Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
|
|
|
- Scott Barton
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the negative control sirna. (b) Western blot for PTEN protein level in 22Rv1 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and 1
2 PTEN as well as the negative control sirna. (c) The qrt-pcr for lnc-2 and lnc-6 and RNA level in DU145 and 22Rv1 cells transfected with the sirna against PTEN and the negative control sirna. (d) The qrt-pcr for PTEN, VAPA and SERINC1 RNA level in DU145 cells transfected with the sirna against PTEN, lnc1-7, and the negative control sirna. (e) The relative expression level of lnc-2 (ΔΔct value normalized to mock control group) and (f) western blot for PTEN and actin control protein level in DU145 cells for the rescue experiment. Mock: tranfection agent only; Neg mirs: transfected with scrambled mir control; mirs: transfected with 10 PTEN-targeting mirs precursors; Vector Ctrl: transfected with empty expressing vector only; F1: transfected with the expressing vector inserted with lnc-2 gene fragment 1; F2: transfected with the expressing vector inserted with lnc-2 gene fragment 2; mirs+f1: co-transfected with PTEN-targeting mirs precursors and with the expressing vector inserted with lnc-2 gene fragment 1; mir+f2: co-transfected with PTEN-targeting mirs precursors and with the expressing vector inserted with lnc-2 gene fragment 2. All experiments with error bars were performed in three replicates (n=3). Error bars are defined as SD. The two-sample t-test was used to calculate the significance of difference between the means of two experimental groups (*p<0.05, ** p<0.01). 2
3 Supplementary Figure 2. RNA-FISH for probe set quality control (a) even probes of lnc-2, (b) odd probes of lnc-2, and (c) the merged image of (a) and (b) in DU145 cells, as well as (d) even probes of lnc-7, (e) odd probes of lnc-7 and (f) the merged image of (d) and (e). DAPI staining of nucleus is shown in blue. The FISH signal of even probes is shown in red and that of odd probes is shown in green. 3
4 Supplementary Figure 3. RNA-FISH for determining subcellular localization of (a) lnc-2, (b) ln-6, and (c) lnc-7 in DU145 cells, as well as (d) lnc-2, (e) ln-6 and (f) lnc-7 in 22Rv1 cells. DAPI staining of nucleus is shown in blue and FISH signal is shown in red. 4
5 Supplementary Figure 4. (a) Cell proliferation curves of 22Rv1 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and PTEN as well as the negative control sirna. Anchorage-independent growth of (b) 22Rv1, (c) the wild type HCT116, and (d) the HCT116 DICERex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and PTEN as well as the negative control sirna. All the bar graph showed the quantification of the colony formation after 10 days. All experiments with error bars were performed in three replicates (n=3). Error bars are defined as SD. The two-sample t-test was used to calculate the significance of difference between the means of two experimental groups and the one-way analysis of variance (ANOVA) was used to calculate the significance of difference between the means of more than two groups (*p<0.05, ** p<0.01). 5
6 Supplementary Figure 5. The uncropped scans of (a) Western blot for PTEN protein level in DU145 cells (corresponding to Figure 4a), (b) Western blot for PTEN protein level in wild type HCT116 and HCT116 Dicer ex5 cells (corresponding to Figure 4c), (c) Western blot for phospho-akt level following serum starvation and restimulation of DU145 cells (corresponding to Figure 6d), and (d) Western blot for AKT level following serum starvation and restimulation of DU145 cells (corresponding to Figure 6d). 6
7 lnc-2 RNAi-1 RNAi-3 RNAi-4 lnc-6 (TUG1) RNAi-1 RNAi-3 RNAi-4 lnc-7 RNAi-1 RNAi-2 RNAi-3 RNAi-4 UGUGUCUUCAACUUGUAUC UAUUACGGUACUAAUAUCCCU AUCCGCAUUUCCUGUUGGGUU GGATATAGCCAGAGAACAA GAATAAGCCCTATGGATTA CCAGAAGAGTTAAGAATCA UAUACUAGGGACUAUGCUG UUCCUAGUAAGUAUCUUGG AGCGAGCCAGUUUAUCAGGAC AUCGUGCUUUGCACAUUGGAC Supplementary Table 1. The sequences of sirnas used to knock down each candidate PTEN sp-lncrna. 7
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
7.17: Writing Up Results and Creating Illustrations
7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
sirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells
S1of S7 Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells Hanne Merethe Haatveit, Øystein Wessel, Turhan Markussen, Morten Lund, Bernd Thiede,
Supporting Information
Supporting Information Signal mingle: Micropatterns of BMP-2 and fibronectin on soft biopolymeric films regulate myoblast shape and SMAD signaling. Vincent Fitzpatrick, Laure Fourel, Olivier Destaing,
Product: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
ViewRNA ISH Cell Assays. Visualize RNA with single-molecule sensitivity and single-cell resolution
ViewRNA ISH Cell Assays Visualize RNA with single-molecule sensitivity and single-cell resolution ViewRNA ISH Cell Assays Analyze sample heterogeneity Study noncoding RNAs, including mirna and lncrna,
Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
TransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
System. Using the xcelligence System for Functional Genomics: Assessing Gene Function in Real Time. Application Note No.
System Application Note No. 11/January 2013 Using the xcelligence System for Functional Genomics: Assessing Gene Function in Real Time For life science research only. Not for use in diagnostic procedures.
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
Supplementary Figure 1
Supplementary Figure A Name Location Start position End position Oct4P Chr 3 29433673 29435 Annotation Mus musculus predicted gene 572 (Gm572), noncoding RNA RefSeq accession number NR_33594. Oct4P2 Chr
SUPPLEMENTARY DATA. Supplementary Table 2; Supplementary Figure 6; Supplementary Figure 7
SUPPLEMENTARY DATA Supplementary Table 1; Supplementary Table 2; Supplementary Figure 1; Supplementary Figure 2; Supplementary Figure 3; Supplementary Figure 4; Supplementary Figure 5; Supplementary Figure
Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
Nucleofector technology and transient protein production
amaxa xxxxxxxxxxxx Nucleofector technology research Nucleofector technology and transient protein production your link to transfection The Nucleofector technology and transient protein production Transient
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
BLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC
HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,
Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage, Jason H. Pomerantz, and Helen M. Blau
Cell Stem Cell, Volume 7 Supplemental Information Transient Inactivation of Rb and ARF Yields Regenerative Cells from Postmitotic Mammalian Muscle Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage,
Concepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
Dharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
SUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16206 DOI: 10.1038/NMICROBIOL.2016.206 Single cell RNA seq ties macrophage polarization to growth rate of intracellular
RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors
Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,
2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
Chicken EpithelialGut CellLines 1
Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came
MISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
Galina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
ARN interférence Technologies : sirna, shrna, mirna
ARN interférence Technologies : sirna, shrna, mirna LabCluster Tour 2014 - Delphine Ayache sigma-aldrich.com Methods for Modulating Gene Expression DNA RNA Protein Transcription Translation Genome Editing:
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
mcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
NTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
Learning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
LabBOOK VIROMER BLUE VIROMER GREEN. sirna /mirna transfection
LabBOOK VIROMER BLUE VIROMER GREEN sirna /mirna transfection Contact General information Bettina Weber (Biologist) +49 345 55 59 625 bettina.weber@lipocalyx.de Dr. Sandra Lagauzère (Biologist) +49 345
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
Supplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a
Cell Chemical Biology, Volume 24 Supplemental Information Lithocholic Acid Hydroxyamide Destabilizes Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting Deubiquitinase USP2a Katarzyna Magiera, Marcin Tomala,
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
SureSilencing shrna Plasmid Handbook
March 2011 SureSilencing shrna Plasmid Handbook For genomewide, plasmid-based RNA interference Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative
Biology-on-Array sirna Handbook
March 2011 Biology-on-Array sirna Handbook For regulation studies using gene silencing Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
RNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
Breast Cancer Stem Cell Fate through WNT Signaling
Cell Reports, Volume 18 Supplemental Information mir-600 Acts as a Bimodal Switch that Regulates Breast Cancer Stem Cell Fate through WNT Signaling Rita El Helou, Guillaume Pinna, Olivier Cabaud, Julien
Supplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
Same TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
Supplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Identification of Microprotein-Protein Interactions via APEX Tagging
Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian
Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103
The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based
validation report for TaqMan Roundup Ready Quantification Kit
validation report for TaqMan Roundup Ready Quantification Kit Life Technologies offers a breadth of products DNA RNA protein cell culture instruments For Research Use Only. Not intended for any animal
Supplemental Information. Antagonistic Activities of Sox2. and Brachyury Control the Fate Choice. of Neuro-Mesodermal Progenitors
Developmental Cell, Volume 42 Supplemental Information Antagonistic Activities of Sox2 and Brachyury Control the Fate Choice of Neuro-Mesodermal Progenitors Frederic Koch, Manuela Scholze, Lars Wittler,
Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. MUT-16 DAPI. Phillips et al. S-1. male.
Supplementary Material for Phillips et al. Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. Figure S2. Mutator foci and P granules localize independently
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino