Nobel Prizes Module in Review: Experimental Approaches & Biological Concepts Day 8 Flow Cytometry
|
|
- Belinda Horton
- 5 years ago
- Views:
Transcription
1 MOD1 DNA ENGINEERING Engelward, Fall 09 Day 8 Nobel Prizes Module in Review: Experimental Approaches & Biological Concepts Flow Cytometry 2009 Szostak Blackburn (Greider) Szostak Model Telomerase Mario Capecci, Nobel Prize 2007 Jack W. Szostak, Terry L. Orr-Weaver, Rodney J. Rothstein and Franklin W. Stahl Terry Orr Weaver (MIT!) 1
2 2009 Module in Review Science Engineered Solutions Experimental Approaches PCR MELT 94 o C ANNEAL 55 o C EXTEND 72 o C 2
3 DNA Vectors & Purification Gel Electrophoresis Restriction Mapping & Data Analysis DNA Engineering: Ligation Figure by Justin Lo 3
4 Mammalian Cell Culture Flow Cytometry Flow Cytometry: First Principles, Alice L. Givan, 1992 Biological Principles DNA Damage & Repair via Homologous RecombinaFon 4
5 Sunlight Radiation Oxidative Radicals Cigarette Smoke Pollution & Food Nitric Oxide SDSA Base Lesions Single Strand Breaks Double Strand Breaks Szostak Model: Can lead to Crossover SDSA 5
6 A Plasmid-Based Assay for Homologous Recombination in Mammalian Cells Engineering an Assay for Homologous RecombinaFon Δ5 Δ3 + lipofect 48 hours Traditional ES Knock-Out Technology Targeted Homologous Recombination ExploiFng Homologous RecombinaFon for Gene TargeFng Long Arm Short Arm Neo hsvtk Your Favorite Gene Neo Your Favorite Gene 6
7 Genomic Instability: BRCA2: Without homologous recombinafon, cells suffer genomic instability Too Little HR: Mis-Repair of Broken Forks HR provides the only pathway to accurately repair broken replication forks Normal From Science To Engineered SoluFons BRCA2 Null Data from Grigorova et al., Cytogen. Gen. Res. 104:333 (2004) 7
8 Two Great Bioengineering Accomplishments Exploi=ng a tumor s Achilles Heel PARP Crea=ng new drug delivery technology Basic Principles of Key StaFsFcs Normal Distribu=on Standard Devia=on Confidence Interval Student s t Test Flow Cytometry 8
9 Principle of Fluorescence Activation See Specific Colors By Restricting Ex and Em: Flow Cytometry: First Principles, Alice L. Givan, 199 Your laser is 488 nm For Green, Can excite using <510 nm For Green, Can capture emission when >510 nm Spectra from Clontech, Inc Laser(s) Basic Optics Cell Dichroic mirrors PMTs turn light into analog signals Laser Light High angle scatter (Side Scatter): Reflection & refraction; structure. Low angle scatter (Forward Scatter): Diffraction. Cell size. Direct beam stop. Photo-multiplier tubes (PMTs) Slide Adapted FromTerry Hoy, Department of Haematology, UWCM Slide Adapted From Terry Hoy, Department of Haematology, UWCM 9
10 Sample Flow Flow Cytometry: First Principles, Alice L. Givan, 199 Flow Cytometry: First Principles, Alice L. Givan, 199 FACS = Fluorescence Activated Cell Sorting Electronic delay until cell reaches break off point. Then the stream is charged. Vibrating the nozzle produces a stream that breaks into droplets Flow Cytometry: First Principles, Alice L. Givan, 199 Flow Cytometry: First Principles, Alice L. Givan,
11 Rare Cells Expressing EGFP nm (FL-2) nm (FL-2) Normal Cells EGFP Expressing Cells Normal Cells Rare Cells Expressing EGFP nm (FL-1) EGFP Expressing Cells Rare Cells Expressing EGFP R nm (FL-1) nm (FL-2) nm (FL-2) nm (FL-1) Normal Cells EGFP Expressing Cells R nm (FL-1) 11
12 Flow Cytometry Flow cytometry analyzes cells one by one Fluorescence, diffracted, and reflected light can be measured for each cell Multiple lasers and multiple colors can be analyzed at millions of cells per minute Resulting plots show the relative level of fluorescence of each cell for specific wave lengths (a dot is a single cell) Key Experimental Concepts for Mod1: Nothing is 100% Ask What else might be happening? Avoid AssumpFons (Controls!) Double Check at Every Opportunity Flow cytometry is an analysis method, where as FACS actually sorts cells Our major goals are: To teach strong fundamentals in laboratory science & To inspire 12
Engelward, Spring 2008
MOD1 DNA ENGINEERING Engelward, Spring 2008 Day 1 About this Module Goals for this Module Brief background: Homologous recombination is not just for meiosis! Overview of the Experiment The Plasmid Construction
More informationMOD1 DNA ENGINEERING. Day 6. Why you owe Your Life to Homologous Recombina9on. Engelward, Fall Rad51 / Normal
MOD1 DNA ENGINEERING Engelward, Fall 2009 Lecture 1: Intro to importance of HR Polymerases & PCR Lecture 2: How HR works Overview of experiments & discussion of controls (single digests) Lecture 3: Why
More informationBevin Engelward, Agi Stachowiak, David Weingeist. Oral Presentation Instructor: Atissa Banuazizi. Spring Day 7
MOD1 DNA NGINRING Bevin ngelward, Agi Stachowiak, David Weingeist Writing Instructor: Neal Lerner Oral Presentation Instructor: Atissa Banuazizi Spring 008 Day 7 Overview of this Module s xperiments Restriction
More informationEngelward, Spring 2008
MOD1 DNA NGINRING ngelward, Spring 2008 Day 3 About the experiments in Mod1 how is recombination used to fix double strand breaks how your two plasmid assay works Agarose Gels How do we look at DNA? Anticipating
More informationMOD2 Day 5 (Engelward)
MOD2 Day 5 (Engelward) Day 5 Objectives: Extract DNA Analyze DNA by Restriction Mapping Start Recombination Assay (Lipofection) Day 6 Objective: Determine the frequency of Recombination between D3 and
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationALL INFECTOLOGY. and now. Gucker, 1947 Wallace Coulter Coulter Orifice, Kamentsky, 1965 Mack Fulwyler sorter BLOOD:
ALL BLOOD: RBC, PLT, WBC ( /-/ ) (+ LDH, carbamide, ESR, periphery blasts, liver function deviation, renal function dev.) Classification: Morphology + genetics+ immunology! B-cell: T-cell: Dedifferentiated:
More informationALL INFECTOLOGY COMMERCIALLY AVAILABLE DEVICES. and now BLOOD:
ALL BLOOD: RBC, PLT, WBC ( /-/ ) (+ LDH, carbamide, ESR, periphery blasts, liver function deviation, renal function dev.) Classification: Morphology + genetics+ immunology! B-cell: T-cell: Dedifferentiated:
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationMOD1 DNA ENGINEERING. Day 5. Why you owe Your Youthfulness to Homologous Recombina8on. Engelward, Fall Loss of Helicase Faulty Recomb.
MOD1 DN NGINRING ngelward, Fall 2009 Lecture 1: Intro to importance of HR Polymerases & PR Lecture 2: How HR works Overview of experiments & discussion of controls (single digests) Lecture : Why understanding
More informationAnatomy of a flow cytometer
Anatomy of a flow cytometer Fluidics Optics Electronics Cells in suspension flow in single-file through an illuminated volume where they scatter light and emit fluorescence that is collected, filtered,
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationDefinitions. What functions does a flow cytometer be able to do? The build of the Flow cytometry and sorting. Flow cytometry
The build of the Flow cytometry and sorting Flow cytometry Seminar Mónika Tóth 11-12-13.04.2011 Definitions Flow cytometry Process or measurement method can measure discrete properties physical, chemical,
More informationSecond Generation PARP1 Pharmacodynamic Assay
Second Generation PARP1 Pharmacodynamic Assay 1 What is a Pharmacodynamic Assay? Pharmacodynamic Assays: Provide evidence of drug action on molecular target. Guide drug development process. Base line values
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationseminar
seminar 02.26.-28.2013. Flow cytometry Process or measurement method can measure discrete properties physical, chemical, biochemical, biological parameters of separate particles, e.g. biological cells
More informationBENG 183 Trey Ideker (the details )
BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and
More informationManipulating genes and cells (Kap. 10)
Manipulating genes and cells (Kap. 10) restriction enzymes and agarose gel electrophoresis DNA sequencing nucleic acid hybridization techniques genomic and cdna libraries cloning of DNA PCR and PCR applications
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationBasic Principles in Flow Cytometry. Flow Cytometry
Basic Principles in Flow Cytometry Flow Cytometry» Flow Cytometry is the technological process that allows for the individual measurements of cell fluorescence and light scattering. This process is performed
More informationCh.15 Section 4 Regulation of Gene Expression pgs Complete the attached Active Reading Guides for the above sections.
AP Biology 2018-2019 Summer Assignment Due Wednesday 9/5/2018 Text Book Reading Ch.13 The Molecular Basis of Life pgs. 245-267 Ch.15 Section 4 Regulation of Gene Expression pgs. 307-309 Active Reading
More informationChapter 19 RECOMBINATION AND TRANSPOSITION AT THE MOLECULAR LEVEL. Ref: Genetics (Analysis & Principles), 5 th ed by Robert Brooker, Chapter 19 1
hapter 19 REOMBINATION AND TRANSPOSITION AT THE MOLEULAR LEVEL Ref: Genetics (Analysis & Principles), 5 th ed by Robert Brooker, hapter 19 1 INTRODUTION Genetic recombination involves chromosomes breaking
More informationCh.15 Section 4 Regulation of Gene Expression pgs Complete the attached Active Reading Guides for the above sections.
AP Biology 2018-2019 Summer Assignment Due Wednesday 9/5/2018 Text Book Reading Ch.13 The Molecular Basis of Life pgs. 245-267 Ch.15 Section 4 Regulation of Gene Expression pgs. 307-309 Active Reading
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationFLUORESCENCE. Matyas Molnar and Dirk Pacholsky
FLUORESCENCE Matyas Molnar and Dirk Pacholsky 1 Information This lecture contains images and information from the following internet homepages http://micro.magnet.fsu.edu/primer/index.html http://www.microscopyu.com/
More informationFlowcytometry Dirk Pacholsky
Flowcytometry Dirk Pacholsky Flowcytometry: Overview 1 2 Overview Flow Cyto Metry Fluid Cell Measurement measuring cell properties of cells in suspension Most Flow Cytometer have Spatially separated Lasers
More informationSupplementary Figure 1
Supplementary Figure 1 Cell cycle distribution (%) 1 8 6 4 2 Cell Cycle G1 S G2 Viability (%) 5 4 3 2 1 Viability Supplementary Figure 1. Cell cycle distribution and viability during DSB repair measurements.
More informationTRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:
Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated
More informationThe Need for a PARP Pharmacodynamic Assay
The Need for a PARP Pharmacodynamic Assay Version 05/07/09 amsbiotechnology(europe)ltd info@amsbio.com www.amsbio.com (UK)+44(0)1235828200 (CH)+41(0)916045522 (DE)+49(0)69779099 DNA Repair Pathways Base
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationAssays for gene expression and protein production
Assays for gene expression and protein production Module 3, Lecture 5! 20.109 Spring 2011! Topics for Lecture 5 Measuring protein levels! Measuring transcript levels! Imaging assays! 2 Module overview:
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationPre-made Reporter Lentivirus for p53 Signal Pathway
Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:
More informationIntroduction to Flow Cytometry: A Learning Guide
11-11032-03 rev. A December 2002 Introduction to Flow Cytometry: A Learning Guide Introduction to Flow Cytometry: A Learning Guide Copyright 2002 Becton, Dickinson and Company. All rights reserved. No
More informationDonor DNA Utilization during Gene Targeting with Zinc- finger Nucleases
Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases Kelly J. Beumer, Jonathan K. Trautman, Kusumika Mukherjee and Dana Carroll Department of Biochemistry University of Utah School of
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationChapter 13-The Molecular Basis of Inheritance
Name Fred and Theresa Holtzclaw AP Biology Reading Guide Copyright 2010 Pearson Education, Inc. Chapter 13-The Molecular Basis of Inheritance 13.1 DNA is the genetic material 1) What are the two chemical
More informationSystems assembly. 12 July
Systems assembly 12 July ZR Miniprep Kit from all the genes o AppA o PpsR o PrrA o PrrB o PrrA Promoter o PpsR Promoter Transformation of E. coli TOP10 13 July Colony PCR o Taq Buffer o MgCl2 o dntp s
More informationANAT 3231 Cell Biology Lab12 Stem Cell Analysis
ANAT 3231 Cell Biology Lab12 Stem Cell Analysis 2 June 2010 Dr Antonio Lee Neuromuscular & Regenera9ve Medicine Unit School of Medical Sciences, UNSW Introduction to Flow Cytometry Contributed by Vittoria
More informationLoss of Cul3 in Primary Fibroblasts
PSU McNair Scholars Online Journal Volume 5 Issue 1 Humans Being: People, Places, Perspectives and Processes Article 15 2011 Loss of Cul3 in Primary Fibroblasts Paula Hanna Portland State University Let
More informationIntroduction to Flow Cytometry:
Introduction to Flow Cytometry: A Learning Guide Manual Part Number: 11-11032-01 April, 2000 BD Biosciences 2350 Qume Drive San Jose, CA 95131-1807 1-800-448-2347 Introduction to Flow Cytometry: A Learning
More informationIntroduction to. BD FACSAria TM Cell Sorter. Flow = Fluid Cyto = Cell Metry = Measurement
What is Flow Cytometry? Introduction to BD FACSAria TM Cell Sorter Flow = Fluid Cyto = Cell Metry = Measurement BD Biosciences Application Specialist 產品應用專員 Daisy Kuo 郭正佼 A variety of measurements are
More informationRecombination Models. A. The Holliday Junction Model
A. The Holliday Junction Model Recombination Models Fig. 1 illustrates the formation of a Holliday junction (I) and its branch migration (II).The branch point (the blue X ) at the left in I has moved towards
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationGetting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationPrinciples of flow cytometry: overview of flow cytometry and its uses for cell analysis and sorting. Shoreline Community College BIOL 288
Principles of flow cytometry: overview of flow cytometry and its uses for cell analysis and sorting Shoreline Community College BIOL 288 Flow Cytometry What is Flow Cytometry? Measurement of cells or particles
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationCRC Flow Cytometry Core Facility Knut och Alice Wallenbergs Stiftelse
CRC Flow Cytometry Core Facility CRC Flow Cytometry Core Facility Knut och Alice Wallenbergs Stiftelse CRC Flow Cytometry Core facility Instruments: 1. FACSCalibur: analyser, 6 parameters, 4 colors (BD),
More informationEctopic Gene Expression in Mammalian Cells
Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic
More informationSEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont
SEQUENCING DNA Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Start with PCR product (your end result of a PCR). Remember, your template DNA in the PCR was extracted DNA that included
More informationNature Structural and Molecular Biology: doi: /nsmb.2937
Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,
More informationFlow Cytometry For New PhDs
Flow Cytometry For New PhDs 2012 Simon Monard SCRM and CIR smonard@staffmail.ed.ac.uk Derek Davies CRUK derek.davies@cancer.org.uk Monday 20th and Tues 21st Feb 2012 Program Day 1: Day 2: Basics of flow
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationMontgomery County Community College BIT 220 Biotechnology Research 4-3-3
Montgomery County Community College BIT 220 Biotechnology Research 4-3-3 AY17-18 COURSE DESCRIPTION: This course provides a foundation for the principles of molecular genetics as they apply to research
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationChapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Spring 2001 Chapter 29 Lecture Notes. Slide 1. Slide 2.
BCH 4054 Spring 2001 Chapter 29 Lecture Notes 1 Chapter 29 DNA: Genetic Information, Recombination, and Mutation 2 DNA as the Genetic Material Griffith Experiment on pneumococcal transformation (Fig 29.1)
More informationChapter 29. DNA as the Genetic Material. Recombination of DNA. BCH 4054 Fall 2000 Chapter 29 Lecture Notes. Slide 1. Slide 2. Slide 3.
BCH 4054 Fall 2000 Chapter 29 Lecture Notes 1 Chapter 29 DNA: Genetic Information, Recombination, and Mutation 2 DNA as the Genetic Material Griffith Experiment on pneumococcal transformation (Fig 29.1)
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More information11/19/2013. Janine Zankl FACS Core Facility 13. November Cellular Parameters. Cellular Parameters. Monocytes. Granulocytes.
DEPARTEMENT BIOZENTRUM Janine Zankl FACS Core Facility 13. November 2013 Cellular Parameters Granulocytes Monocytes Basophils Neutrophils Lymphocytes Eosinophils Cellular Parameters 1 What Is Flow Cytometry?
More information2. Why did researchers originally think that protein was the genetic material?
AP Biology Chapter 13 Reading Guide The Molecular Basis of Inheritance Concept 13.1 DNA is the Genetic Material 1. What are the two chemical components of chromosomes? 2. Why did researchers originally
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationMolecular Biology Midterm Exam 2
Molecular Biology Midterm Exam 2 1. The experiments by Frank Stahl and Matthew Messelson demonstrated that DNA strands separate during DNA replication. They showed that DNA replication is what kind of
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationResearchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
More informationPrinciples of Real Time PCR Ameer Effat M. Elfarash
Principles of Real Time PCR Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg Types of PCR Standard PCR (conventional ) RT-PCR (Reverse Transcriptase PCR)
More informationCertificate of Analysis
Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631971
More informationMoFlo Astrios High-Speed Cell Sorter
MoFlo Astrios High-Speed Cell Sorter For Research Use Only. Not to be used in diagnostic procedures. Class I laser product. All trademarks are the property of their respective owners. MoFlo Fluidics Stable
More informationWake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics
Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Extra Resources Website: http://waa-science.weebly.com Module 1: Overview of DNA Vocabulary Term Definition (You may use an Internet
More informationCertificate of Analysis
Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631972
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationPLASMID INTEGRATION IN YEAST: CONCEPTIONS AND MISSCONCEPTIONS
Current Studies of Biotechnology Volume II. - Environment PLASMID INTEGRATION IN YEAST: CONCEPTIONS AND MISSCONCEPTIONS ZORAN ZGAGA, KREŠIMIR GJURAČIĆ 1, IVAN-KREŠIMIR SVETEC, PETAR T. MITRIKESKI AND SANDRA
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More informationTable 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
More informationBring a Molecular Cell Biology Laboratory into the Classroom of HKUST
Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Prof. Kathy Q. Luo and Prof. Donald C. Chang Dept. of Chemical Engineering, Bioengineering Graduate Program and Dept. of Biology HK
More informationLABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.
20.109 LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING MODULE 2 EXPRESSION ENGINEERING Lecture # 3 Leona Samson March 31 st 2009 Snapshot of the next four weeks We will eliminate the expression of various
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationCell analysis and bioimaging technology illustrated
Cell analysis and bioimaging technology illustrated The Cell Analysis Center Scientific Bulletin Part 1 Sysmex has been studying and exploring principles of automated haematology analysers, making full
More informationIntroduction to Flow Cytometry. -- BD FACSCanto II TM. Daisy Kuo Application Specialist BDBiosciences
Introduction to Flow Cytometry -- BD FACSCanto II TM Daisy Kuo Application Specialist E-mail: daisy_kuo@bd.com BDBiosciences Outline Basic Concept of Flow Cytometry FACSCanto II System Introduction Application
More informationDetection of bacterial aggregation by flow cytometry
Detection of bacterial aggregation by flow cytometry Jack Coleman 1 and Melis McHenry 2 1 Enzo Life Sciences, Farmingdale NY, USA, 2 Beckman Coulter Inc., Miami FL, USA PROTEOSTAT Aggresome Detection Kit
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green
More informationAGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14)
AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) - RECOMBINANT DNA TECHNOLOGY is the use of in vitro molecular techniques to isolate
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationUnit 6: Gene Activity and Biotechnology
Chapter 16 Outline The Molecular Basis of Inheritance Level 1 Items students should be able to: 1. Recognize scientists and the experiments that lead to the understanding of the molecular basis of inheritance.
More informationOrflo Application Brief 3 /2017 GFP Transfection Efficiency Monitoring with Orflo s Moxi GO Next Generation Flow Cytometer. Introduction/Background
Introduction/Background Cell transfection and transduction refer to an array of techniques used to introduce foreign genetic material, or cloning vectors, into cell genomes. The application of these methods
More informationModule 17: Genetic Engineering and Biotechnology, Student Learning Guide
Name: Period: Date: Module 17: Genetic Engineering and Biotechnology, Student Learning Guide Instructions: 1. Work in pairs (share a computer). 2. Make sure that you log in for the first quiz so that you
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationBD FACSMelody. Cell Sorter. The simple solution for consistent, quality results
BD FACSMelody Cell Sorter The simple solution for consistent, quality results The right instrument is needed for the best results Simplicity, affordability and quality are key Cell sorting is fast becoming
More informationProgrammable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors
Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram
More informationMultiplexed 3D FRET imaging in deep tissue of live embryos Ming Zhao, Xiaoyang Wan, Yu Li, Weibin Zhou and Leilei Peng
Scientific Reports Multiplexed 3D FRET imaging in deep tissue of live embryos Ming Zhao, Xiaoyang Wan, Yu Li, Weibin Zhou and Leilei Peng 1 Supplementary figures and notes Supplementary Figure S1 Volumetric
More informationDNA Topoisomerases relieve the supercoiling stress ahead of the fork
DNA Topoisomerases relieve the supercoiling stress ahead of the fork Tw 1) T w : # of turns around the central axis 2) W r : # of times the double helix crosses itself 3) Linking Number: L k = T w + W
More informationSelected Topics in Electrical Engineering: Flow Cytometry Data Analysis
Selected Topics in Electrical Engineering: Flow Cytometry Data Analysis Bilge Karaçalı, PhD Department of Electrical and Electronics Engineering Izmir Institute of Technology Outline Experimental design
More informationReview of techniques in flow cytometry. Peter Meeus Onze-Lieve-Vrouwziekenhuis, Aalst 5 may 2011, SCK/CEN Mol
Review of techniques in flow cytometry Peter Meeus Onze-Lieve-Vrouwziekenhuis, Aalst 5 may 2011, SCK/CEN Mol Cytometry definitions The counting and measuring of cells,... Mosby's Medical Dictionary, 8th
More informationAutomated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
More informationCELL CYCLE BASICS. G0/1 = 1X S Phase G2/M = 2X DYE FLUORESCENCE
CELL CYCLE BASICS Analysis of a population of cells replication state can be achieved by fluorescence labeling of the nuclei of cells in suspension and then analyzing the fluorescence properties of each
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationKickstart Biology. Year 11 and Year 12
Kickstart Biology Year 11 and Year 12 Year 11 workshops From 2019, we will be offering Kickstart Biology for Year 11 syllabus content. Building a strong foundation for students at this stage can encourage
More information