Premium Oigonuceotide Synthesis QUALITY CONSISTENCY CONFIDENCE Gene Link oigos are for demanding appications and consistent resuts. We beieve that investigators who vaue time and have no room for an experiment to fai due to oigo quaity shoud consider Gene Link. Our numerous quaity contro steps for each oigo assure confidence. GOLD STANDARD Actua Ge Photo An actua ge photo of each oigo is affixed on the oigo report. An absoute testimony of quaity. Gene Link has raised the standard since inception over a decade ago. We have the pictures to prove it! 1 Gene Link www.geneink.com
Superior to Mass-Produced Factory Oigos Gene Link is not an oigo factory. Each oigo is synthesized, processed and quaity assured to Gene Link s absoute standards. This incudes couping efficiency monitoring of each base during synthesis and eectrophoretic anaysis of each oigo on a poyacryamide ge to visuay assess quaity. Couping Efficiency We maintain a couping efficiency threshod of greater than 99.5% for a oigos by using premium reagents of exacting specifications, membrane synthesis, state-of-the-art instruments and optimized software-driven protocos. This may not be evident when comparing short oigos, as PCR and sequencing reactions are very robust and can toerate up to 50% faiure/truncated sequence oigos. However, you are ceary taking a chance by using ong oigos synthesized at anything beow 99.5% couping efficiency. 100% Yied Yied Yied 100% 100% Couping Efficiency and Fu Length Oigo Yied Oigo Size 99.50% 99.00% 98.00% 20 90.916 82.617 68.123 40 82.243 67.573 45.48 60 74.398 55.268 30.363 80 67.301 45.204 20.27 100 60.881 36.973 13.533 120 55.074 30.24 9.034 140 49.821 24.734 6.031 160 45.068 20.23 4.027 180 40.769 16.546 2.688 200 36.88 13.533 1.795 220 33.36 11.07 1.19 240 30.18 9.05 0.8 250 28.7 8.19 0.65 Oigo size Couping efficiency 99.50% Couping efficiency 99.00% Couping efficiency 98.00% 250 The Gene Link Advantage Stringent Quaity Contro Measures Speciaizing in Long Oigos up to 250 mer Trity Monitoring of A Oigos Poyacryamide Ge Photograph of Each Oigo A Modifications Avaiabe A Oigo Types Avaiabe Easy Onine Ordering System Onine Design and Anaysis Toos Knowedgeabe Technica Support Personaized, Friendy Customer Service Trity Monitoring A Gene Link DNA synthesizers are equipped with trity monitors for monitoring couping efficiency of each added base. The instruments are programmed to hat when it fas beow the threshod. See exampe of routine trity bars. Routine Trity Couping Efficiency GOLD STANDARD Sequence ength Actua trity couping efficiency of a 210 mer. Long Oigos Ask our competitors how often they synthesize 200 to 250 mer oigonuceotides. Gene Link speciaizes in ong oigos. You are invited to compare. Gene Link www.geneink.com 2
Oigo Design and Anaysis Toos Gene Link has been eading the way by providing the most user friendy onine experience in oigo ordering. From oigo design and anaysis, to the convenient ordering system and the assurance of a secured transaction, Gene Link provides the most comprehensive web resource in the industry. Features incude convenient NCBI basting and secondary structure anaysis, simpe import toos for arge orders in spreadsheet or text fie format, and three eves of review and editing. Custom Oigo Ordering System Cassic ordering system with extensive anaysis features Timesaver muti oigo import from spreadsheet and text fies Abiity to hande mixed oigo types, purity and modifications in a singe order Seection of oigo type (DNA, RNA, Phosphorothioate, Chimeric, etc.) Simpe drop down menu seection for 5', interna or 3' modifications Anayze for oigo hairpin and oops Integrates with NCBI Bast for homoogy checks Fip 3' to 5' and reverse compement Onine Oigo Anaysis Simuate anneaing, oops and hairpin formations Cacuate MW, EC, T m, A 260, etc. Appications incude RNAi Exporer, a robust sirna search and design too, and a standaone Oigo Exporer appication for onine acquisition of sequences and oigo design. Save Session Too busy to order a of your oigos in one session? Gene Link s answer to the mutitasking researcher with endess interruptions is the Save Session feature. Enter as many oigos as you wish, cick the Save Session button and resume at your wi. Your oigos wi be saved. What s more, you' save money on shipping by consoidating your mutipe orders into one. 3 Gene Link www.geneink.com
Custom Oigonuceotide Synthesis Mutipe Oigo NCBI Bast Cick to ascertain homoogies to other sequences. Perform NCBI Bast of mutipe sequences at once by using Gene Link s onine MutiBast appication. Import a the sequences using a spreadsheet or a text fie. A of your sequences wi be basted and resuts retrieved. Gene Link offers a very convenient approach to perform mutipe bast searches. Oigo Exporer A PC-based appication for standaone DNA sequence retrieva and oigo design. Oigo Exporer was deveoped to design PCR and sequencing primers. Oigo Exporer is an efficient easyto-use too to determine primer properties ike T m, GC%, primer oops and primer dimers. Oigo Exporer aso incudes a powerfu Primer Wizard too that heps you to find suitabe primer pairs. You can set your own parameters for the primer pair search engine or use the defaut parameters. Primer Wizard suggests primer pairs that ampify PCR products of the given ength. Individua primer pairs are suggested that theoreticay wi not form stabe primer dimers or primer oops. Moecuar Bioogy Convenience Appets Gene Link has numerous onine appets for quick cacuations. The BioCacuator is a series of appets for simpifying the routine aboratory cacuations. The foowing convenient cacuators are avaiabe: Oigo Resuspension Oigo Diution Oigo T m Reagent Diution Moarity Determination Ligation Base/Dye Ratio Gene Link www.geneink.com 4
Oigo Specifications Report Gene Link s Custom Oigonuceotide Synthesis Report specifies each oigo name and sequence aong with its pertinent physica properties such as MW, %GC, T m, A 260 units, etc. Our report is aso unique in that we affix an actua poyacryamide ge eectrophoresis photograph onto each report, so that you aso may visuay attest to the quaity of our product. From your custom oigo to the presentation of our oigo synthesis report, not a step of quaity is overooked. You are invited to compare. Custom Oigo Specifications Gene Link custom oigonuceotides are suppied desated and yophiized. They are ready to use after appropriate reconstitution. Dry oigonuceotides are stabe at room temperature for an extended period of time. Storage & Reconstitution The oigonuceotide shoud preferaby be frozen upon receipt. TE buffer (10 mm Tris, 1 mm EDTA, ph 7.5) is recommended for dissoving the oigonuceotides. After reconstitution store the stock soution at 80 C or 20 C. Purity & Usage The crude, desated oigonuceotide suppied is suitabe for a ampification and sequencing protocos. Ge purification is advised for a oigos used for coning appications and for oigos onger than 50 mer. Biophysica Data Each oigo after desating is quantified by recording A 260. Exact nmos and µg are determined by the extinction coefficient and moecuar weight of the oigo. Ge Photo Documentation An actua ge picture of the synthesized custom oigonuceotide is suppied. A major singe band represents high purity of the crude oigonuceotide. 5 Gene Link www.geneink.com
Custom Oigonuceotide Synthesis Oigo Scae of Synthesis and Typica Yied Crude Desated RPC Purified** Ge Purified 20 mer oigo* 30 mer oigo* 50 mer oigo* Typica yied Typica yied Typica yied Scae A 260 Units nmos mg A 260 Units nmos mg A 260 Units nmos mg 50 nmo 8-10 30+ 0.2-0.3 4-5 12+ 0.1-0.16 NR* [1-2] NR* [2-4] NR* [0.03-0.06] 200 nmo 20-25 80+ 0.6-0.8 8-12 24+ 0.26-0.4 4-6 8+ 0.13-0.2 1 µmo 100-120 400+ 3-4 40-50 30+ 1.3-1.6 20-25 40+ 0.6-0.8 Purity & Yied Purity is greater than 80% depending on oigo sequence and structure. Refer to couping efficiency tabe for oigo ength dependent purity and yied. No further purification required for PCR and sequencing appications. Ge purification recommended for oigos above 50 mer and a appications invoving coning and mutagenesis. Purity 85% to 95% depending on oigo sequence and structure. Yied and purity wi be ower for sequences with high GC content. Not recommended for oigos onger than 35 mer. **RPC is reverse phase purification using a cartridge; a substitute for HPLC. Purity 98% to ~100% depending on oigo sequence and structure. Yied wi graduay decrease as ength of oigo increases. Paindromes, hairpins and high GC content oigos and oigos containing stretches of 3 or more G s induces strong secondary structure and base stacking thus decreasing purity and yied. NR* Not Recommended *Yied of 30 µg/a 260 unit for oigos is cacuated for an ~equimoar base composition. Long stretches of a singe base or homopoymers wi have variabe yieds. Exampe for homopoymeric 50 mer: A(50) = ~20/A 260 Unit; G(50) = ~28/A 260 Unit; T(50) = ~35/A 260 Unit and C(50) = ~39/A 260 Unit. Unmodified DNA Oigo Synthesis* Scae of Synthesis Cataog No. Price ($) 50 nmo 26-6400-05 0.90 200 nmo 26-6400-02 2.00 1 µmo 26-6400-01 3.75 2 µmo 26-6400-03 6.50 10 µmo 26-6400-10 32.00 15 µmo 26-6400-15 38.00 *minimum charge for 15 mer appies. Pease visit www.geneink.com for current ist prices. Ca for institutiona discount pricing structure. Same Day Oigo* Design your oigos today and use them tomorrow morning! Investigators who just can not wait order our rush service (order by 12 noon EST). We ship the same day for next eary morning deivery in the US and 72 hours for most internationa destinations. * Turn-around time stated is for unmodified oigos. Pease inquire about purified and modified oigos Purification Scae of Synthesis Price ($)/purification Product Cataog No. 50 nmo 200 nmo 1 µmo 2 µmo 10 µmo 15 µmo Ge Purification 26-6400-XX 75.00 75.00 150.00 280.00 1500.00 1800.00 Reverse Phase Cartridge 26-6400-XX 30.00 30.00 90.00 170.00 750.00 900.00 Gene Link www.geneink.com 6
Gene Link 140 Od Saw Mi River Road Hawthorne, NY 10532 1-800-GENELINK te: 914-769-1192 fax: 914-769-1193 emai: orders@geneink.com www.geneink.com OLIGO SYNTHESIS CUSTOM OLIGO SPECIFICATIONS Customer Name: Ayson Rodgers Order Number: 136039 Customer Number: 10532AJ1 Date: June 13, 2004 Quaity Consistency Confidence Lane Oigo Name Sequence (5' 3') Size MW TM nmos µg A260 Units 1. Primer 1 CATCCTGCAGGGCTAGCTCATAGAGCTTGCGCGTCAATT AGGATACCTAGG 51 15,715 74.8 48.7 765.3 26.61 2. Primer 2 GGTGCTCTAGATCAGGAGCTTGCGCAGTCCCCGTGGG GATACCTAGTCACGTACTACTATGTCA 64 19,719 77.9 47.8 941.9 32.11 3. Primer 3 CATCCTGCAGGGCTAGCTCATAGAGCTTGCGCGTCAATT AGAGCTTGG 48 14,800 74.6 45.5 672.7 23.10 4. Primer 4 CTCAAGCAGGAAATCGGGAGCGGCACTTCGTACGGCG CGTCC 42 12,950 77.0 48.9 633.6 21.92 5. Primer 5 CGGAATTCGGTCACAGGCTTGGTCA 25 7,698 63.9 48.2 370.7 12.79 6. Primer 6 GGTCTGTCTGGGATCCCA 18 5,507 56.6 52.6 289.8 9.49 7. Primer 7 AAGAGAAAGGTAGGAAGCAC 20 6,257 53.4 40.2 251.5 10.37 8. Primer 8 CCAACCTCCTGTCCACCAACTTTCTTTCGTTGGATGTC CATCTGCGGCGTTTATGTTGGTTCTCCTGTAGGACTG GAA 78 23,869 77.7 9.3 222.7 7.26 9. Primer 9 TGGTCAGAATTCTAGCCTTTCGTGACGAAATTTTAACATA AAAGAAAGGCTTCTTGATATATTATCAAGAAACCTTTCTT TTCTATTAAATTTACA 96 29,513 70.2 8.5 252.0 9.14 10. Primer 10 AATTCTCAGTACTGTGTTTCAGCAGAAGGAGTCTTACAT GTGATGGGGTGTTACAACTGAAAAGTCAAAAGAAGTT TGTATTACCATTTTCAATAGCAGTATAAAAGGTTCTCTTT GGATTCCAGTTGTTGCTGCTTTACTACTCTTTCTAGTGC TTAGCT 161 49,736 76.2 6.2 309.4 10.87 NOTES 11. Primer 11 CTCAAGCAGGAAATCGAGCGGCACTTCGTACGTAAAT GCCAA 42 12,925 71.1 28.6 369.8 13.53 Oigos 1-7 are crude unpurified. Oigos 8-11 are ge purified. Ge anes for oigos 8-11 correspond to crude foowed by ge purified. Mobiity of an oigonuceotide is dependent upon the size and base composition. Oigos of the same size may not share the same mobiity patterns based on the foowing migration rate C>A>T>G. A stretch G's and GC's induces strong secondary structure that traves as higher mobiity fragments.
PRODUCT GUIDE Gene Link OLIGO SYNTHESIS Custom Oigo Specifications Gene Link custom oigonuceotides are suppied desated and yophiized. They are ready to use after appropriate reconstitution. Dry oigonuceotides are stabe at room temperature for an extended period of time. Storage & Reconstitution The oigonuceotide shoud preferaby be frozen upon receipt. TE buffer (10mM Tris, 1mM EDTA, ph 7.5) is recommended for dissoving the oigonuceotides. After reconstitution store the stock soution at -80 C or -20 C. Ge Photo Documentation An actua ge picture of the synthesized custom oigonuceotide is suppied. A major singe band represents high purity of the crude oigonuceotide. Purity & Usage The crude, desated oigonuceotide suppied is suitabe for a ampification and sequencing protocos. Ge purification is advised for a oigos used for coning appications and for oigos onger than 50mer. Biophysica Data Each oigo after desating is quantified by recording A 260. Exact nmos and µg is determined by the extinction coefficient and moecuar weight of the oigo. Oigo Scae of Synthesis and Typica Yied of Unmodified Oigos* Crude Desated RPC Purified*** Ge Purified 20mer oigo** 30mer oigo** 50mer oigo** Scae A 260 Units nmos A 260 Units nmos A 260 Units nmos 50 nmo 8-10 30+ 4-5 12+ NR* [1-2] NR* [2-4] 200 nmo 20-25 80+ 8-12 24+ 4-6 8+ 1 µmo 100-120 400+ 40-50 30+ 20-25 40+ Purity & Yied Purity is more than 80% depending on oigo sequence and structure. Purity 85% to 95% depending on oigo sequence and structure. Not recommended for oigos onger than 35mer. Purity 98% to ~100% depending on oigo sequence and structure. Yied wi graduay decrease as ength of oigo increases. *The yied of modified oigos varies based on modification. **Yied of 30µg/A260 unit for oigos is cacuated for an ~equimoar base composition. Long stretches of a singe base or homopoymers wi have variabe yieds. Exampe for homopoymeric 50mer: A(50)= ~20/A260 Unit; G(50)= ~28/A260 Unit; T(50)= ~35/A260 Unit and C(50)= ~39/A260 Unit. ***RPC is reverse phase purification using a cartridge; a substitute for HPLC. NR*Not Recommended. Primer Design Hairpin Loop Formation and Primer Design* Successfu use of oigos as primers for ampification and sequencing starts with functiona primer design foowed by optimized PCR ampification conditions. Fortunatey, both PCR and sequencing reactions are inherenty robust and have been observed to toerate wide variations in quaity of primers when using unique tempates. The same toerance can aso ead to fase priming, poor resuts and frustrating time oss with tempates of higher compexity. Primer specificity aone does not guarantee an optimum ampification yied. Numerous computer appications are avaiabe for primer search and design. Most of these appications do not consider the effect of hairpin structures which tend to be quite stabe thermodynamicay. Genera guideines for primer design are given beow foowed by a brief account of stabe hairpin structure formation and non-watson-crick base pairing induced by a stretch of G s and G s interspersed with A s or C s (1-3). Genera Guideines 1. Specificity: Seect an 18 to 24mer stretch with perfect specificity. 2. Base Composition: Preferaby maintain GC content beow 60% with no stretches of more than 3G s or 4 runs of the same base. 3. Tm: Seect primer Tm within a few degrees of the pair. 4. Cross Homoogies: Perform NCBI bast to determine extent of cross homoogies. 5. Secondary Structure: Perform computer assisted anaysis to view formation of stabe dimers, oops and hairpins. Sequence 5'-CAGCGCACTACAGGCATGACGT-3' 5'-GTCCGCACGTACGGACAT-3' 5'-GTCAGCCGCACGTACGGACAT-3' 5'-AGTAACGCACTACGGACTTACGAC-3' 22mer; dg= -47.5; Tm(NN)= 61.6 C 18mer; dg= -38.4; Tm(NN): 57.0 C 21mer; dg: -46.3; Tm(NN): 61.70 C 24mer; dg= -47.1; Tm(NN)= 58.8 C *Dimers 5' CAGCGCACTACAGGCATGACGT 3' 5' GTCCGCACGTACGGACAT 3' 5' GTCAGCCGCACGTACGGACAT 3' 5' AGTAACGCACTACGGACTTACGAC 3' + + + + + ++ + ++++ 3' TGCAGTACGGACATCACGCGAC 5' 3' TACAGGCATGCACGCCTG 5' 3' TACAGGCATGCACGCCGACTG 5' 3' CAGCATTCAGGCATCACGCAATGA 5' STACK AT 3 IS 4 BP LONG. STACK AT 8 IS 6 BP LONG. STACK AT 11 IS 6 BP LONG. STACK AT 2 IS 4 BP LONG. dg= -4.8; Tm= -58.4 C dg= -5.7; Tm= -42.4 C dg= -4.65; Tm= -28.2 C dg=-2.05; Tm=-47.3 C Hairpin None 5' GTCCGCAC 5' GTCAGCCGCAC 5' AGTAACGCACT Loops ] ] ] 3' TACAGGCATG 3' TACAGGCATG 3' CAGCATTCAGGCA STEM AT 1 IS 5 BP LONG. LOOP=6. STEM AT 6 IS 3 BP LONG. LOOP=6 STEM AT 2 IS 4 BP LONG. LOOP=12. dg= -5.3; Tm=87.3 C dg= -2.4; Tm= 68.9 C dg= 0.8; Tm= 13.8 C *Secondary structure resuts are truncated to show the most stabe structures. A thermodynamic vaues incuding Tm and secondary structures cacuated and dispayed soey indicate the reative stabiity of the secondary structures. They shoud ony be used to compare the reative stabiity of the structures. dg vaue unit is kca/mo. Visit www.geneink.com/toos/g-sod.asp to design oigos or cick on the Anayze button whie on the onine oigo ordering page. Hairpin Structures One essentia eement of efficient primer design is to minimize interna secondary structure, especiay hairpin oops which tend to be deceptivey stabe at standard anneaing temperatures. Hairpins are stabe with as few as 4 bases stacked in the stem and a oop size of 4 to 6 bases. The stabiity decines as the oop size increases. The stem and oop size are reated proportionatey such that onger stem sizes can toerate onger oop sizes (4). As a genera rue, avoid hairpins with more than 3 bases in the stem. Stabe hairpin oop formation drasticay reduces the primer concentration avaiabe for hybridization to the target sequence. Base Composition Higher GC content stabiizes hybridization, but a string of G's and C's can exhibit interna Hoogsteen base pairing, non-watson-crick base pairing and shoud be avoided (3,4). Athough this anomaous behavior is difficut to predict, these structures can disrupt stabe primer binding. In genera, avoid runs of more than three consecutive G's in primers. Aso, examine potentia primers for sef-compementary and hairpin structures. Nucear Magnetic Resonance (NMR) studies have shown that a stabe hairpin can form with just four G-C basepairs in the stem and just three bases in the oop (5). References 1. Michae Zuker (2003) Nuceic Acids Res., 31, 3406 3415. 2. SantaLucia, J. (1998) Proc. Nat. Acad. Sci. USA 95, 1460. 3. Sarochi, M-T., Courtois, Y., Guschbauer, W. 1970. Eur. J. Biochem. 14: 411. 4. Gene Link, Inc. interna data. 5. Summer, M.F., Byrd R.A., Gao, K.A., Samson, C.J., Zon, G., Egan, W. 1985. Nuceic Acids Res.13: 6375. R26-6400-XXB 10062004 Gene Link, Inc. 2004 A Rights Reserved