Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Similar documents
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Online Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

GFP CCD2 GFP IP:GFP

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

Journal of Cell Science Supplementary Material

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

Bronchial epithelium and its associated tissues act as a

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

TE5 KYSE510 TE7 KYSE70 KYSE140

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de

Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues

Supplementary Information

SureSilencing sirna Array Technology Overview

Supporting Online Material for

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

SANTA CRUZ BIOTECHNOLOGY, INC.

AMP-activated protein kinase-α1 as an activating kinase of TGFβ-activated kinase 1 has a key role in inflammatory signals

Supplementary Figures

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

TOOLS sirna and mirna. User guide

Table S1. Primer sequences

SUPPLEMENTARY INFORMATION

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

HCT116 SW48 Nutlin: p53

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supporting Online Material for

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

pgbkt7 Anti- Myc AH109 strain (KDa) 50

1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45

CNBP acts as a key transcriptional regulator of sustained expression of interleukin-6

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Coleman et al., Supplementary Figure 1

Chicken EpithelialGut CellLines 1

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplementary Figure 1.

ENCODE RBP Antibody Characterization Guidelines

Supporting Information

466 Asn (N) to Ala (A) Generate beta dimer Interface

The MAP Kinase Family

Western-GUARANTEED Antibody Service FAQ

Hsp90 Regulates Activation of Interferon Regulatory Factor 3 and TBK-1 Stabilization in Sendai Virus-infected Cells

Jae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan M. Graff

The lineage-defining factors T-bet and Bcl-6 collaborate to regulate Th1 gene expression patterns

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

I B Kinase (IKK ) Regulation of IKK Kinase Activity

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

Hossain_Supplemental Figure 1

Product: Arrest-In TM Transfection Reagent for RNAi

Protocol for induction of expression and cell lysate production

Center Drive, University of Michigan Health System, Ann Arbor, MI

of signal transduction pathways?

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

from Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

Supporting Information

RIP1/RIP3 Binding to HSV-1 ICP6 Initiates Necroptosis to Restrict Virus Propagation in Mice

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

Dual Mechanisms for the Inhibition of E2F Binding to RB by Cyclin-Dependent Kinase-Mediated RB Phosphorylation

Localization of the Major NF- B-activating Site and the Sole TRAF3 Binding Site of LMP-1 Defines Two Distinct Signaling Motifs*

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

This Document Contains:

Transcription:

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated with PMA/Ionomycin (P/I) for 16h (a) or transfected together with RIG-I-2CARD (b) and cell lysates were then used for dual-luciferase assay. Data (mean and s.e.m.) are representative of at least three independent experiments. 1

2

Supplementary Figure 2. The N-terminal of TRIM9 is critical for the NF- B inhibition. (a) Schematic diagram of TRIM9 mutants and summary of their NF- B inhibition ability. (b, c) HEK293T cells were transfected with NF- B reporter, TK-Renilla reporter and TRIM9 WT or its mutant for 24h, followed by treatment with PMA/Ionomycin, TNF- or IL-1 for 16h (b) or together with TRAF6, IKK or TBK1 (c). Cell lysates were used for dual-luciferase assay (d, e) HEK293T cells were transfected with NF- B reporter, TK-Renilla reporter and TRIM9 WT or its CA (C30A C33A) mutant for 24h, followed by treatment with PMA/Ionomycin, TNF- or IL-1 for 16h (d) or together with RIG-I (2 CARD), TRAF6, TBK1, IKK or IKK (e). Cell lysates were used for dual-luciferase assay. Data (mean and s.e.m.) are representative of at least three independent experiments. 3

Supplementary Figure 3. The C-terminal 7 WD40 motifs of TrCP are required for TRIM9 binding. (a) At 48h posttransfection with Flag- -TrCP together with HA-TRIM9 WT or its mutants, HEK293T cells were used for IP and IB with the indicated antibodies. (b) Schematic diagram of the GST- -TrCP WD40 (1-7) repeats and deletion mutants. (c) At 48h posttransfection with mammalian GST-TrCP C-terminal fusion construct and HA-TRIM9, HEK293T cell lysates were subjected to GST-Pull-down (PD) and IB analysis. The data are representative of three independent experiments. 4

Supplementary Figure 4. Both SA, and SD mutant fail to bind -TrCP and to inhibit NF- B activity. (a) HEK293T cells were transfected with NF- B reporter, TK-Renilla reporter and TRIM9 WT SA or SD mutant for 24h, followed by stimulation with mock, IL-1 or TNF-. Cell lysates were used for dual-luciferase assay. (b) At 48h post transfection with Flag- -TrCP and HA-TRIM9 WT, SA or SD mutant, HEK293T cell lysates were subjected to IP and IB analysis. Data (mean and s.e.m.) are representative of at least three independent experiments. 5

Supplementary Figure 5. I B does not complete with TRIM9 for -TrCP binding. At 48h post transfection with Flag- -TrCP and V5-TRIM9 and increasing amounts of I B (0-1.6 g), HEK293T cell lysates were used for IP with anti- -TrCP, followed by IB with anti-i B, anti- - TrCP or anti-v5 antibody. The data are representative of three independent experiments. 6

Supplementary Figure 6. TRIM9 suppresses I B degradation and p65 phosphorylation. (a) At 24 h posttransfection with TRIM9 or its SA mutant, HEK293T cells were stimulated with TNF- for indicated times (min) and cell lysates were used for IB with the indicated antibodies. (b and c) A549 cells carrying lentivirus containing scrambled shrna (SC) or TRIM9-specific shrna (KD) were stimulated with TNF- or IL-1 for indicated times and cell lysates were then used for IB with the indicated antibodies. The data are representative of three independent experiments. 7

Supplementary Figure 7. TRIM9 inhibited IL-6 production in SK-N-AS cells. (a,b) SK-N- AS cells stably expressing vector, TRIM9 wt or SA mutant (a) or carrying lentivirus containing scrambled shrna (SC) or TRIM9-specific shrna (KD) (b) were stimulated with PBS or IL-1 for 16 hrs and their supernatants were used for IL-6 ELISA. TRIM9 expressions were analyzed by IB (lower panel). The mean±s.d. is shown: *p<0.05. The data are representative of three independent experiments. 8

Supplementary Figure 8. Q-PCR analysis for NOS1 mrna levels of primary neuron cells. At 48h post infection with scramble (SC) lentivirus or TRIM9-specific shrna lentivirus, primary rat neuron cells were stimulated with TNF- for 2h, followed by Q-PCR analysis for NOS1 mrna levels. The mean±s.d. is shown: *p<0.05, The data are representative of three independent experiments.. 9

Supplementary Figure 9. Full scan image of the Western blots used in the manuscript for Fig 2. 10

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Fig 3 and Fig 4a. 11

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Fig 4b, c and e. 12

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Fig 4d and Fig 5c. 13

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Fig 5b and Fig 6. 14

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Supplementary Fig 3b, 4 and 5. 15

Supplementary Figure 9 (Continued). Full scan image of the Western blots used in the manuscript for Supplementary Fig 6 and 7. 16