IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

Similar documents
To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x

Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

NTM486-04, NTM174-04,

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

Supplemental Methods Cell lines and culture

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supporting Online Material for

Supplemental Information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism

0.9 5 H M L E R -C tr l in T w is t1 C M

A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Data Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway.

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR

Supplementary Figures

Supplemental Materials and Methods

Firefly luciferase mutants as sensors of proteome stress

Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila

Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

HCT116 SW48 Nutlin: p53

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Data Sheet HVEM/NF-κB Reporter Jurkat Recombinant Cell Line Catalog # 79310

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Isolation, culture, and transfection of primary mammary epithelial organoids

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138

SUPPLEMENTAL FIGURE LEGENDS

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method

Document S1. Supplemental Experimental Procedures and Three Figures (see next page)

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Nemo like kinase regulates the expression of vascular endothelial growth factor (VEGF) in alveolar epithelial cells

Proteasome activity is required for the initiation of precancerous pancreatic

For immunoprecipitation, cells were serum-starved for 2 hours and treated with

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Angeles Duran, Juan F. Linares, Anita S. Galvez, Kathryn Wikenheiser, Juana M. Flores, Maria T. Diaz-Meco, and Jorge Moscat

EGFR (Phospho-Ser695)

Supplementary Materials for

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536

Li et al., Supplemental Figures

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

PKA α/β CAT (Phospho-Thr197)

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Translation of HTT mrna with expanded CAG repeats is regulated by

Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546

Supplementary Material

Supplemental Materials and Methods

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde

Online Supplementary Information

RealTime-Glo MT Cell Viability Assay

SANTA CRUZ BIOTECHNOLOGY, INC.

VEGFR2 (Phospho-Tyr1175)

to 65 years old, including 5 males and 5 females. Patients did not receive any treatment 4

Plasmid DNA transfection of LN-229 human glioblastoma cells with the Biontex K2 Transfection System

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Division of Molecular Cardiology, Department of Medicine, College of Medicine,

The 30 colon carcinoma cell lines utilized were: Caco-2, Colo201, Colo205, Colo320, Dld-1,

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

MDA-MB-231 cells were grown in DMEM and T47Ds in RPMI, supplemented with 10% fetal bovine

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

detailed description. Cell proliferation and soft agar colony numbers were shown as relative values normalized to

Data Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice.

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

SUPPORTING ONLINE MATERIAL

Supplementary Figure S1

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Transcription:

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh Supplemental Figure : Targeting IKKβ and IKKα by RNA interference reduces NF-κB activity in KRAS positive lung cells. The indicated cells were initially transfected with nm sirna smartpools targeting KRAS (sikras), IKKα (siikkα), IKKβ (siikkβ), or nontargeting control (sictrl). At 8h posttransfection, the cells were transfected with g of an NF-κB-responsive firefly luciferase reporter vector (x-κb-luc) and 5 g of Renilla luciferase vector (prltk) and analyzed at 7h after the initial transfection for NF-κB luciferase reporter activity (upper panel) and for efficacy of sirna targeting by Western Blotting (bottom panel). LUC) negative control (cells transfected with pcdna instead of x-κb-luc and prl-tk); ) Relative luciferase units. Images shown are representative of three independent experiments and statistical significance was measured when appropriate by Student's t-test (p<.5) when compared to experimental control samples ( or sictrl). Error bars represent average ± s.d.

HCT6- HCT6- A B CpA-5 CpA- 5 h 5 h CpA-5 CpA- 5 h 5 h phosphop65 (S56) 6 p65 phospho-iκbα (S/6) IκBα p5 β-tubulin 8 6 -Luc +Luc C 5 D 5 HCT6- MTS Assay h h 8h 7h Colony number Total colony area (normalized x ) 5 5 5 5 5 HCT6-

Supplemental Figure : reduces growth of KRAS positive HCT6 colon cancer cells with knockout of p5. A) HCT6-p5 and HCT6-p5 cells were treated with.%, 5μM (CpA-5) or μm (CpA- ) for the indicated times. NF-κB activity was analyzed by Western Blotting. Antibodies used are indicated. B) HCT6-p5 and HCT6-p5 cells were transfected with ng of an NF-κB-responsive firefly luciferase reporter vector (x-κb-luc) and 5ng of Renilla luciferase vector (prl-tk) and dual luciferase reporter activity was analyzed after 6h. - LUC) negative control (cells transfected with pcdna instead of x-κb-luc and prl-tk); ) Relative luciferase units. C) HCT6-p5 and HCT6-p5 cells were treated with either.% or 5μM as indicated. Cell growth was measured at the indicated timepoints using a colorimetric MTS tetrazolium assay (CellTiter 96 Aqueous One Solution Cell Proliferation Assay from Promega, Madison, WI). D) HCT6- p5 and HCT6-p5 cells were plated for clonogenic assays as described in supplemental methods and treated with either.% or 5μM for days. Colonies formed were stained with crystal violet, counted and the total colony area was measured. Images shown are representative of three independent experiments and statistical significance was measured when appropriate by Student's t-test (p<.5) when compared to experimental control samples ( or sictrl). Error bars represent average ± s.d.

A H58 A59 H6 SALEB SAKRAS KPF5 6 5 KE67 B..8.6.. H58 sictrl sik-ras siikkβ siikkα...8.6.. sictrl A59 sik-ras siikkβ siikkα C.5.5 BCL.5.5 ciap..8. EF..8. MYC Supplemental Figure : Targeting IKKβ or IKKα does not trigger apoptosis of lung cancer cells. A) The indicated cell lines were treated with either.% or 5μM for 8h. Apoptosis was evaluated by measuring Caspase /7 activity in a luminescence-based assay (Caspase /7 Glo Assay, Promega, Madison, WI). Treatment with μg/ml rubicin () for 8h was used as a positive control. LUs) Light units. B) The indicated cell lines were transfected with the indicated sirnas and apoptosis was evaluated 7h after transfection by measuring Caspase /7 activity in a luminescence-based assay (Caspase /7 Glo Assay, Promega, Madison, WI). LUs) Light units. C) Expression of BCL, CIAP, EF and MYC was analyzed by real-time quantitative PCR in H58 cells 8h after sirna transfection. Statistical significance in all cases was measured by Student's t-test (p<.5) when compared to experimental control samples (). Error bars represent average ± s.d.

A F/8 µm µm Normalized number of F/8 positive cells 5 5 75 5 5 (n=7) (n=) B 5µm CD 5µm CD positive area (% total tumor area) 8 6 (n=5) (n=5) Supplemental Figure : Targeting IKKβ in the KRASGD/p5Δ conditional mouse model reduces lung tumor inflammation and angiogenesis in vivo. Immunohistochemistry for F/8 (A) and CD (B) (positive cells are brown). A representative picture of stained lung slides of -treated and placebotreated lungs is displayed on the left panels. The graphs on the right panels are quantitative representations of the data. Statistical significance in all cases was measured by Student's t-test (p<.5) when compared to experimental control samples (). Error bars represent average ± s.d.

SUPPLEMENTAL MATERIALS AND METHODS Cell culture. Cell passages were kept to a minimum and cells were not passaged continuously for more than six months. HCT6-p5 and HCT6-p5 knockout cells were a kind gift from Dr. Yanping Zhang. They were maintained in Dulbecco s Modified Eagle s Medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with % FBS (Sigma-Aldrich, St. Louis, MO). Clonogenic Assay. 5x HCT6-p5 and HCT6-p5 cells were plated in 6mm dishes and cultured for days. h after plating, the cells were treated with either.% (vehicle control) or 5μM. The supplemented media was replaced every other day. After days, the cells were fixed in icecold methanol for minutes and subsequently stained with.5% crystal violet for minutes. Quantitation of staining results was perfomed using ImageJ software. Caspase /7 Glo Apoptosis Assay. Apoptosis was evaluated using the Caspase /7 Glo Assay System (Promega, Madison, WI) following the manufacturer s instructions. Luminescent caspase activity was detected on an Lmax Microplate Luminometer (Molecular Devices, Sunnyvale, CA). RNA isolation and Real-time PCR analysis. Total RNA was prepared using TRIZOL reagent (Invitrogen, Carlsbad, CA) following the manufacturer s protocol and real-time PCR analysis was performed in an ABI 7 Sequence Detection System using TaqMan Gene Expression Assay primer-probe sets (all from Applied Biosystems/Life technologies, Grand Island, NY) for BCL (Hs68_m), CIAP (Hs59_m), EF (Hs55_m) and MYC (Hs58_m). Relative quantitation was determined by the ΔΔCt method using GUSB (Hs9999998_m) as the endogenous control. Immunohistochemistry: Formalin-fixed, paraffin-embedded tissue sections were stained with rat monoclonal anti-f/8 antibody (ab66, Abcam, Cambridge, MA) diluted : or with rabbit polyclonal anti-cd antibody (ab86, Abcam, Cambridge, MA) using the Rat or Rabbit Vector Elite ABC Kit (Vector Laboratories, Burlingame, CA), following the manufacturer s protocol. Quantitation of staining results was perfomed using ImageJ software to count positive cells (F/8) or measure positive area (CD).