Table S5. Bacterial strains, phages, plasmids and primers.

Similar documents
Primers Sequence (5'-3') Genes Product size (bp) References

Construction of plant complementation vector and generation of transgenic plants

Supporting Information-Tables

Supplementary Material. Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological

Supplemental Material for: Nutritional control of antibiotic resistance via an interface between the phosphotransferase system and

Xcc strains 8004, ATCC33913, B100 and B Rectangular squares indicate the

Genome Sequence Assembly

A universal chassis plasmid pwh34 was first constructed to facilitate the

Supporting Information

Approaches to Vaccine Development Using Bioinformatics. Vaccine development has traditionally been a lengthy process. Animal studies with specific

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Supplemental Fig. S1. Key to underlines: Key to amino acids:

Genetic Engineering & Recombinant DNA

VanG-Type Vancomycin-Resistant Enterococcus faecalis Strains Isolated in Canada

Cassette denotes the ORFs expressed by the expression cassette targeted by the PCR primers used to

Data Sheet Quick PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit

Supporting Online Material for

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

Regulation of mga Transcription in the Group A Streptococcus: Specific Binding of Mga within Its Own Promoter and Evidence for a Negative Regulator

Diversity of the fsr-gele Region of the Enterococcus faecalis Genome but Conservation in Strains with Partial Deletions of the fsr Operon

Molecular Biology Techniques Supporting IBBE

TransforMax EPI300 Electrocompetent E. coli TransforMax EPI300 Chemically Competent E. coli

Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation. Transmission of genetic variation: F+ conjugation

CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract

chapter eight: microbial genetics

1

Additional Practice Problems for Reading Period

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary

chapter eight: microbial genetics

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

2054, Chap. 14, page 1

7.013 Practice Quiz

Recombinant DNA recombinant DNA DNA cloning gene cloning

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY MATERIAL

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Supplemental Data. Li et al. (2015). Plant Cell /tpc

CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter

Partial list of differentially expressed genes from cdna microarray, comparing MUC18-

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.

HE Swift Cloning Kit

Δsig. ywa. yjbm. rela -re. rela

Supplemental Data Genetic and Epigenetic Regulation of the FLO Gene Family Generates Cell-Surface Variation in Yeast

Using mutants to clone genes

Problem Set 4

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

Microbial Genetics. Chapter 8

7.012 Problem Set 5. Question 1

Genetics Lecture Notes Lectures 13 16

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent

BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:

Page 1 of 10 MIDTERM EXAM OF BIO

Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability

3 Designing Primers for Site-Directed Mutagenesis

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Bac 32, a Novel Bacteriocin Widely Disseminated among Clinical Isolates of Enterococcus faecium

Problem Set 8. Answer Key

Arsenite oxidation regulator AioR regulates bacterial chemotaxis towards. arsenite in Agrobacterium tumefaciens GW4

Bottom-up genome assembly using the Bacillus subtilis genome vector

Supplementary Material

4/26/2015. Cut DNA either: Cut DNA either:

Allele-specific locus binding and genome editing by CRISPR at the

Chapter 10 (Part II) Gene Isolation and Manipulation

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Chapter 4. Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

Chapter 6 - Molecular Genetic Techniques

BIO 304 Fall 2000 Exam II Name: ID #: 1. Fill in the blank with the best answer from the provided word bank. (2 pts each)

Chapter 4. The Genomic Biologist s Toolkit

Strain, plasmid, primer or dsdna fragment Relevant genotype, description, or sequence

TABLE S1. Sequences of the primers used for RT-PCR and PCR

Table S1. List of primers used in this study

Bacterial DNA replication

Recombinant DNA Technology

CH 8: Recombinant DNA Technology

Biology 4100 Minor Assignment 1 January 19, 2007

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

A cross between dissimilar individuals to bring together their best characteristics is called

Map-Based Cloning of Qualitative Plant Genes

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou


The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.

NEB [1] Plasmids pdest-hismbp-ascpf1-ec E. coli codon optimized AsCpf1 coding sequence, Am R [2] pmtl82151 pbp1 ori, Cm R, ColE1 ori, TraJ [3]

Shah, N.R., et al., Supplemental Data SUPPLEMENTAL TEXT. Cloning:

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Guide-it Indel Identification Kit User Manual

Heterologous protein expression systems

Experimental genetics - I

amplification of the 5 flanking region of CAT1 with a tail for the geneticin resistance gene cassette fusion CAT1-3F

Protocols for cell lines using CRISPR/CAS

Gene Transfer 11/4/13. Fredrick Griffith in the 1920s did an experiment. Not until 1944 was DNA shown to be the moveable element

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution

Transcription:

Table S5. Bacterial strains, phages, plasmids and primers. Strains, phages, plasmids and primers Characteristics and/or description Reference/source Enterococcus faecalis V583 Human blood isolate; Vm R, Em R, Gm R (1) ATCC29212 Human urine isolate; Quality control strain; Tc R (2) T1 SS498; CDC reference strain, (3) T2 Human urine isolate; Sapporo-603; Tc R (3) T3 Human urine isolate; Sapporo-109; Tc R (3) T8 Human urine isolate; Nagasaki-742; Tc R, Em R (3) T11 Human urine isolate; Sapporo-027; (3) X98 Infant fecal isolate; Lancefield H69D6 (3) Fly1 Commensal isolate from Drosophila (3) AR01/DG Dog wound isolate; Vm R, Tc R, Em R (3) DS5 FDA strain PCI1326, Tc R, Em R (3) JH1 Clinical isolate; Tc R, Em R, Gm R (3) D6 Pig isolate; Tc R, Em R, Gm R (3) ATCC4200 Human blood isolate; Patient with rheumatic fever (3) CH188 Human liver isolate; Tc R, Em R, Gm R, Cm R, Ap R (3) E1Sol Human fecal isolate; Solomon Islands (3) HIP11704 Clinical isolate; Vm R, Em R, Gm R (3) OG1RF Human oral isolate; Rf R, Fa R (4) Merz96 Human blood isolate; Vm R, Tc R, Em R, Gm R (3) BDU50 ΔEF0858 PIP EF mutant of V583 BDU51 PIP Ef replacement strain; EFJG_01790 with EF0858 in E1Sol BDU53 EF0858 PIP EF variable region mutant in V583; Δaa 342-390 BDU54 EF0858 PIP EF variable region mutant in V583; Δaa 391-439 BDU55 EF0858 PIP EF variable region mutant in V583; Δaa 440-494 APENS1 Phage resistant mutant of V583; PIP EF 5 ISE APENS2 Phage resistant mutant of V583; PIP EF ATACGATTGA insertion APENS3 Phage resistant mutant of V583; PIP EF nucleotide deletion frameshift VPENS1 Phage resistant mutant of V583; PIP EF ATACGATTGA insertion VPENS2 Phage resistant mutant of V583; PIP EF nucleotide deletion frameshift VPENS3 Phage resistant mutant of V583; PIP EF nucleotide change; Glu to Stop VFWNS1 Phage resistant mutant of V583; PIP EF ATACGATTGA insertion VFWNS2 Phage resistant mutant of V583; PIP EF nucleotide change; Gly to Stop VFWNS3 Phage resistant mutant of V583; PIP EF nucleotide change; Gly to stop Enterococcus faecium Com12 Human fecal isolate (3) Com15 Human fecal isolate (3) 1,141,733 Human blood isolate (3) Escherichia coli TG1 [F' trad36 proab laciqz ΔM15] supe thi-1 Δ(lac-proAB) Δ(mcrBhsdSM)5(rK - mk -) Lucigen Phages ɸVPE25 Siphoviridae; Wastewater isolate ɸVFW Siphoviridae; Wastewater isolate Plasmids plt06 E. faecalis allelic exchange vector; Cm R (5) plz12 Shuttle vector; psh71 origin; Cm R (6) pat28-cat Shuttle vector; puc and pamβ1 origins; Cm R Rodrigues and Palmer, 2016 pltpip plt06 with ΔEF0858 extending from +25 to +2649 bp with respect to the predicted start site; Cloned as a PstI-NcoI fragment; Allelic exchange vector for deletion of PIP EF in E. faecalis V583 pltdpipa plt06 with ΔEF0858 extending from +1024 to +1170 bp with respect to the predicted start site; Cloned as a XbaI-NcoI fragment; Allelic

pltdpipb pltdpipc pltpdv1 plzpip plzev ppbpip Primers EF0858L-F EF0858L-R EF0858R-F EF0858R-R PIP_F3TruncA PIP_R1TruncA PIP_F2TruncA PIP_R3TRuncA PIP_F1TruncB PIP_R1TruncB PIP_F2TruncB PIP_R2TruncB PIP_F1TruncC PIP_R1TruncC exchange vector for ΔA truncation of PIP EF in E. faecalis V583 plt06 with ΔEF0858 extending from +1171 to +1317 bp with respect to the predicted start site; Clone as a XbaI-NcoI fragment; Allelic exchange vector for ΔB truncation of PIP EF in E. faecalis V583 plt06 with ΔEF0858 extending from +1318 to +1482 bp with respect to the predicted start site; Cloned as a XbaI-NcoI fragment; Allelic exchange vector for ΔC truncation of PIP EF in E. faecalis V583 plt06 with EF0858 from +76 bp to +2751 with respect to the predicted start site; Cloned as a XbaI-NcoI fragment; Allelic replacement vector used to generate transgenic PIP EF in E. faecalis E1Sol plz12 carrying V583 PIP EF from -180 to +2780 with respect to the predicted start site; Complementation plasmid; Cloned as a PstI-BglII fragment plz12 carrying chimeric PIP EF ; E1sol PIP Ef from -180 to +1261 fused to V583 PIP Ef from +1262 to +2769 bp with respect to the predicted start site; PIP swapping plasmid for E. faecalis; Cloned as a PstI-BglII fragment pat28-cat carrying V583 PIP EF from -180 to +2780 with respect to the predicted start site; PIP swapping plasmid for E. faecium; Cloned as a KpnI fragment NNNNNNCTGCAGGATCAACAGAAACTGGTAGAGGACTATC; Forward primer for the left homology fragment and for final overlap extension PCR to generate pltpip; PstI site CAGCTTTTTGTTTTTTAATGGAATAAATGGCTCCATGTATTTTTTATA TGTTTCATAAAATCACCTGC; Reverse primer for the left homology fragment used to generate pltpip GCAGGTGATTTTATGAAACATATAAAAAATACATGGAGCCATTTATT CCATTAAAAAACAAAAAGCTG; Forward primer for the right homology fragment used to generate pltpip NNNNNNCCATGGACGCAAACGTTTGGCTGG; Reverse primer or the right homology fragment and for final overlap extension PCR to generate pltpip; NcoI site NNNNNNTCTAGATTGATTGTTGCCTTAATGATTATTCCATCATTATA TGCA; Forward primer for the left homology fragment and for final overlap extension PCR to generate pltdpipa; XbaI site TCCTAGGCTTTCAGACAGTTGTTGCTTGCCATCTAATGTGACATTC CCTAAATCATTGGC; Reverse primer for the left homology fragment used to generate pltdpipa GCCAATGATTTAGGGAATGTCACATTAGATGGCAAGCAACAACTGT CTGAAAGCCTAGGA; Forward primer for the right homology fragment used to generate pltdpipa NNNNNNCCATGGCCGTGCTGAAAATTGTTCCCGTTTAGAGAA; Reverse primer or the right homology fragment and for final overlap extension PCR to generate pltdpipa; NcoI site NNNNNNTCTAGAGCCGGGATTTATTTACCTAAAGATTTTTCCAAAG AT; Forward primer for the left homology fragment and for final overlap extension PCR to generate pltdpipb; XbaI site CGCATTCACATCAATGTTATCAACATCAGTTTTTAATCTAATTGCTT CTCTTTCTTCAACTGGTAAACGATG; Reverse primer for the left homology fragment used to generate pltdpipb CATCGTTTACCAGTTGAAGAAAGAGAAGCAATTAGATTAAAAACTG ATGTTGATAACATTGATGTGAATGCG; Forward primer for the right homology fragment used to generate pltdpipb NNNNNNCCATGGCGCTTCAACATCTGGCATTTTCTCATTGAC; Reverse primer or the right homology fragment and for final overlap extension PCR to generate pltdpipb; NcoI site NNNNNNTCTAGATTCAATGATATTGGCTATGATATTGATAAAAACAT GGTTAGC; Forward primer for the left homology fragment and for final overlap extension PCR to generate pltdpipc; XbaI site TTTGTTTAGTTGACCTTGAGCGTTTTGGATAACTACAATACCATCAA TCGTATTCAATCTATTTATTGTGTC; Reverse primer for the left homology fragment used to generate pltdpipc

PIP_F2TruncC GACACAATAAATAGATTGAATACGATTGATGGTATTGTAGTTATCC AAAACGCTCAAGGTCAACTAAACAAA; Forward primer for the right homology fragment used to generate pltdpipc PIP_R2TruncC NNNNNNCCATGGACACAAAGCTGTATAGAATGGCGTACTTGC; Reverse primer for the right homology fragment and for final overlap extension PCR to generate pltdpipc; NcoI site PIPswap-F1 NNNNNNTCTAGATTTTTGATTGTTGCCTTAATGATTATTCCATCA; Forward primer used to amplify the E. faecalis V583 PIP EF region in pltpdv1; XbaI site PIPswap-R1 NNNNNNCCATGGATAAAGAATTGCACCGCCAATACTAAAGAC; Reverse primer used to amplify the E. faecalis V583 PIP EF region in pltpdv1; NcoI site PIPcompLZ-F1 NNNNNNCTGCAGCCAGAAGCCATTGATGAAGTTAAAC; Forward plzpip; PstI site PIPcompLZ-R1 NNNNNNAGATCTATTGCCAAAAAGTCAAAAGCAAGAGC; Reverse plzpip; BglII site PIPF1-E NNNNNNCTGCAGCCAGAAGCCATTGATGAAGTTAAACAAGTC; Forward primer for the left homology in plzev; PstI site PIPR1-E AATCGTATTCAATCTATTTATTGTGTCTTGTAAATCAGTGTTACCTG TGGCTTCTTGTATTTGCGT; Reverse primer for the left homology fragment in plzev; BglII site PIPF2-V ACGCAAATACAAGAAGCCACAGGTAACACTGATTTACAAGACACAA TAAATAGATTGAATACGATT; Forward primer for the right homology fragment in plzev PIPR2-V NNNNNNAGATCTATTGCCAAAAAGTCAAAAGCAAGAGC; Reverse primer for the right homology fragment in plzev; BglII site PIPcomp28-F1 NNNNNNGGTACCCCAGAAGCCATTGATGAAGTTAAAC; Forward ppbpip; KpnI site PIPcomp28-R1 NNNNNNGGTACCATTGCCAAAAAGTCAAAAGCAAGAGC; Reverse ppbpip; KpnI site PIPvaruniv-F GTCACATTAGATGGCGCYAMTMAATTG; Forward primer to amplify the PIP EF variable region from sewage samples PIPvaruniv-R CTTGAGCGTTTTGGATGGTASRAYTTAYTTTG; Reverse primer to amplify the PIP EF variable region from sewage samples PIPorf-F GCCATTGATGAAGTTAAACAAGTCGTTTCGG; Forward primer used to amplify the PIP EF from E. faecalis mouse intestinal isolates PIPorf-R GCTGTTCGTTTTTCCAATTTACGACGTTC; Reverse primer used to amplify the PIP EF from E. faecalis mouse intestinal isolates VFW_2_For TATTTTGAGTTTTATTTTGTTGTTT; Forward methyl primer for ɸVFW bisulfite sequencing VFW_2_Rev AATCCCAATCCTATTTACCATATTC; Reverse methyl primer for ɸVFW bisulfite sequencing VPE25_1_For GTTGGATAGTAGTAAAAATTAAAATATTTG; Forward methyl primer for ɸVPE25 bisulfite sequencing VPE25_1_Rev ACTAACATTAATCCAAAACCAATAAAAC; Reverse methyl primer for ɸVPE25 bisulfite sequencing OG1RF_11844_For GATATTTGTAGGTATATTTTTGTTT; Forward methyl primer for E. faecalis OG1RF bisulfite sequencing OG1RF_11844_Rev AAATATTACTTTCATTAATAAAACC; Reverse methyl primer for E. faecalis OG1RF bisulfite sequencing mtail-f1 GACGCATTCTATGCGGACGA; Forward qpcr primer for amplifying orf_117 transcripts from ɸVPE25 mtail-r1 AATGCTACACGAGGGGCAAC; Reverse qpcr primer for amplifying orf_117 transcripts from ɸVPE25 PGRP-F1 TAAAGCACAGTTGGCGCAAG; Forward qpcr primer for amplifying orf_106 transcripts from ɸVPE25 PGRP-R1 GCGCGTCTGGGTTTTTGTAG; Reverse qpcr primer for amplifying orf_106 transcripts from ɸVPE25

capsid-f1 capsid-r1 EFrecA-F1 EFrecA-R1 733recA-F1 733recA-R1 TGCGTGACATCGCTTACTCT; Forward qpcr primer for amplifying orf_123 transcripts from ɸVPE25 AGTTACCGTCTTCACGAGCA; Reverse qpcr primer for amplifying orf_123 transcripts from ɸVPE25 GATGGTGAGATGGGAGCGAG; Forward qpcr primer for amplifying reca transcripts from E. faecalis V583 CACGTCCACCAGGAGTTGTT; Reverse qpcr primer for amplifying reca transcripts from E. faecalis V583 CACAGCCTGACACAGGAGAA; Forward qpcr primer for amplifying reca transcripts from E. faecium 1,141,733 ACGTGCTTGTAACCCGACAT; Reverse qpcr primer for amplifying reca transcripts from E. faecium 1,141,733 Vm R - vancomycin resistance; Tc R - tetracycline resistance; Em R - erythromycin resistance; Gm R - Gentamicin resistance; Cm R - chloramphenicol resistant; Rf R - rifampicin resistance; Fa R - fusidic acid resistance; Ap R - ampicillin resistance; Restriction sites are underlined 1. Paulsen IT, Banerjei L, Myers GS, Nelson KE, Seshadri R, Read TD, Fouts DE, Eisen JA, Gill SR, Heidelberg JF, Tettelin H, Dodson RJ, Umayam L, Brinkac L, Beanan M, Daugherty S, DeBoy RT, Durkin S, Kolonay J, Madupu R, Nelson W, Vamathevan J, Tran B, Upton J, Hansen T, Shetty J, Khouri H, Utterback T, Radune D, Ketchum KA, Dougherty BA, Fraser CM. 2003. Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science 299:2071-2074. 2. Kim EB, Kopit LM, Harris LJ, Marco ML. 2012. Draft genome sequence of the quality control strain Enterococcus faecalis ATCC 29212. J Bacteriol 194:6006-6007. 3. Palmer KL, Carniol K, Manson JM, Heiman D, Shea T, Young S, Zeng Q, Gevers D, Feldgarden M, Birren B, Gilmore MS. 2010. High-quality draft genome sequences of 28 Enterococcus sp. isolates. J Bacteriol 192:2469-2470. 4. Bourgogne A, Garsin DA, Qin X, Singh KV, Sillanpaa J, Yerrapragada S, Ding Y, Dugan-Rocha S, Buhay C, Shen H, Chen G, Williams G, Muzny D, Maadani A, Fox KA, Gioia J, Chen L, Shang Y, Arias CA, Nallapareddy SR, Zhao M, Prakash VP, Chowdhury S, Jiang H, Gibbs RA, Murray BE, Highlander SK, Weinstock GM. 2008. Large scale variation in Enterococcus faecalis illustrated by the genome analysis of strain OG1RF. Genome Biol 9:R110. 5. Thurlow LR, Thomas VC, Hancock LE. 2009. Capsular polysaccharide production in Enterococcus faecalis and contribution of CpsF to capsule serospecificity. J Bacteriol 191:6203-6210.

6. Perez-Casal J, Caparon MG, Scott JR. 1991. Mry, a trans-acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of two-component regulatory systems. J Bacteriol 173:2617-2624.

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback