Recombinant adenoviruses. A TRB3-expressing adenovirus was generated through
|
|
- Cameron Casey
- 6 years ago
- Views:
Transcription
1 Materials and Methods Recombinant adenoviruses. A -expressing adenovirus was generated through homologous recombination between a linearized transfer vector pad-track and the adenoviral backbone vector pad-easy as described (1). pad- contained the fulllength murine cdna or variant with an NH 2 -terminal Flag-tag. In addition to the transgene the virus encoded the green fluorescent protein (GFP) transcribed from an second independent CMV promoter. GFP expression was used to monitor viral infection efficiency. An adenovirus coding for GFP only (pad-gfp) was used as a control in all experiments. Viruses were purified by the CsCl method and dialyzed against PBS buffer containing 10% glycerol as described (2). Two Hybrid Screening. Yeast two-hybrid screening with a GAL4 PH Akt (aa ) construct as bait was performed in the yeast strain AH109 (Clontech) according to the manufacturer's instructions. A total of 2x10 6 clones from the pre-adipocyte F422A library was screened. Protein Interaction Studies. GST pull down assays were done with baculovirus expressed GST-Akt (gift of T. Roberts, Dana Farber). For co-immunoprecipitation of epitope-tagged proteins, cells were transfected with Akt fused to hemaglutinin antigen (2ug) and Flag- (2ug) expression vectors by Lipofectamine 2000 according to the manufacturer's instructions. Transfected cells were harvested and lysed in Co-IP buffer [25mM Tris (ph 7.6), 150mM NaCl, 2.5mM MgCl 2, 0.5mM EDTA, 0.5% NP-40, 5mM β-glycerophosphate, 1mM DTT, 5% glycerol, and proteinase inhibitors]. Total cell lysate (500µg) was subjected to immunoprecipitation with immobilized anti-ha monoclonal antibodies (COVANCE). For co-immunoprecipitation studies on endogenous Akt and proteins, total cell lysate from HepG2 cells was incubated with antiserum to
2 . Immunoprecipitates were separated by SDS-PAGE (12% gels), and proteins were analyzed by Western blot assay using monoclonal antiserum to Akt. RNA interference. Double stranded RNA duplexes corresponding to aa of rat and mouse (5'-CGAGUGAGAGAUGAGCCUG-3') or human (5'- CGAGCUCGAAGUGGGCCCC-3') were purified, annealed, and transfected into human HepG2 hepatocytes. The effect of RNAi on expression and on insulin dependent Akt activation was measured after 24 to 48 hours. Mouse- and rat-specific duplex oligos were used as control oligos in experiments with human HepG2 cells. All RNAi experiments were performed on at least three independent occasions with comparable results. In vitro kinase assay. Human embryonic kidney cells (HEK 293) were co-transfected with an expression vector encoding HA-Akt and either a vector encoding or empty expression vector. One day after transfection, cells were deprived of serum for 16 hours and then treated with 100µM of sodium pervanadate or vehicle for 15 mins. Cells were lysed in lysis buffer [20mM Tris, (ph 7.6), 150mM NaCl, 1mM EDTA, 1mM EGTA, 1% Triton X-100, 2.5m β-glycerophosphate, 1mM sodium pervanadate and proteinase inhibitors), and HA-tagged Akt was immunoprecipitated with monoclonal antibody to HA. Immune complexes were washed, and in vitro kinase assays were performed with recombinant GST-GSRSRRPSYRL polypeptide (2µg per reaction) as substrate. Reactions were incubated in kinase assay buffer [20mM Tris ph7.6, 5mM β- glycerophosphate, 2mM DTT, 0.1mM sodium pervanadate, 10mM MgCl 2, 200µM cold ATP, 1µCi [γ-p 32 ]-ATP] at 30 o C for 30 minutes. Reactions were terminated by addition
3 of 2x SDS PAGE loading buffer, and phosphorylated substrate was resolved by SDS PAGE (12% gels). Radio-labeled bands were quantified by phosphoimager. Western blot assays. Western blot assays were done as described (3) using specific antibodies to the non-phosporylated or phosphorylated forms of Akt or GSK3, respectively (Cell Signaling, Santa Cruz). Anti- rabbit polyclonal antiserum was generated against GST- polypeptide extending from aa. 1 to 145 of mouse protein. Specificity of the antiserum was verified by Western blot assay with purified recombinant protein. Animal experiments. Male 6-week old C57Bl6 mice were obtained from Harlan (San Diego, CA) and housed in an air-conditioned environment, with a 12-hour light-dark cycle, and were fed a regular unrestricted diet. Animals were anaesthetized with Iso- Flurane and a total of 1x10 9 plaque-forming units of recombinant virus was administered by systemic tail vein injection. In each experiment at least 7 animals received identical treatments. During the course of the experiments animals were fasted for 24 hours with free access to water, and then fasting blood glucose was monitored. Mice were then refed for the following 24h and blood glucose was determined thereafter. This fasting-feeding protocol was maintained for at least 7 consecutive days. All mice were sacrificed for blood and tissue collection at the end of the experiment. Blood samples were collected from the tail vein. Plasma was obtained by centrifugation of collected blood and assayed for insulin. Liver tissue for RNA and protein isolation was immediately frozen in liquid nitrogen and stored at 80 C. Cryomicrotome sections of liver samples were used to assess viral infection efficiency by fluorescence microscopy. For glucose tolerance tests, mice were fasted for 24 hours and then injected with 1 unit glucose per g body weight into the peritoneal cavity. Glucose levels were measured from blood collected from the tail immediately before and 10, 20, 30, 60, and 120 minutes after the injection. Hepatic
4 glycogen content was determined essentially as described (4), and expressed as mg glycogen per gram wet liver tissue. All study protocols were reviewed and approved by the IACUC of the Salk Institute. Blood metabolites. Blood glucose values were determined from whole blood using an automatic glucose monitor (One Touch Ultra, Lifescan). Plasma insulin levels were determined using a commercial insulin ELISA kit (Crystal Chem. Inc., Chicago). All procedures were performed according to the directions provided by the manufacturers. Quantitative Taqman RT-PCR. Total RNA was extracted from homogenized mice livers using the RNeasy (Qiagen, Valencia) kit including DNase I treatment. RNA was processed for quantitative RT-PCR analysis as previously described (5). Cell culture. Cells were maintained as described (6). Glucose output assay. Rat FAO hepatoma cells were cultured in six-well plates in DMEM with 10% FBS and infected 48 hours after plating with adenoviruses expressing either GFP or. 48 hours after infection, cells were treated with 30nM insulin for 3h where indicated. The medium was then replaced with 2 ml of glucose production buffer consisting of glucose-free DMEM, without phenol red, supplemented with 20mM sodium lactate and 2mM sodium pyruvate. After a 3 hour incubation, 0.4 ml of medium was assayed for glucose concentration by using a colorimetric glucose assay kit (Sigma). Readings were normalized to the total protein content determined from the whole-cell lysate.
5 Supplementary Figures Fig. S1. Co-immunoprecipitation assay of HA-tagged Akt1 and FLAG-tagged proteins in transfected HEK293 cells. Top, Input of wild-type and truncated proteins. Middle, Western blot of HA-tagged Akt1 immunoprecipitates showing FLAG-tagged recovered. Bottom, input levels of HA-Akt1 in transfected cells. - WT INPUT IgG CO-IP Akt INPUT Fig. S2. Western blot analysis of phospho (Thr 308 ) Akt, total Akt, and protein levels in HEK293 cells transfected with HA-tagged Akt1 expression vector plus Flagtagged vector. Cells were treated either with IGF1 (100nM) or left untreated for 30 minutes. Immunoprecipitates of Akt were prepared with antiserum to HA, and Western blot assays were done with antibody specific to phospho (Thr 308 )as well as anti-ha antibody to visualize total amounts of Akt. Amounts of Flag-tagged are shown. IGF P-T308 Akt
6 Fig. S3. Effect of RNAi oligos on expression in hepatocytes. Human HepG2 hepatocytes were co-transfected with increasing amounts of RNA duplex oligos (0, 0.1, 0.2, 0.4 µg) plus Flag-tagged expression vector. Flag-tagged and endogenous expression in transfected cells was evaluated after 24 hours by Western blot assay. RNAi FLAG- Fig. S4. Enhanced Akt phosphorylation in response to growth factor stimulation in cells with disrupted expression. Western blot assays of phospho (Thr 308 ) and total Akt levels in control and pervanadate (PV) treated HepG2 cells transfected with wild-type (WT) or mutant (mt) RNAi oligos and HA-tagged Akt expression vector. HepG2 extracts were probed with antiserum specific for phospho (Thr 308 ) (top) or nondiscriminating Akt antiserum (middle) and antiserum (bottom). RNAi mt mt WT PV WT + P- Akt
7 Fig. S5. Potentiation of GSK-3 phosphorylation in response to growth factor stimulation after RNAi-mediated disruption of. Western blot assay of phospho (Ser 21 ) GSK- 3α and phospho (Ser 9 ) GSK-3β in HepG2 hepatocytes transfected with RNAi oligos and treated with pervanadate (PV) or vehicle as indicated. Effect of co-transfected mouse expression vector (which is not recognized by human RNAi oligos) on GSK-3 phosphorylation shown. mtrb + + RNAi mt mt WT WT WT WT PV P-GSK3 α P-GSK3β GSK3 α GSK3β Fig. S6. Western blot analysis of protein amounts in whole liver extracts from wild-type and db/db mice using antiserum to. Organs were harvested under refed or fasting conditions. refed fast WT db/db
8 Fig. S7. expression is induced by counter-regulatory hormones. Quantative PCR analysis of RNA levels in FAO hepatocytes treated with dexamethasone (10-7 M) or forskolin (10µM) for 18 hours. TRB-3 expression in FAO hepatoma cells Vehicle DEX FSK
9 Fig. S8. Western blot analysis of Akt in immunoprecipitates prepared from whole liver extracts of fasted db/db mice using either pre-immune (Pre), polyclonal anti- (α) antiserum, or anti- antiserum blocked with polypeptide (aa ). Recovery of 60 kd Akt immunoreactive band from each immunoprecipitate is shown. Input levels of and Akt indicated. Akt Pre - α + - Pre-blocked IgG Akt INPUT INPUT Fig. S9. Comparable expression of in db/db mice and in mice infected with adenovirus. Western blot assay of whole liver extracts using anti- or anti-creb antiserum as control. Livers were collected from db/db, adenovirus, or control GFP adenovirus infected mice. GFP db/db anti anti-creb
10 Fig. S10. Serum insulin levels (ng/ml) in control (GFP) or adenovirus infected mice under refed or fasted conditions, as indicated. 2 GFP 1 0 refed fasted References 1. T. He, et al., Proc. Natl. Acad. Sci. 95, (1998). 2. T. Becker, et al., Methods Cell Biol, (1994). 3. L. F. Michael, H. Asahara, A. Shulman, W. Kraus, M. Montminy, Mol Cell Biol. 20, (2000). 4. W. Shen, L. M. Scearce, J. E. Brestelli, N. J. Sund, K. H. Kaestner, J Biol Chem 276, (2001). 5. S. Herzig, et al., Nature 413, (2001). 6. K. Du, M. Montminy, J Biol Chem 273, (1998).
Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100
Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationXiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationCheckpoint Kinase Activity Immunoblot Kit
Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationThe retroviral vectors encoding WT human SIRT1 or a mutant of SIRT in which a
Supporting online material Constructs The retroviral vectors encoding WT human SIRT1 or a mutant of SIRT in which a critical histidine in the deacetylase domain of SIRT1 has been replaced by a tyrosine
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationAttenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by
Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran
More informationProtein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationFor quantitative detection of mouse IGF-1 in serum, body fluids, tissue lysates or cell culture supernatants.
Mouse IGF-1 ELISA Kit (migf-1-elisa) Cat. No. EK0378 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationSupplementary material for: Materials and Methods:
Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated
More information96-well Checkpoint Kinase Activity Assay Kit
Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a
More informationAnalysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng
Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationused at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were
1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies
More informationSupplemental Experimental Procedures
Supplemental Experimental Procedures Generation of BLM protein segments and mutants. For immunoprecipitation experiments with topoisomerase IIα, BLM N-terminal segments were generated by PCR amplification
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSupplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationMouse IGF-1 ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: sales@genwaybio.com http://www.genwaybio.com Mouse IGF-1 ELISA Kit Catalog No GWB-ZZD063 Size
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationRegulation of hepcidin expression by inflammation-induced activin B
Regulation of hepcidin expression by inflammation-induced activin B Yohei Kanamori, Makoto Sugiyama, Osamu Hashimoto, Masaru Murakami, Tohru Matsui and Masayuki Funaba Supplemental methods Liver cell separation
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationCell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)
Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationsupplementary information
DOI: 10.1038/ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna 930041I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated
More informationSupplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
More informationpt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationSupporting Information
Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationPlease read manual carefully before starting experiment
RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationhours after food deprivation hours after food deprivation
Figure S.6 protein (fasted / control).2.8.4 p47 p97 Rpt Ufd 3 24 48 hours after food deprivation mrn (fasted / control) C mrn (denervated / control) 2.5 2.5.5 3.5 3 2.5 2.5.5 p97 ** Npl4 Ufd p47 2 3 4
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationRapid and sensitive determination of recombinant protein expression
APPLIAION NOE Pro-Detect Rapid assays Rapid and sensitive determination of recombinant protein expression Introduction Recombinant protein expression and purification is a multistep process that includes:
More informationAntibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg
Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationSupplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
More informationSupplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on
Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on MS media, seedlings were transferred to soil and treated
More informationMechanism of Induction and Suppression of Antiviral Immunity Directed by Virus-Derived Small RNAs in Drosophila
Cell Host & Microbe, Volume 4 Supplemental Data Mechanism of Induction and Suppression of Antiviral Immunity Directed by Virus-Derived Small RNAs in Drosophila Roghiyh Aliyari, Qingfa Wu, Hong-Wei Li,
More informationAdenovirus Titration Kit
Adenovirus Titration Kit Catalog # LF-RK0001(1 kit) Immunostaining method for Quantitative Detection of Adenovirus For research use only Not for diagnostic or therapeutic procedures AbFrontier Science
More informationEndogenous MYC was detected by Western blotting using the N-262 polyclonal antibody (Santa
SUPPLEMENTARY METHODS Antibodies Endogenous MYC was detected by Western blotting using the N-262 polyclonal antibody (Santa Cruz) or the 9E10 monoclonal antibody (Vanderbilt Antibody and Protein Resource).
More informationFigureS1NodegradationofRNA wasobservedby
FigureS1NodegradationofRNA wasobservedby recombinantgasdnasesda1.rna wasisolatedfrom GAS andco-incubatedwitheitherthednasebuferaloneorwith 365ngoftherecombinantSda1inDNasebuferfor10minutesat 37uC.Visualisationfolowedby1.5%
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationHistone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
More informationSupplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationSupporting Information
Supporting Information Sung et al. 10.1073/pnas.1513341112 SI Materials and Methods Cell Lines, Primary Human Hepatocytes, and Reagents. Huh-7 cells, Huh-7.5 cells (Apath, LLC), HepG2 cells (KCLB), and
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationHistone H3K27 Methylation Antibody Panel Pack Base Catalog # C Component Size Shipping Temperature
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K27M Histone H3K27me1 (H3K27 Monomethyl) Polyclonal Antibody 25 µg
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationMAP Kinase (ERK1/2) Activity Assay Kit
MAP Kinase (ERK/2) Activity Assay Kit For 96 tests Cat. No. SGT45 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +(800) 437-7500 Fax: + (909) 676-9209 Europe +44 (0) 23
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationHiYield TM Genomic DNA Extraction Kit Reagent
HiYield TM Genomic DNA Extraction Kit Reagent CONTENTS Genomic DNA Extraction Kit Blood Cat.No. YGBE1KR // YGBE 100R Blood Protocol..... 3 Genomic DNA Extraction Kit Cultured Cells /Tissue / Bacterial
More information