Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental Experimental Procedures DNA Constructs The mouse LMO4, Lhx3, SCL, SCL-F238G, SSDP1, NLI, NLI-DD (NLI aa 1-298) and NLI-LID (NLI aa 200-375) and human Gata2 and E47 were subcloned into pcs2 or pcdna3 (Invitrogen) vectors with hemaglutinin (HA) or flag epitope tag (Lee et al., 2008; Lee and Pfaff, 2003; Thaler et al., 2002), or pm (Clontech) encoding the Gal4-DNA-binding domain, or LexA- and B42-vectors for yeast two hybrid assays. Gata2 and NLI were cloned into bacterial expression vector pgex4t-1 (Amersham) for in vitro GST pull down assays or mammalian expression vector pebg for in vivo GST pull down assays. A ~190 nt fragment of mouse Gata2-enhancer and ~290 nt fragment of human Gata3-enhancer were amplified by PCR from mouse and human genomic DNA, respectively, using oligonucleotides following Gata2-enhancer-forward, 5 - GGACTAGTAGCTGCACAATGTGAGTGCACC; Gata2-enhancer-reverse, 5 - GCTCTAGATTCTCCTATCACAGGTACCCGG; Gata3-enhancer-forward, 5 - CCGCTCGAGTACTCTGGGAGCCCAGTGACCATGAG; Gata3-enhancer-reverse, 5 - CGCGGATCCTCTTGCTTTCTTTTTGACTCCACCAG. A single to four copies of Gata2/3-enhancers were cloned into synthetic- TATA-GFP reporter vector, pgl3:luc (Promega) or TK-LUC vector. E-box-GATA:LUC was created by subcloning five copies of the duplex oligonucleotides (5 -GGATCTCGCCAGGTGCTGCGTCCCGATAGGGGGATCC) into TK-LUC vector. SCL-F238G point mutant and m1-m6 mutants of Gata2/3-enhancer reporters were generated using a PCR-based mutagenesis method. Antibodies Immunohistochemistry, immunoprecipitation and western blotting assays were performed using the following antibodies: guinea pig anti-chx10 (Sharma et al., 1998), rabbit anti-lhx3 (Sharma et al., 1998), rabbit anti-gata2 (1:100, Santa Cruz # sc-9008), mouse anti-gata3 (1:100, Santa Cruz # sc-268), rabbit anti-gfp (1:1000, Molecular probes), goat anti-lacz (1:1000), mouse anti-ha (1:5000, Covance), goat anti-lmo4 (1:100, Santa Cruz #sc-11122), rabbit anti-gaba (1:2500, Chemicon AB131), rabbit anti-glycine (1:5000, Chemicon, AB139), guinea pig anti-vglut2 (1:5000, Chemicon, AB5907), mouse anti-ha (Covance), mouse anti-flag (Stratagene), mouse anti-gata2 (Santa Cruz, #267), goat anti-scl (Santa Cruz #sc-12982) and rabbit anti-nli (Thaler et al., 2002). Chromatin Immunoprecipitation (ChIP) Assay ChIP was performed in P19 cells or mouse spinal cord extracts. P19 cells were transiently transfected using Lipofectamine (Invitrogen) and harvested 36-48 hours later. Embryonic mouse spinal cords were micro-dissected at E14.5 and combined according to genotypes. Cells were fixed with 1% formaldehyde, washed with buffer I (10 mm EDTA, 0.5 mm EGTA, 0.25% TritonX100, 10 mm
HEPES ph6.5) and buffer II (0.2M NaCL, 1 mm EDTA, 0.5 mm EGTA, 10 mm HEPES ph6.5) sequentially, resuspended in lysis buffer (0.5% SDS, 5 mm EDTA, 25 mm Tris-HCl ph8.0, protease inhibitors), and sonicated briefly. Then the supernatants were collected, and diluted five times in dilution buffer (2 mm EDTA, 150 mm NaCl, 1% TritonX100, 20 mm Tris-HCl ph8.0, protease inhibitors), followed by an immunoclearing step with 1 μg of salmon sperm DNA, IgG and protein A agarose beads. Next, the cell lysates were subject to immunoprecipitation using a specific antibody and protein A agarose beads for two hours to overnight, followed by washing steps with TSE I buffer (0.1% SDS, 1% TritonX100, 2 mm EDTA, 150 mm NaCl, 20 mm Tris-HCl ph8.0), TSE II buffer (0.1% SDS, 1% TritonX100, 2 mm EDTA, 500 mm NaCl, 20 mm Tris-HCl ph8.0), buffer III (0.25M LiCl, 1% NP-40, 1% deocycholate, 1 mm EDTA, 10 mm Tris-HCl ph8.0) and TE buffer. Then genomic DNA fragments were eluted in elution buffer (1% SDS, 0.1 M NaHCO 3 ), followed by incubation at 65ºC for six hours for reverse cross-linkage, and treatment with proteinase K at 42ºC for two hours. Finally, genomic DNA fragments were purified using phenol/choloroform and concentrated. PCR was performed on immunopurified genomic DNA using the following primers: Gata2-e, forward 5 -CAACGCCTGTGGCCTCTACTA, reverse 5 - GCCCAGACCCAATGTGACTC; Gata3e forward 5 -GCGAGCAGGAGAGCAGTTTC, reverse 5 -GCACCTTCAGCAGACCACAC. Co-immunoprecipitation (CoIP) Assay HEK293 cells were transfected using Superfect (Qiagen), harvested 48 hours later, and resuspended in lysis buffer (120 mm NaCl, 1 mm EDTA, 0.5% NP-40, 50 mm Tris-HCl ph8.0, protease inhibitors). Then the cell lysates were subject to immunoprecipitation using a specific antibody and protein A agarose beads for two hours to overnight, followed by multiple washing steps with lysis buffer supplemented with 300 mm NaCl. The bound proteins were eluted by heating the beads in SDS gel-loading buffer (50 mm Tris-Cl ph6.8, 100 mm DTT, 2% SDS, 10% glycerol, 0.1% bromophenol blue) at 100ºC for 5 minutes. Eluted proteins were resolved by SDS-PAGE and visualized by western blotting. In vitro GST-pull Down Assay GST-tagged fusion proteins were inducibly expressed in E. coli BL21 strain and affinity purified from bacterial cell lysate using glutathione sepharose beads. The sepharose-bound GST fusion proteins were then incubated with in vitro translated [ 35 S]methionine-labeled proteins (TNT T7-coupled transcription translation kit, Promega) in GST-binding buffer (1% TritonX-100, 1 mm DTT, 25 mg/ml BSA and protease inhibitors in phosphate buffered saline) overnight at 4ºC with end-over-end mixing. Nonspecifically bound proteins were removed by washing 3 times with phosphate buffered saline. The bound proteins were eluted by heating the beads in SDS gel-loading buffer at 100ºC for 5 minutes. Eluted proteins were resolved by SDS-PAGE and visualized by autoradiography. In vivo GST-pull Down Assays GST tagged bait proteins were expressed from the mammalian GST expression vector pebg with or without HA-tagged SCL or SCL-F238G proteins and untagged LMO4, NLI proteins in HEK293 cells. Following lysis of the cells in lysis buffer (120 mm NaCl, 1 mm EDTA, 0.5% NP-40, 50 mm Tris-HCl ph8.0, protease inhibitors), GST-tagged proteins were affinity purified using glutathione sepharose beads. Unbound proteins were removed by washing the beads 3 times with phosphate buffered saline. The bound proteins were eluted by heating the beads in SDS gel-loading buffer at 100ºC for 5 minutes. Eluted proteins were resolved by SDS- PAGE and visualized by western blotting with anti-ha antibody.
Cell culture and luciferase assays HEK293 human embryonic kidney cell line and P19 mouse embryonic carcinoma cell line were used as described (Lee et al., 2005). For luciferase assays, HEK293 cells were transfected transiently 24 hours after seeding using Superfect reagent (Qiagen). To normalize transfection efficiency across samples, β-galactosidase expressed from an actin promoter was included. Total DNA concentration was made equal between samples by adding empty vector plasmids. 36-48 hours after transfection, cells were lysed and luciferase activity measured. Histograms show mean normalized luciferase units and error bars represent standard deviation. All transfections were repeated multiple times. Supplemental References Lee, S., Lee, B., Joshi, K., Pfaff, S. L., Lee, J. W., and Lee, S. K. (2008). A regulatory network to segregate the identity of neuronal subtypes. Dev Cell 14, 877-889. Lee, S. K., Lee, B., Ruiz, E. C., and Pfaff, S. L. (2005). Olig2 and Ngn2 function in opposition to modulate gene expression in motor neuron progenitor cells. Genes Dev 19, 282-294. Lee, S. K., and Pfaff, S. L. (2003). Synchronization of neurogenesis and motor neuron specification by direct coupling of bhlh and homeodomain transcription factors. Neuron 38, 731-745. Sharma, K., Sheng, H. Z., Lettieri, K., Li, H., Karavanov, A., Potter, S., Westphal, H., and Pfaff, S. L. (1998). LIM homeodomain factors Lhx3 and Lhx4 assign subtype identities for motor neurons. Cell 95, 817-828. Thaler, J. P., Lee, S. K., Jurata, L. W., Gill, G. N., and Pfaff, S. L. (2002). LIM factor Lhx3 contributes to the specification of motor neuron and interneuron identity through cell-type-specific protein-protein interactions. Cell 110, 237-249.