Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier, Raoul Raffel, Sonia Amraoui, Julien Cau, Dany Severac, Emeric Dubois, Olivier Schwartz, Yamina Bennasser, and Monsef Benkirane
SUPPLEMENTAL INFORMATIONS The DNA-mediated innate immune response is regulated by a multi subunit complex containing HEXIM1 and NEAT1 lncrna Mehdi Morchikh 1,5,6, Alexandra Cribier 1,5,6, Raoul Raffel 1, Sonia Amraoui 3, Julien Cau 4, Dany Severac 2, Emeric Dubois 2, Olivier Schwartz 3, Yamina Bennasser 1 and Monsef Benkirane 1,6 1 Institut de Génétique Humaine, Laboratoire de Virologie Moléculaire, Université de Montpellier, CNRS UPR1142, Montpellier, 34000, France. 2 MGX-Montpellier GenomiX 3 Institut Pasteur, Virus and Immunity Unit, URA CNRS 3015, Paris, France. 4 Universités Montpellier, Montpellier, 34095 France IGH CNRS UPR 1142, Montpellier, 34396, France 5 This author equally contributed 6 Correspondence to: monsef.benkirane@igh.cnrs.fr; mehdi.morchikh@igh.cnrs.fr; alexandra.cribier@igh.cnrs.fr Inventory of Supplemental Information: Supplemental Data - Figure S1, related to Figure 1 - Figure S2, related to Figure 2 - Figure S3, related to Figure 3 - Figure S4, related to Figure 4 - Figure S5, related to Figure 5 - Figure S6, related to Figure 6 Supplemental Movies - Movie S1, related to Figure 3E - Movie S2, related to Figure 3E 1
- Movie S3, related to Figure 3E Supplemental Tables - Table S1, related to STAR methods - Table S2, related to STAR methods 2
Supplemental Data Supplementary figure 1: related to figure 1 (A) Upper panels: whole-cell extracts from HeLa S3 HEXIM1 mock treated or treated with RNAse (lane 1 and 3) and whole-cell extracts from HeLa S3 HEXIM1 transfected with si SCR or si 7SK (lane 4-5) were subjected to Flag IP. Lower panels: Flag-IPs were analysed by WB using indicated antibodies. RNA was extracted from whole cell extract or IPs and subjected to qrt-pcr analysis using 7SK-specific primers. (B) Whole cell extracts from HeLa S3 cells were subjected to endogenous IP using HEXIM1 (lane 3-4), Ku70 (lane 5-6), SFPQ (lane 7-8) or an irrelevant IgG (lane 2) antibodies. Before elution, IPs were mock-treated (lanes 2, 3, 5, 7) or treated with an RNAse cocktail to disrupt protein/rna interactions (lanes 4, 6, 8). The presence of HDP-RNP complex subunits in the IPs was assessed by WB using indicated antibodies. 3
Supplementary Figure 2: related to Figure 2 (A) HeLa S3 ehexim1 nuclear extracts or CycT1-depleted were subjected to Flag-IP. Input and bound complexes were analysed by WB using indicated antibodies. (B) Whole cell extracts from HeLa cells transfected with Flag-HEXIM1 constructs were subjected to Flag IPs. Flag-HEXIM: full length wt (1-359), truncated, or point mutants in the RRM motif (ILAA) are indicated. Input (lane 1-6) and IPs (lane 7-12) were analysed by WB using the indicated antibodies. 4
(C) HEXIM1 forms two distinct RNP complexes. The C-terminal domain of HEXIM1 forms the 7SK snrnp complex which comprise the 7SK-RNA and P-TEFb subunits. The N-terminal of HEXIM1 forms the HDP-RNP complex which comprise DNAP-PK (DNAPKc, Ku80/Ku70) and the paraspeckle components SFPQ, NONO, PSPC1. 5
Supplementary Figure 3: related to Figure 3 (A) Venn diagram showing the common and differential sets of bound RNAs found in the different complexes (Figure 3A) (B) RNA from IP used in Figure 3D was purified and 7SK and NEAT1 RNA levels were measured by RT-qPCR. (C) Upper panel: Whole cell extracts from HeLa cells, transfected with the full length Flag-HEXIM1, or with point mutants of the P-TEFb binding domain (P202S mutant) or of the RRM domain (ILAA mutant), were treated (or not) with an RNAse cocktail and subjected to Flag IPs. Input (lane 1-7) and IPs (lane 8-14) were analysed by WB using indicated antibodies. Lower panel: RNA from IPs shown in upper panel was purified and the 7SK and NEAT1 RNA levels were measured by RT-qPCR. 6
Supplementary Figure 4: related to Figure 4 Left panels: Whole cell extracts from experiment performed in (4A) were analysed by WB using the indicated antibodies. Right Panel: RNA from the experiment performed in (4A) was purified and the NEAT1 RNA level was measured by RT-qPCR. 7
Supplementary Figure 5: related to Figure 5 (A) Anti-Flag immunoprecipitation showed in Figure 1C was probed with cgas and IRF3 specific antibodies. (B) Nuclear extracts from HeLa S3 cells were subjected to endogenous IPs using HEXIM (lane 3-4), Ku70 (lane 5-6) or an irrelevant IgG (lane 2) antibodies. Before elution, IPs were mock-treated (lanes 2, 3, 5) or treated with an RNAse cocktail to disrupt protein/rna interactions (lane 4-6). (C) Whole cell extracts from HeLa cells mock-treated or treated for 6h with 10µg/ml ISD were subjected to endogenous IPs using HEXIM, Ku70 and SFPQ antibodies; an IgG irrelevant antibody was used as control. Immuno-precipitated complexes were analysed by WB using the indicated antibodies. 8
Supplementary Figure 6: related to Figure 6. (A) and (B) HUVEC cells were transfected with sirna targeting HEXIM1 (sihexim1), Ku70 (siku70), or a control non-specific sirna (siscr) for 48 hours or transfected with sirna targeting NEAT1 (sineat1) for 8 hours. Specific inhibition was assessed by western blot sihexim1 and siku70 and by qrt-pcr for sineat1. Cells were then treated with 5 µg/ml ISD for 16 hours. RNAs were purified and IFN-β expression was quantified by qrt-pcr using specific primers and normalized to actin expression. Results are expressed as fold increased expression compared to untreated cells (n=1). 9
Supplemental Movies These movies are related to Figure 3E and present an animation of the three dimensional reconstitution (3D) of the nucleus showed in Figure 3E. In each movie, NEAT1 RNA are shown in red (non-co-localized with a HDP subunit) and orange spots (co-localized). Proteins (Ku70, HEXIM1 or SFPQ) are shown in green (non-colocalized with NEAT1 RNA) and yellow spots (co-localized). Supplementary Movie S1 related to Figure 3E This movie shows the 3D reconstitution for Ku70 and NEAT1 co-localization. Supplementary Movie S2 related to Figure 3E This movie shows the 3D reconstitution for HEXIM1 and NEAT1 co-localization. Supplementary Movie S3 related to Figure 3E This movie shows the 3D reconstitution for SFPQ and NEAT1 co-localization. 10
Supplemental Tables These tables list the sequences of the sirna and qpcr primers used in this study. Oligonucleotides were synthesized by the MWG-Biotech. Table S1. sirna sequences, related to STAR methods. NEAT1 sirna SFPQ sirna shexim1 sirna Ku70 sirna SCR sirna STING sirna 5 /5Phos/rGrUrGrArGrArArGrUrUrGrCrUrUrArGrArArArCrUrUrUCC 3' (Zhang et al., 2013) 5 CUUUCUGUUCGUAAUCUUUCA 3 5' GGAUCCGAGCCGAGAUGUU 3' 5' ACAAGCAGUGGACCUGAC 3 5 auguauuggccuguauuagtt 3' #NM_198282/SASI_Hs01_0003103/ Sigma Aldrich Table S2. qpcr primers, related to STAR methods. IFNα for 5 -GCTTTACTGATGGTCCTGGTGGTG-3 IFNα rev 5 -GAGATTCTGCTCATTTGTGCCAG-3 IFNβ for 5 -GAATGGGAGGCTTGAATACTGCCT-3 IFNβ rev 5 -TAGCAAAGATGTTCTGGAGCATCTC-3 MxA for 5 -ATGAGCTAATCACCCTGGAG-3 MxA rev 5 -ATACCCAATGTCAGCAGGC-3 GAPDH for 5 -CTGGCGTCTTCACCACCATGG-3 GAPDH rev 5 -CATCACGCCACAGTTTCCCGG-3 7SK for 5 -CCCTGCTAGAACCTCCAAAC- 3 7SK rev 5 -AAGAAAGGCAGACTGCCAC -3 NEAT1 for 5'-CTTCCTCCCTTTAACTTATCCATTCAC-3' NEAT1 rev 5'-CTCTTCCTCCACCATTACCAACAATAC-3' Actin for 5'-AACCCAGCCACACCACAAAG-3' Actin rev 5'-CACTGACTTGAGACCAGTTGAATAAAA-3' 11