Wnt16 smact merge VK/AB

Similar documents
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

SureSilencing sirna Array Technology Overview

supplementary information

HCT116 SW48 Nutlin: p53

Please read manual carefully before starting experiment

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplemental Material for

INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Center Drive, University of Michigan Health System, Ann Arbor, MI

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

Confocal immunofluorescence microscopy

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Supplementary Materials for

Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics

Sex affects BMPR-II signalling in pulmonary artery smooth muscle

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

Quantitative Real Time PCR USING SYBR GREEN

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

ENCODE RBP Antibody Characterization Guidelines

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Alternative Cleavage and Polyadenylation of RNA

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplementary Figure Legend

TOOLS sirna and mirna. User guide

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

GFP CCD2 GFP IP:GFP

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

SUPPLEMENTARY INFORMATION

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figures Montero et al._supplementary Figure 1

Supplementary Figure and Table Legends

Supporting Information

RayBio Phospho- Akt (Ser473) ELISA Kit

Click here to read the case study about protein synthesis.

Gene Expression Technology

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1

mir-24-mediated down-regulation of H2AX suppresses DNA repair

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Isolation, culture, and transfection of primary mammary epithelial organoids

Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces

Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts

Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells

REAL TIME PCR USING SYBR GREEN

Coleman et al., Supplementary Figure 1

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Generation of ips-derived model cells for analyses of hair shaft differentiation

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Chicken EpithelialGut CellLines 1

TransIT-TKO Transfection Reagent

CD34 Cells at the Apex of the Human Hematopoietic Stem Cell Hierarchy Have Distinctive Cellular and Molecular Signatures

Read and take notes on pages

Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart

EGFR (Phospho-Ser695)

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

Bronchial epithelium and its associated tissues act as a

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Supporting Online Material for

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

EECS730: Introduction to Bioinformatics

cdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC CATGGCGCTGCCGCGGCACA-3 ) and XhoI-PmeI-GFP (5 - GGCCCTCGAGGTTTAAACT

IPA Advanced Training Course

JANUARY 20, 2006 VOLUME 281 NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 1765

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

SUPPLEMENTARY INFORMATION

Topical sirna for management of androgenic alopecia and oily skin Quark Pharmaceuticals, Inc.

AP Biology Gene Expression/Biotechnology REVIEW

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

TransIT -mrna Transfection Kit

SUPPLEMENTAL MATERIALS

OPPF-UK Standard Protocols: Mammalian Expression

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Transcription:

A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day old (A) or 4.5 week old () wild-type (WT) or MGPdeficient (KO) mice [nuclei counterstained with DAPI (blue)]. In A, adjacent sections were incubated with control IgG. And in, adjacent sections were stained for deposition of calcified (black) and glycosaminoglycan-rich (blue) matrices by von Kossa (VK) and Alcian blue (A) stains, respectively. Scale bar in A = mm. Scale bar in = 5 mm.

b-catenin luciferase activity (fold) A pwnt6: - + Wnt6 GAPDH 8 6 4 Medium Cell lysate pwnt6-medium: - + SUPPLEMENTAL FIGURE II: Active Wnt6 is secreted by transfected Cos7 cells. A, Western blot for Wnt6 protein in equal volumes of conditioned medium collected from mock-transfected Cos7 cells or Cos7 cells transfected with Wnt6 plasmid (pwnt6). Roughly equal numbers of cells were used in this experiment as evident from Western blot for GAPDH in total cell lysates., Activity of the TCF/LEF-responsive luciferase reporter dependent on canonical b-catenin signaling in cells treated with mock- or pwnt6-conditioned medium (N=3)., p<.5.

Smad-dependent luciferase activity 5 4 3 MP: + + Noggin: + - LDN9389: - - - + SUPPLEMENTAL FIGURE III: Efficiency of MP inhibitors. Noggin ( ng/ml) or LDN9389 (5 nmol/l) effects on MP- induced activity of Smad-dependent luciferase reporter in A cells treated with recombinant MP (5 ng/ml) for 48 hours (N=4)., p<.

SUPPLEMENTAL FIGURE IV: Adapted representation of Ingenuity Pathway Analysis (IPA). RNA deep sequencing data revealing the interactions between 33 (gray symbols) out of 6 signature transcripts and molecules of the Mechanistic IPA network. The presence of known direct and indirect relationships between signature genes and members of the network are indicated with solid and dashed lines, respectively. For clarity, relationships between non-signature molecules were omitted.

A psmad smactin psmad/smact/dapi phase WT KO psmad/5/dapi WT-d3 KO-d3 vertebra limb/bone SUPPLEMENTAL FIGURE V: Smad activation in MGP-null aortic tissue. A, Immunostaining for phosphorylated Smads (psmad) implicates activation of TGFb signaling in aortae from 4.5 week old (d3) MGP-null (KO) but not in wild-type (WT) mice [nuclei counterstained with DAPI (blue)]. Phase images of tissue morphology (right panels) show cartilaginous metaplasia in KO aorta in contrast to typical aortic morphology in WT tissue with characteristic elastic lamina. Scale bar = mm, Lack of immunostaining for phosphorylated Smads and 5 (psmad/5) suggests no activity of the MP signaling in aortae from 4.5 week old (d3) wild-type (WT) and MGP-null (KO) mice [nuclei counterstained with DAPI (blue)]. Cartilaginous metaplasia is outlined with white dashed oval. Control sections of neonatal mice showed positive stain for psmad/5 in both developing vertebrae and limb bones. Scale bar = mm in aortae. Scale bar = 5 mm in neonatal tissues.

8 6 4 GAG deposition (fold) DMEM DMEM-S TGFb: - + - - TGFb: - - + - TGFb3: - - - + SUPPLEMENTAL FIGURE VI: TGFb-induced chondrogenic transformation in WT VSMCs. Equal pro-chondrogenic activities of the TGFb isoforms ( ng/ml) on A micromasses cultured for 8 days is shown by similar levels of glycosaminoglycan (GAG) synthesis detected with Alcian blue stain. Graph shows quantitation of extracted Alcian blue dye normalized to crystal violet stain for cell density (N=4)., p<..

Wnt6 mrna (fold) Wnt6 protein (fold) A..8.6.4. TGFb: - + Wnt6 GAPDH..8.6.4. TGFb: - + TGFb: - - + + Wnt6: - + - + SUPPLEMENTAL FIGURE VII: TGFb-induced repression of Wnt6 in VSMCs and effects on chondrogenesis. A, Expression of Wnt6 is reduced by TGFb3 ( ng/ml, 7 hours) in rat A VSMCs. Real-time PCR analysis for expression of Wnt6 mrna (left) and Western blot for protein levels (right) (N=3)., p<.., Representative images of A VSMCs micromasses treated with TGFb3 and Wnt6 and stained with Alcian blue dye to detect GAG.

osteogenic gene expression (fold) relative cell number (% of untreated) LDH release in medium (AU) SMC markers (fold) SMC markers (fold) A..8.6.4. Cnn MHC sma smact Wnt6 shscr: + - shwnt6: - + + - - + + - + - - + - + + - - + C D.4..8.6.4. SP OPN TGFb: + + Wnt6: - - + - - + 3 5 5 5 TGFb: + Wnt6: - + SUPPLEMENTAL FIGURE VIII: Effects of Wnt6 on gene expression in wild type VSMC. A-, Wnt6 supports expression of smooth muscle contractile markers. Down-regulation of Wnt6 by sirna results in down-regulation of contractile markers (A). In contrast, exogenous Wnt6 induces contractile markers expression inhibited by TGFb ().Gene expression analyzed by real-time PCR and compared to expression in non-transformed VSMC after normalization to ribosomal protein L9 expression (N=3). C, Expression of osteogenic genes in 8 days old rat A VSMCs micromasses in the presence or absence of exogenous Wnt6 (N=4). D-E, Exogenous Wnt6 did not affect either total cell number (detected by DNA staining with Crystal violet (D) or cytotoxicity in 4 day old chondrogenic micromasses (detected by release of lactate dehydrogenase into the medium) (E) compared to micromasses cultured in plain DMEM (N=4). NS not significant..5.5.5 NS calponin MHC sma smact E TGFb: + + + + Wnt6: - - + - - + - - + - - + 3.5.5.5 NS TGFb: + Wnt6: - - +

Notch gene expression (fold) Notch gene expression (fold) A..8.6.4. Dll Notch Jag Hey Hes DAPT: - + - + - + - + - +.5 Notch Dll Jag Jag.5 TGFb: - + - + - + - + SUPPLEMENTAL FIGURE IX. TGFb3 inhibits Notch signaling in wild type VSMC. Real-time PCR analysis of the expression of Notch genes in A VSMCs treated with either Notch inhibitor DAPT (A, N=3) or exogenous TGFb ( ng/ml) (, N=3)., p<.5;, p<.;, p<..