
|
|
- Brooke Hill
- 5 years ago
- Views:
Transcription
1 Biochemistry 674 Nucleic Acids Your Name: Prof. Jason Kahn Exam I October 11, 2001 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded under any circumstances. Explanations should be concise and clear. You may need a calculator for this exam. No other study aids or materials are permitted. Generous partial credit will be given, i.e., if you don t know, guess. 1. Secondary Structure and Thermodynamics (25 pts): (a; 5 pts) Identify (name) the indicated secondary structure elements (numbered 1-5) in the RNA below. (b; 3 pts) What is the likely three-dimensional conformation of the junction labeled 6 above (sketch). What is this arrangement called (cf. trna in class)?
2 Biochemistry 674 Exam I, 10/11/01 2 / 8 (c; 9 pts) List the ten unique nearest-neighbor dinucleotides for DNA. In addition to the database of DH and DS values for forming each dinucleotide, what other thermodynamic parameters (in general) do the prediction programs use in order to make the most accurate possible predictions of RNA secondary structure? What additional information derived from looking out into genome land is most useful for predicting RNA secondary structure? (d; 8 pts) Briefly discuss the tradeoff between stability and specificity in designing oligonucleotide primers or hybridization probes.
3 Biochemistry 674 Exam I, 10/11/01 3 / 8 2. DNA Flexibility and Topology (23 pts): (a; 12 pts) A ~1000bp circular DNA with a DLk = -4 relative to relaxed can assume many different shapes. Sketch (1) the shape one would expect for free DNA just in buffer, (2) the shape observed if enough ethidium is bound to induce DTw = -6, (3) the shape expected if all superhelical strain appears as toroidal writhe, and (4) the shape expected if the DNA has a 42 bp heteroduplex (i.e. unpaired) region. [#3 is vaguely like the structure wrapped around the nucleosome, with several wrinkles we haven t studied yet.] Indicate node signs where appropriate (b; 5 pts) Why do intercalating dyes bind with higher affinity to negatively supercoiled DNA than to relaxed DNA?
4 Biochemistry 674 Exam I, 10/11/01 4 / 8 (c; 6 pts) Briefly describe what persistence length means. What effect would magically doubling the persistence length have on the Shore and Baldwin curve of J factor vs. length in bp? 3. Base Pairing and DNA geometry (18 pts): (a; 6 pts) Draw the structure of dttp, including the numbering of the sugar and the base and identifying the phosphates.
5 Biochemistry 674 Exam I, 10/11/01 5 / 8 (b; 12 pts) The miscoding oxidative lesion 8-oxoG (right) is much more likely than G itself to adopt the syn conformation. Why? Draw syn 8-oxoG with its sugar and propose (sketch) a likely base pairing partner for it in the context of an otherwise Watson-Crick helix. O H N O NH N dribose N NH 2
6 Biochemistry 674 Exam I, 10/11/01 6 / 8 4. RNA Tertiary structure (16 pts): (a; 4 pts) Briefly describe the A-minor motif. (b; 4 pts) What often constitutes the core of a large structured RNA?
7 Biochemistry 674 Exam I, 10/11/01 7 / 8 (c; 8 pts) It has been found that a given ssrna often adopts a more stable and ordered 3-D structure than the corresponding ssdna. What chemical difference between RNA and DNA is likely to be the cause of this, and why? Speculate on the interactions that might be responsible for stabilizing RNA but not DNA tertiary structure. 5. Miscellaneous (18 pts): (a; 8 pts) Why are roll, tilt, and twist the three base pair geometric parameters which are critical for describing long-range DNA shape (e.g. as opposed to slide, buckle, propeller twist etc.). Sketch a picture defining one of the angles (roll, tilt, or twist).
8 Biochemistry 674 Exam I, 10/11/01 8 / 8 (b; 2 pts) Name a molecular visualization program: (c; 8 pts) Some nucleic acid analogues made with sugars other than ribose can form stable base-paired structures which are not helical. Speculate on why (in terms of evolution) our own genetic material is in fact helical. Score: Question 1: out of 25: 2 Structure and Thermo Question 2: Question 3: Question 4: Question 5: out of 23: DNA Flexibility and Topology out of 18: Base Pairing and Geometry out of 16: RNA Tertiary Structure out of 18: Miscellaneous Total: out of 100
Biochemistry 661 Your Name: Nucleic Acids, Module I Prof. Jason Kahn Exam I (100 points total) September 23, 2010
Biochemistry 661 Nucleic Acids, Module I Your Name: Prof. Jason Kahn Exam I (100 points total) September 23, 2010 You have 60 minutes for this exam. Exams written in pencil or erasable ink will not be
b. (4) In the space below, draw a reasonable G G base pair. c. (2) Indicate major and minor grooves and 5 and 3 ends on the duplex DNA at the right.
Biochemistry 674: Nucleic cids Prof. Jason Kahn Exam I October 9, 1997 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded under any circumstances. Explanations
Exams written in pencil or erasable ink will not be re-graded under any circumstances.
Biochemistry 465 Section I March 4, 1999 Exam #1 Prof. Jason D. Kahn Your Printed Name: Your SS#: Your Signature: You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be
Biochemistry 465 Your Name: Biological Information Processing Prof. Jason Kahn Exam I (100 points total) March 2, 2006
Biochemistry 465 Biological Information Processing Your Name: Prof. Jason Kahn Exam I (100 points total) March 2, 2006 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not
Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam II (100 points total) November 17, 2005
Biochemistry 674 ucleic Acids Your ame: Prof. Jason Kahn Exam II (100 points total) ovember 17, 2005 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded under
Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam II (100 points total) November 13, 2006
Biochemistry 674 Nucleic Acids Your Name: Prof. Jason Kahn Exam II (100 points total) November 13, 2006 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
Gene Expression - Transcription
DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making
Introduction to Bioinformatics. Lecture 20: Sequencing genomes
Introduction to Bioinformatics Lecture 20: Sequencing genomes Nucleic Acid Basics Nucleic Acids Are Polymers Each Monomer Consists of Three Moieties: Nucleotide A Base + A Ribose Sugar + A Phosphate Nucleoside
Biochemistry 674 Your Name: Nucleic Acids Prof. Jason Kahn Exam II (100 points total) November 13, 2006
Biochemistry 674 Nucleic Acids Your Name: Prof. Jason Kahn Exam II (100 points total) November 13, 2006 You have 80 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded
Understanding DNA Structure
Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction
Biochemistry 674, Fall, 1996: Nucleic Acids Final Exam: December 16, 1996 Your Name Here:
Biochemistry 674, Fall, 1996: Nucleic Acids Final Exam: December 16, 1996 Your Name Here: Prof. Jason Kahn This exam has six questions worth various numbers of points, for a total of 200. Answer all six.
Biochemistry 674: Nucleic Acids Your Name:
Biochemistry 674: Nucleic Acids Your Name: Exam II, November 18, 1997 Prof. Jason Kahn You do not need a calculator. Guess if you don t know. Give clear and concise answers. You have 85 minutes for this
Biochemistry 674, Fall, 1995: Nucleic Acids Exam II: November 16, 1995 Your Name Here: PCR A C
CHM 674 Exam II, 1995 1 iochemistry 674, Fall, 1995: Nucleic cids Prof. Jason Kahn Exam II: November 16, 1995 Your Name Here: This exam has five questions worth 20 points each. nswer all five. You do not
DNA, RNA Topology. Dr. Leena Barhate Department of Microbiology M.J.College, Jalgaon
DNA, RNA Topology Dr. Leena Barhate Department of Microbiology M.J.College, Jalgaon The DNA molecules in human chromosomes are linear. However, electron microscopic and other studies have shown that intact
Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
1. Transcription (40 pts):
BCHM 674: Nucleic Acids Final Exam, Dec. 20, 2005 Your Name: Prof. Jason Kahn You have 120 minutes for this exam, which is worth 150 points. Thus you get about the same points per minute as for the 80
(Due Sept 9 th ) Problem Set 2
Problem Set 2 (Due Sept 9 th ) 1. Consider these two polynucleotides: AAGCGT GCACTG a. Draw each molecule in the 2 deoxy form (DNA). SEE BELOW b. What is the sequence of the complementary strand? Write
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
Structure of nucleic acids II Biochemistry 302. Bob Kelm January 21, 2005
Structure of nucleic acids II Biochemistry 302 Bob Kelm January 21, 2005 http://biochem.uvm.edu/courses/kelm/302 User: student PW: nucleicacid Secondary structure of RNAs antiparallel A-form Fig. 4.19
Structure of nucleic acids II Biochemistry 302. January 20, 2006
Structure of nucleic acids II Biochemistry 302 January 20, 2006 Intrinsic structural flexibility of RNA antiparallel A-form Fig. 4.19 High Temp Denaturants In vivo conditions Base stacking w/o base pairing/h-bonds
Types of nucleic acid
RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have
MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
NUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
Structural Bioinformatics GENOME 541 Spring 2018
Molecular composition of a rapidly dividing Escherichia coli cell Structural Bioinformatics GENOME 541 Spring 2018 Lecture 4: Nucleic Acids Frank DiMaio (dimaio@uw.edu) The major biopolymers DNA structure
Chapter 11 Structure of Nucleic Acids
Reginald H. Garrett Charles M. Grisham Chapter 11 Structure of Nucleic Acids 11.1 How Do Scientists Determine the Primary Structure of Nucleic Acids? Two simple tools have made nucleic acid sequencing
Biochemistry 673 Your Name: Regulation of Metabolism Assoc. Prof. Jason Kahn Midterm Exam (100 points total) October 19, 2007
Biochemistry 673 Your Name: Regulation of Metabolism Assoc. Prof. Jason Kahn Midterm Exam (100 points total) October 19, 2007 You have 50 minutes for this exam. Explanations should be concise and clear,
BIOL 5304 Molecular Biology Fall 2018 Name. Homework #1 Due Monday, September 10 at 10:00 AM. 80 points - 1 -
BIOL 5304 Molecular Biology Fall 2018 ame omework #1 Due Monday, September 10 at 10:00 AM 80 points - 1 - 1. (20 points-maximum) For each item at the left, find all the descriptions on the right that apply
Nucleic Acids. Information specifying protein structure
Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information
Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids
Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
BASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Assembly and Characteristics of Nucleic Acid Double Helices
Assembly and Characteristics of Nucleic Acid Double Helices Patterns of base-base hydrogen bonds-characteristics of the base pairs Interactions between like and unlike bases have been observed in crystal
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
MCB 102 University of California, Berkeley July 28-30, Problem Set 6
MCB 102 University of California, Berkeley July 28-30, 2009 Isabelle Philipp Handout Problem Set 6 The answer key will be posted by Tuesday July 28. Try to solve the problem sets always first without the
Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Appendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
Molecular Biology. Code: ECTS Credits: 6. Degree Type Year Semester
2017/2018 Molecular Biology Code: 100858 ECTS Credits: 6 Degree Type Year Semester 2500252 Biochemistry OB 2 2 Contact Name: Joan-Ramon Daban Email: JoanRamon.Daban@uab.cat Prerequisites Use of languages
Determine the primary structure of nucleic acids. Structure of nucleic acids. The nucleotide sequence of DNA
Determine the primary structure of nucleic acids Structure of nucleic acids 1975, determining the primary structure of nucleic acids (the nucleotide sequence) was more formidable problem than amino acid
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
Student Name Biochem. 461 Exam 1 Key, September 23, 2010
Student Name Biochem. 461 Exam 1 Key, September 23, 2010 (100 POINTS TOTAL) ANSWER ALL QUESTIONS IN THE SPACES PROVIDED [10 pts] We will learn in Chapter 28 that ribonuclosides and deoxyribonucleosides
RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
The discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review nucleic acid New double helix nucleosome Discovery
Molecular biology lecture #2
Molecular biology lecture #2 In the previous lecture, we got to chapter 12. We talked about DNA structure and reached the Watson and Crick model and the double helix. Today, we are going to finish chapter
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
The discovery that DNA is the genetic code involved many experiments.
Section 1: The discovery that DNA is the genetic code involved many experiments. K What I Know W What I Want to Find Out L What I Learned Essential Questions Which experiments led to the discovery of DNA
MBMB,BCHM, or CHEM 451A
MBMB,BCHM, or CHEM 451A This is a team taught course Blaine Bartholomew: 1 st section Joseph Schmit: 2 nd section Peter Hardwicke:3 rd Section Text is Lehninger Principles of Biochemistry 4 th edition
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 49-52, 118-119, 130 Nucleic acids 2 types: Deoxyribonucleic acid
DNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA
DNA Structures Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag The Structural Conformations of DNA 1. The principle message of this lecture is that the structure of DNA is much more flexible
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
Biochemistry 302, February 11, 2004 Exam 1 (100 points) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed DNA
1 Biochemistry 302, February 11, 2004 Exam 1 (100 points) Name I. Structural recognition (very short answer, 2 points each) 1. What form of DNA is shown on this Nature Genetics cover? Z-DNA or left-handed
1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
Structure of DNA [pln39]
![Structure of DNA [pln39]](/thumbs/77/76253099.jpg "Structure of DNA [pln39]")
Structure of DNA [pln39] Deoxyribonucleic acid (DNA) consists of two biopolymer strands cross-linked into a double helix. Each strand is a polynucleotide. Composition of nucleotide: nucleobase: guanine
Molecular biology (1)
2018/9/24 Molecular biology (1) Important. 436 Notes Original slides. 438 notes Extra information Objectives: Know the central dogma of molecular biology. Understand the composition, types and structure
M1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
Final exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
10BT43 Structural Biology
10BT43 Structural Biology Unit III Structure of Nucleic Acids 1. General characteristics of nucleic acid structures (A, T, G, C, U), Base-pairing 2. Base pairing types, glycosidic bond, Ribose puckering,
Chapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Genetics Genome Chromosome Gene Protein Genotype Phenotype 2 Terms and concepts gene Fundamental unit of heredity
Molecular Biology - The Structure of DNA *
OpenStax-CNX module: m49482 1 Molecular Biology - The Structure of DNA * Jerey Mahr Based on The Structure of DNA by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
DNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.
DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use
Macromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
DNA Replication. Back ground.. Single celled zygote goes from being single celled to 100 trillion more cells in over 240 days in humans! Wow!
DNA Replication Back ground.. Single celled zygote goes from being single celled to 100 trillion more cells in over 240 days in humans! Wow! Must be fast! six billion base pairs in a single human cell
Genome Replication. Topological Problems. Mitesh Shrestha
Genome Replication Topological Problems Mitesh Shrestha Watson-Crick scheme for DNA replication Topological problem and its solution The most trivial of difficulties during DNA replication is the possibility
DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav
DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of
وراثة األحياء الدقيقة Microbial Genetics
وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
Roadmap. The Cell. Introduction to Molecular Biology. DNA RNA Protein Central dogma Genetic code Gene structure Human Genome
Introduction to Molecular Biology Lodish et al Ch1-4 http://www.ncbi.nlm.nih.gov/books EECS 458 CWRU Fall 2004 DNA RNA Protein Central dogma Genetic code Gene structure Human Genome Roadmap The Cell Lodish
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush I. Hierarchical structure of nucleic acids II. Structures of nucleotides A. Purines & pyrimidines B. Nucleosides & nucleotides
Unit 3c. Microbial Gene0cs
Unit 3c Microbial Gene0cs Microbial Genetics! Gene0cs: the science of heredity Genome: the gene0c informa0on in the cell Genomics: the sequencing and molecular characteriza0on of genomes Gregor Mendel
DNA Topoisomerases relieve the supercoiling stress ahead of the fork
DNA Topoisomerases relieve the supercoiling stress ahead of the fork Tw 1) T w : # of turns around the central axis 2) W r : # of times the double helix crosses itself 3) Linking Number: L k = T w + W
Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
Geometry applied to DNA. Ángel Ferrández Izquierdo webs.um.es/aferr Departamento de Matemáticas Universidad de Murcia
Geometry applied to DNA Ángel Ferrández Izquierdo aferr@um.es webs.um.es/aferr Departamento de Matemáticas Universidad de Murcia Why Geometry (or better, Geometry & Topology) applied? Three (main and personal)
GENES AND CHROMOSOMES-I. Lecture 3. Biology Department Concordia University. Dr. S. Azam BIOL 266/
GENES AND CHROMOSOMES-I Lecture 3 BIOL 266/2 2014-15 Dr. S. Azam Biology Department Concordia University GENE AND THE GENOME Terms to remember. Base pairs Genes Histones Nucleosomes DNA Chromatids Chromosomes
BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
Module Overview. Lecture
Module verview Day 1 2 3 4 5 6 7 8 Lecture Introduction SELEX I: Building a Library SELEX II: Selecting RNA with target functionality SELEX III: Technical advances & problem-solving Characterizing aptamers
Figure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
Chapter 16. The Molecular Basis of Inheritance. Biology Kevin Dees
Chapter 16 The Molecular Basis of Inheritance DNA Life s instructions!!!! Deoxyribonucleic Acid Nucleic acid polymer from nucleotide monomers Unique in that it can: Self replicate Carry information History
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,