Coleman et al., Supplementary Figure 1

Similar documents
SUPPLEMENTARY INFORMATION

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Immunofluorescence images of different core histones and different histone exchange assay.

FBH1 Catalyzes Regression of Stalled Replication Forks

PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4 Cdt2 ubiquitin ligase complex

HCT116 SW48 Nutlin: p53

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Bub1 Plk1 kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Electronic Supplementary Information

SUMOstar Gene Fusion Technology

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Distinct Action of the Retinoblastoma

Lecture 8: Affinity Chromatography-III

Confocal immunofluorescence microscopy

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Supplementary Materials for

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Supporting Online Material for

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2

The preparation of native chromatin from cultured human cells.

supplementary information

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.

Docking of a Specialized PIP Box onto Chromatin-Bound PCNA Creates a Degron for the Ubiquitin Ligase CRL4 Cdt2

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

1. Cross-linking and cell harvesting

EGFR (Phospho-Ser695)

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

AFFINITY HIS-TAG PURIFICATION

The MAP Kinase Family

SUPPLEMENTARY INFORMATION

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Mammalian Orc1 Protein Is Selectively Released from Chromatin and Ubiquitinated during the S-to-M Transition in the Cell Division Cycle

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

SANTA CRUZ BIOTECHNOLOGY, INC.

7.06 Problem Set #3, Spring 2005

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Supplementary Information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

Xfect Protein Transfection Reagent

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

Nature Neuroscience: doi: /nn Supplementary Figure 1

MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Nature Structural and Molecular Biology: doi: /nsmb.2937

Immunoassay Kit Catalog # KCA0021. Canine. C-Reactive Protein

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Nickel-NTA Agarose Suspension

Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov

ab Hypoxic Response Human Flow Cytometry Kit

Human Cdc14A regulates Wee1 stability by counteracting CDK-mediated phosphorylation

Technical Note. Housekeeping Protein Validation Protocol

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli

mir-24-mediated down-regulation of H2AX suppresses DNA repair

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

Anaphase-Promoting Complex/Cyclosome Participates in the Acute Response to Protein-Damaging Stress

Azure Biosystems Western Blotting Workflow

Cyclin-dependent Kinases Are Inactivated by a Combination of p21 and Thr-14/Tyr-15 Phosphorylation after UV-induced DNA Damage*

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

SUPPLEMENTARY MATERIAL

A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression

7.06 Cell Biology EXAM #2 March 20, 2003

Maintenance of genomic information depends on faithful replication

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

Received 17 July 2003/Returned for modification 10 September 2003/Accepted 21 October 2003

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Supplementary Figures and Legends

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.

RayBio Human bfgf ELISA Kit

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Identification of PSD-93 as a Substrate for the Src Family Tyrosine Kinase Fyn*

Technical tips Session 5

Aurora Kinase-A Inactivates DNA Damage-Induced

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Mutation of Cyclin/cdk Phosphorylation Sites in HsCdc6 Disrupts a Late Step in Initiation of DNA Replication in Human Cells

CRL1-FBXO11 Promotes Cdt2 Ubiquitylation and Degradation and Regulates Pr-Set7/Set8-Mediated Cellular Migration

Supplemental Information for:

Dual Mechanisms for the Inhibition of E2F Binding to RB by Cyclin-Dependent Kinase-Mediated RB Phosphorylation

Transcription:

Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential thymidine and nocodazole treatment and fixed at 2.5 h (G1), 4 h (early S), or 5.5 h (mid S) post nocodazole release. Cells were labeled with BrdU 3 minutes prior to fixation and staining with the indicated antibodies. Scale bar = 1 mm.

% Remaining Cell cycle length (h) Cell Number Coleman et al., Supplementary Figure 2 C) -CFP-HA UV (min): 15 3 6 12 18 YFP-HA- -CFP-HA 15 1 75 5 Anti -HA Anti- (light) Doxycycline (ng/ml): 2 3 2 -CFP-HA YFP-HA- Anti Anti -CFP-HA YFP-HA- Anti- (dark) Anti D) 1 2 3 4 ng/ml 2 ng/ml 1 2 3 4 5 6 3 ng/ml 2 ng/ml 1 5 5 1 15 Time (min) YFP -CFP E) 3 25 2 15 1 5 2C 4C Doxycycline (ng/ml) 2 75 ng/ml ng/ml ng/ml dox dox dox Supplementary Figure 2. YFP- and -CFP fusion protein expression and validation. ( Asynchronously proliferating U2OS cells expressing -CFP-P2A-YFP- were treated with 2 J/m 2 UV and collected at the indicated times. The asterisk () marks the predicted position of the uncleaved fusion which is undetectable. ( Quantifications of immunoblots from A. (C) U2OS cells were treated with the indicated concentrations of doxycycline to induce expression of YFP- and -CFP fusion proteins; fusions were detected by immunoblotting. (D) Cells treated with the indicated doxycycline concentrations as in (C) were analyzed by flow cytometry for DNA content. (E ) Live cell movies of cells induced with the indicated doxycycline concentrations were analyzed for cell cycle length. Twenty cells ( ng/ml and 2 ng/ml) and 19 (75 ng/ml) cells were counted from one mitotic event to the next mitotic event. Error bars indicate standard deviations.

Cell Number HA- ln (% remaining) band intensity % remaining Coleman et al., Supplementary Figure 3 Fraction loaded (-UV) Time (min) post-uv 1 1 1 1 1 1 1 2 4 8 16 32 15 3 6 9 12 18 i) 1. ii).5 1 5 (dark) (light) tubulin 1 2 3 4 5 6 7 8 9 1 11 12 13 iii). 1..8.6.4.2. fraction loaded -1-2 -3-4 -5 3 6 9 121518 Time (min) 3 6 9 121518 Time (min) post-uv y = -.41x -.232 t 1/2 () = 11 min +CHX UV (min): 1 3 6 12 18 PR-Set7 HA- 1 2 3 4 5 6 7 8 -CHX 1 3 6 12 18 9 1 11 12 C) UV (J/m 2 ): 1 2 5 2 HA- vector 1 2 3 4 5 6 D) J/m 2 1 J/m 2 2 J/m 2 5 J/m 2 E) HeLa HCT116 UV (min): 1 3 6 12 18 1 3 6 12 18 PR-Set7 1 2 3 4 5 6 7 8 9 1 11 12 F) K153A UV (min): 15 3 6 912 18 HA- K153A 1 2 3 4 5 6 2C 4C WT-HA- (no UV) Supplementary Figure 3. protein degradation is independent of DNA damage-inducible expression. (. Example of semi-quantitative immunoblot analysis of substrate degradation kinetics. (Lanes 1-6, (i): Two-fold serial dilutions of HCT116 cell lysate were immunoblotted for endogenous and tubulin (light and dark exposures are shown). Lanes 7-12, (ii): HCT116 cells were irradiated with 2 J/m 2 UV, harvested at the indicated time points, and probed for endogenous and tubulin. Band intensities from multiple exposures were used to generate graphs of lysate loaded (i) and degradation (ii). (iii) Semi-log plot of % remaining values used for half-life determinations. ( HCT116 cells were subjected to 2 J/m 2 UV and treated with cycloheximide (1 µg/ml) immediately after irradiation (lanes 1-6) or left untreated (lanes 7-12). Cells were harvested at the indicated time points for immunoblot analysis. (C) Asynchronous HCT116 cells were treated with the indicated doses of UV and collected after 24 h for immunoblot analysis. (D) Cells treated as in (C) were analyzed by flow cytometry for DNA content. HCT116 cells stably expressing wild-type HA-tagged used in Figure 4A are included for comparison. (E) HeLa cells were subjected to a UV time-course and compared to HCT116 cells. (F) HCT116 cells expressing ectopic HA- deficient for TRIM39 binding (K153 were treated with 2 J/m 2 and harvested at the indicated time-points for immunoblot analysis of ectopic and endogenous levels.

% Remaining % Remaining Coleman et al., Supplementary Figure 4 PIP HA- UV (min): 15 3 6 9 12 18 P21 PIPm tubulin 1 PIPm- endogenous 5 3 6 9 12 15 18 Time (min) key a.a: () ---MEQRRVTDFFARRRPG PR-Set7 GKTQQNRKLTDFYPVRRSS GRKRRQTSMTDFYHSKRRL PIPm GRKRRQTSAAAAAHSKRRL C) Δ (15 546) -HA ΔPIP--HA (anti-h UV (min): 15 3 6 12 18 tubulin 1 PIP endogenous 5 3 6 9 12 15 18 Time (min) Supplementary Figure 4. Mutation of PIP degron sequences impairs CRL4 Cdt2 -mediated proteolysis. ( Cells expressing ectopic HA-tagged bearing alanine substitutions in amino acids 146-15 were treated with 2 J/m 2 UV and harvested at the indicated time-points for immunoblot analysis. ( Alignment of the PIP degron sequences from human, PR-Set7, and. Basic residues are in magenta, hydrophobic residues in green, and the conserved T and D common to PIP degrons are in blue. (C) 15-546 lacking the native PIP degron and tagged at the C-terminus was expressed from a doxycycline-inducible promoter in U2OS cells (2 ng/ml doxycycline), then analyzed as in A.

Cell Number Cell Number Coleman et al., Supplementary Figure 5 Doxycycline (ng/ml) : PIP --YFP YFP-WT- (-) YFP-WT PIP - -YFP 1 3 2 1 3 2 Endo. 1 2 3 4 5 6 7 8 9 YFP-WT- PIP --YFP ng/ml ng/ml 1 ng/ml 1 ng/ml 3 ng/ml 3 ng/ml 2 ng/ml 2 ng/ml 2C 4C DNA Content 2C 4C DNA Content C) YFP-WT- PIP --YFP UV (min): 15 3 6 12 18 15 3 6 12 18 PIP --YFP YFP-WT- Endo. 75 kda 5 37 25 2 Anti- light Anti- dark 1 2 3 4 5 6 7 8 9 1 11 12 Supplementary Figure 5. Validated YFP- and PIP--YFP fusion regulation and function. ( Asynchronous U2OS cells expressing either YFP (Venus)- or PIP--YFP fusions were induced with the indicated concentrations of doxycycline and then subjected to anti- immunoblot analysis. ( indicates a non-specific band that serves as a loading control.) ( Flow cytometry analysis of DNA content of cells expressing YFP fusion proteins shown in (. Doxycycline concentrations of each cell line used in the imaging analysis in Figure 5 are underlined. (C) Asynchronous U2OS cells expressing either YFP- or PIP--YFP proteins (induced with 2 ng/ml doxycycline) were treated with 2 J/m 2 UV and collected at the indicated times for immunoblot analysis.

Input GST GST-WT GST-PIPm Coleman et al., Supplementary Figure 6 PCNA GST- Ponceau S GST 1 2 3 4 Supplementary Figure 6. PIPm (PIP degron mutant) fails to bind PCNA DNA. ( The indicated GST fusion proteins were purified from E.coli lysates with glutathione-sepharose beads and incubated with sonicated chromatin fractions from UV-irradiated 293T cells. Bound proteins were eluted in 2X SDS buffer and subjected to immunoblot analysis after normalizing for bound GST. ( Alignment of PIP degron sequences from human, PR-Set7, and PIPm. Positions previously shown to be important for CRL4 Cdt2 -mediated degradation are shown in red.

Coleman et al., Supplementary Figure 7 sirna: GL2 UV(min): 15 3 45 6 PIP - PIP - Endo. GAPDH UBCH8 15 3 45 6 Anti- (dark) Anti- (light) 1 2 3 4 5 6 7 8 9 1 sirna: GL2 UV(min): 15 3 45 6 PIP - UBE2G1+G2 15 3 45 6 Endo. Endo. GAPDH Anti- (dark) Anti- (light) 1 2 3 4 5 6 7 8 9 1 sirna: UBCH8 UBE2G1 UBE2G2 GAPDH Supplementary Figure 7. The PIP degron fused to is still a substrate for the -specific E2 (UBCH8). ( HCT116 stably expressing PIP - were depleted of UBCH8 or UBE2G1 +UBE2G2 as in Shibata et al. 211. Cells were treated with cycloheximide for 1 min before 2 J/m 2 UV irradiation, collected at the indicated times after UV treatment and then analyzed for ectopic and endogenous by immunoblotting; GAPDH serves as a loading control. ( Immunoblot analysis of sirna transfected cells to assess E2 depletion.

h post-hu Cell Number vector vector YFP-WT- PIP --YFP Coleman et al., Supplementary Figure 8 si: + + + + + + + + post-hu (h): 12 12 12 12 PIP - Venus Venus-WT- tubulin 1 2 3 4 5 6 7 8 Anti- light Anti- dark si-control si-control si-+ vector 12 h post-hu si-+ WT- si-+ PIP - 2C 4C DNA Content Supplementary Figure 8. HU-mediated replication-coupled destruction and recovery. ( Immunoblot and ( flow cytometry analysis of samples from HU arrest and release experiment in Figure 7D. Cells were treated with 1 nm sirna and 1 ng/ml doxycycline as indicated.