* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

Similar documents
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

GFP CCD2 GFP IP:GFP

supplementary information

Coleman et al., Supplementary Figure 1

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Wnt16 smact merge VK/AB

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

SUPPLEMENTARY INFORMATION

SANTA CRUZ BIOTECHNOLOGY, INC.

HCT116 SW48 Nutlin: p53

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure Legend

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Technical Note. Housekeeping Protein Validation Protocol

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Center Drive, University of Michigan Health System, Ann Arbor, MI

ENCODE RBP Antibody Characterization Guidelines

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

Please read manual carefully before starting experiment

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supporting Online Material for

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

Nature Neuroscience: doi: /nn Supplementary Figure 1

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

RayBio Phospho- Akt (Ser473) ELISA Kit

Technical tips Session 5

Real-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis

Supplementary Figure 1 Activated B cells are subdivided into three groups

Confocal immunofluorescence microscopy

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

SUPPLEMENTARY INFORMATION

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

RayBio Rat IL-6 ELISA Kit (For Lysates)

ab Ubiquitylation Assay Kit

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

QS S Assist STK_FP Kit

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Human bfgf ELISA Kit

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

The MAP Kinase Family

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

RayBio Human HGF ELISA Kit

Supporting Information

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

Fig. S1. Nature Medicine: doi: /nm HoxA9 expression levels BM MOZ-TIF2 AML BM. Sca-1-H. c-kit-h CSF1R-H CD16/32-H. Mac1-H.

Supplementary Figure 1. Isolation of GFPHigh cells.

Immunofluorescence images of different core histones and different histone exchange assay.

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

MEK1/2 (MAPK Kinase) Activity Assay Kit

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis

SUPPLEMENTARY INFORMATION

TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue and cell culture extracts.

special offers from your protein biology resource

To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV-

Supplementary Figures

EGFR (Phospho-Ser695)

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

mir-24-mediated down-regulation of H2AX suppresses DNA repair

Chapter 10 Analytical Biotechnology and the Human Genome

Xfect Protein Transfection Reagent

Protocol for induction of expression and cell lysate production

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

Maximize Your Western Blotting Results. Superior products for every step of the Western workflow

This Document Contains:

Supplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

ab SUMOylation Assay Kit

1. Cross-linking and cell harvesting

In-Cell Western Kits I and II

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

pgbkt7 Anti- Myc AH109 strain (KDa) 50

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

QS S Assist KINASE_MSA Kit

Transcription:

I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary units) 4 7 6 5 4 5 5 (min) Mannitol 5 mm Ang II ( nm) (h) -Glucose 5 mm Online figure I. p9rsk activation in cardiomyocytes (A-) Cardiomyocytes were stimulated with Ang II ( nm) (A and ) or high glucose or mannitol (C and ) for the indicated times. p-p9rsk, p9rsk and tubulin were detected by Western blotting of total cell lysates with each specific antibody. ( and ) Intensities of p-p9rsk protein bands were quantified using a Fujifilm image-analysis program (Image Gauge 4.) and were calculated relatively to the intensity of the tubulin band at each time point. Results were expressed as fold increase of p-p9rsk in AngII-treated cells compared to untreated cells. Shown is mean ± S.. (n = ). p <., p <.5 compared to untreated cells.

p9rsk kinase activity (in vitro kinase assay, arbitrary units) Ad-LacZ vehicle Ad-LacZ Ang II Ad-N-p9RSK vehicle Ad-N-p9RSK Ang II I: p9rsk p9rsk I: 5 vehicle Ang II vehicle Ang II Ad-LacZ Ad-N-p9RSK I: p-p9rsk p-p9rsk (Ser8) I: p9rsk p9rsk I: 5 Ang II 6 6 (min) vehicle FMK-MEA ( µm) Online figure II. Ad-N-p9RSK and FMK-MEA, a specific p9rsk inhibitor, blocked Ang IImediated p9rsk activation in cardiomyocytes (A) Cardiomyocytes were stimulated with Ang II ( nm), and p9rsk kinase activity was detected using an in vitro kinase assay as described in methods. The p9rsk kinase activity (upper) was normalized to its expression level, which was evaluated by Western blotting of p9rsk (lower). () Cardiomyocytes were pretreated with vehicle or FMK-MEA for hrs and stimulated with Ang II ( nm) for the indicated times. p-p9rsk, p9rsk and tubulin were detected by Western blotting of total cell lysates with each specific antibody. The blots are representative of data obtained from three separate experiments.

Relative ICER/ mrna (arbitrary units) N.S Ang II ( nm) (min) Ad-LacZ Ad-N-p9RSK I : ICER I : p9rsk I : 5 7 5 ICER p9rsk ICER expression (abitrary units) Ad-WTp9RSK Ad- LacZ Ad-WTp9RSK Ad- LacZ Online figure III. Ad-N-p9RSK did not inhibit Ang II-mediated ICER mrna expression in cardiomyocytes (A), but Ad-WT-p9RSK enhanced ICER protein levels (). (A) Cardiomyocytes were transduced with Ad-LacZ or Ad-N-p9RSK for 4 hrs. Cells were then stimulated with Ang II ( nm) for min, and ICER mrna level was detected by qrt-pcr as described in methods. () Cardiomyocytes were transduced with Ad-LacZ or Ad-WT-p9RSK for 4hrs. ICER, p9rsk and tubulin were detected by Western blotting using the total cell lysates with each specific antibody (left). Intensities of ICER protein bands were quantified using a Fujifilm image-analysis program (Image Gauge 4.) and were calculated relatively to the intensity of the tubulin band at each time point. Results were expressed as fold increase of ICER in Ad-WT-p9RSK-transduced cells compared to the Ad-LacZ-transduced cells. Shown is mean ± S.. (n = ). p <.5.

I: ICER ICER I: 5 N-p9RSK-Tg WT-p9RSK -Tg ouble- Tg Sham MI sham Sham ERK5-CKO I: ICER ICER I: 5 Online figure IV. N-p9RSK-Tg, WT-p9RSK-Tg, ouble-tg, and ERK5-CKO mice showed no difference of ICER expression in sham operated mice. Expression of ICER and tubulin in heart samples collected from sham and MI in, sham in N-p9RSK-Tg, WT-p9RSK-Tg and ouble-tg mice (A), and heart samples from sham in and ERK5-CKO ().

C!STZ i.p. (mg/kg/ W) (%) Survival rate 8 6 4 Coronary ligation N-p9RSK 4 6 8 4 (days) (n = 5) (n = 7) p <.5 Random S (mg/dl) 4 M + MI - + + ody weight (g) Np9RSK-Tg Np9RSK-Tg 4 6 8 M + MI - + + LV/TL (mg/mm) Np9RSK-Tg 7 5.5.5. M + MI - + + Lung/TL (mg/mm) 5 5 M + MI + + E LVEd (mg/min) 6 5 4 M + MI + + 5 4 M + MI + + LVESd (mg/min) FS (%) 7 6 5 4 M + MI + + EF (%) 5 5 M + MI + + Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg F G TUNEL API TUNEL-positive cells (%).6.4. M + MI - + + TUNEL/ API/αactinin Np9RSK-Tg Sham M + MI N-p9RSK-Tg Online figure V. Inhibition of p9rsk activation prevented the exacerbation of LV dysfunction after MI in diabetic mice. (A) Kaplan-Meier survival analysis in diabetic (n=7) and N-p9RSK-Tg (n=5) after MI. Overall survival was significantly higher in N-p9RSK-Tg compared to mice. p <.5 compared to group. () Random blood sugar (S) and body weight at one week after STZ injection for coronary ligation (M + MI) or vehicle-treated sham operation groups in or N-p9RSK-Tg mice. (mean ± S.., n =9-) (C) LV weight/tl (mean ± S.., n =9-) and () lung weight/tl in M + MI or vehicle-treated sham operation groups in or N-p9RSK-Tg mice one week after surgery. (p <., mean ± S.., n=9-). (E) Echocardiographic data obtained from M + MI, or vehicle treated sham operation groups in or N-p9RSK-Tg mice one week after surgery. LVEd, left ventricular end-diastolic dimension; LVESd, left ventricular end-systolic dimension; TL, Tibial length. (p<.5, p <., mean ± S.., n=9-).(f) Cardiomyocytes apoptosis in the remote area was increased in M + MI group, which was inhibited in N-p9RSK-Tg mice. TUNELpositive cardiomyocytes were counted in the remote area as described in Fig.6. Representative pictures of TUNEL (top), API (middle), and merged of α-actinin with TUNEL and API staining (bottom) of the remote area from mice subjected to sham or M+MI, and N-p9RSK-Tg mice subjected to M + MI operation. 4X objective lens. Scale bars: 4 µm (G) A bar graph showing TUNEL-positive cells (%) in and N-p9RSK-Tg. ( p <.5, mean ± S.., n =).

N-p9RSK-Tg Sham M + MI CHIP Ub E ligase assay 5 5 5 Quantification area Relative levels of ubiquitinated GST-ICER expressions.9.7.879.4.8.4.6.7.54 Online figure VI. Quantification of CHIP ubiquitin E ligase activity. The activities of CHIP Ub E ligase were assessed by quantifying ubiquitinated GST-ICER fusion proteins. riefly, protein was extracted by modififed RIPA buffer, and then immunoprecipitated with anti-chip antibody. CHIP proteins were immunopresipitated by protein A and G agarose mixture. After that, GST-ICER protein as added to each sample. CHIP Ub E ligase activity was detected using Ubiquitin-Protein Conjugation kit. Science Lab Image gauge software (version 4; Fuji Photo Film, Tokyo, Japan) was used for the analysis. Ubiquitinated GST-ICER expressions were calculated in equal area described in white broken squires. Relative levels were indicated as based on means of sham mice. 6

IP: ERK5 C IP ERK5 I: CHIP 7 CHIP I: CHIP 7 CHIP I: ERK5 ERK5 I: ERK5 ERK5 I: Myc 7 I: HA 5 I: Flag I: VP6 5 5 I: Myc-CHIP + - + + + + + + + Myc-CHIP HA- CA-MEK5α Flag-p9RSK VP6-ERK5 Fr (57-87) I: Myc I: HA I: Flag 7 5 Myc-CHIP + - + + + + + + + CA-MEK5α - + + + + + + + + Np9RSK WTp9RSK CHIP HA- CA-MEK5α Flag-N-p9RSK or WT-p9RSK CA-MEK5α - + + + + + + + + ERK5-CHIP binding (arbitraty units).5.5 WTp9RSK Fr VP6-ERK5 (57-87) ERK5-CHIP binding (arbitraty units)...8.6.4. Myc-CHIP + - + + + + + + + CA-MEK5α - + + + + + + + + Myc-CHIP + - + + + + + + + CA-MEK5α - + + + + + + + + Np9RSK WTp9RSK WTp9RSK VP6-ERK5 Fr (57-87) Online figure VII. p9rsk kinase activation inhibits ERK5-CHIP association. (A) oth wild type p9rsk (WT-p9RSK) and ERK5-Fr (aa57-87) disrupted ERK5-CHIP association. After plasmids were transfected as indicated, cell lysates will be immunoprecipitated with anti-erk5 and then immunoblotted with anti-chip. Protein expression was determined by immunoblotting with each specific antibody. () Relative ERK5-CHIP binding was quantified as described in Fig. (mean±s.., n=, (p<., p<.5 compared to both Myc-CHIP and CA-MEK5α transfected cells (the third black bar from left). Results are expressed as fold decrease in ERK5-CHIP binding in WT-p9RSK (grey bars) and ERK5-Fr (aa58-87) (white bars) transfected cells compared to the control cells (the third black bar from left). (C) WT-p9RSK but not N-p9RSK fully disrupted ERK5-CHIP interaction. ERK5-CHIP binding and each protein expression were detected as described in (A). () Relative ERK5-CHIP binding was quantified as described in Fig.. Results are expressed as fold decrease in ERK5-CHIP binding in cells over-expressing WT-p9RSK. p<., mean±s.., n=.

I: p-p9rsk p-p9rsk (Ser8) I: p9rsk p9rsk I: p-erk5 p-erk5 (T8/Y) I: ERK5 ERK5 I: p-erk / I: 7 5 p-erk / vehicle HO µm Ang II nm Online figure VIII. Ang II increased only p9rsk but not ERK5 kinase activity in cardiomyocyte. Cardiomyocytes were stimulated with Ang II ( nm) or HO ( µm) for 5 min. p- p9rsk, p9rsk, p-erk5, ERK5, p-erk/, and tubulin were detected by Western blotting using the total cell lysates with each specific antibody. Representative immunoblots from duplicate experiments are shown.

A ouble-tg (FV) WT (FV) MI M+MI WT (c57l) CKO (c57l) MI MI MI 5 Infarction size (%) 4 ou M +M bl ei Tg (F V )M W I T (c 57 L C )M KO I (c 57 L )M I (F V ) W T W T (F V )M I Online figure IX. Evaluation of infarction size at one week after MI surgery. (A) Representative pictures of LV tissue sections by Masson s trichrome staining. Infarct areas were described in black triangle between broken lines. 4X objective lens. Scale bars: µm. () Comparision of MI sizes. The sizes were not significantly changed in each groups. ata are shown as means ± S.. (n=). 9