Improvement of Transformation Efficiency Through In Vitro Methylation and SacII Site Mutation of Plasmid Vector in Bifidobacterium longum MG1

Transcription

1 J. Microbiol. Biotechnol. (2010), 20(6), doi: /jmb First published online 19 April 2010 Improvement of Transformation Efficiency Through In Vitro Methylation and SacII Site Mutation of Plasmid Vector in Bifidobacterium longum MG1 Kim, Jin Yong 1, Yan Wang 1, Myeong Soo Park 2, and Geun Eog Ji 1,3 * 1 Department of Food and Nutrition, Research Institute of Human Ecology, Seoul National University, Seoul , Korea 2 Department of Hotel Culinary Arts, Anyang Technical College, Anyang , Korea 3 Research Institute, Bifido Inc., Seoul , Korea Received: March 8, 2010 / Revised: March 25, 2010 / Accepted: April 10, 2010 The different cleavage patterns of pybamy59 plasmid isolated from E. coli DH5α and B. longum MG1 by the cell extract of B. longum MG1 suggested that the main reason for its low transformation efficiency was related to the restriction modification (R-M) system. To confirm the correlation between the R-M system and transformation efficiency, in vitro methylation and site-directed mutagenesis were performed in pybamy59. Sequence analysis of pybamy59 fragments digested by the cell extract of B. longum MG1 revealed that all fragments were generated by restriction of the sequence recognized by SacII endonuclease. When pybamy59 from E. coli was methylated in vitro by CpG or GpC methyltransferase, it was protected from SacII digestion. Site-directed mutagenesis, which removed SacII sites from pybamy59, or in vitro methylation of pybamy59 showed 8- to 15-fold increases in the transformation efficiency over intact pybamy59. Modification of the SacII-related R-M system in B. longum MG1 and in vitro methylation in pybamy 59 can improve the transformation efficiency in this strain. The results showed that the R-M system is a factor to limit introduction of exogenous DNA, and in vitro modification is a convenient method to overcome the barrier of the R-M system for transformation. Keywords: Bifidobacterium, transformation efficiency, methylation, mutagenesis, SacII Bifidobacterium is a Gram-positive strict anaerobe, which has been reported to exert various beneficial effects for the human hosts [7, 11, 12]. Recently, the determination of the full genome sequences of several Bifidobacterium sp. gave *Corresponding author Phone: ; Fax: ; geji@snu.ac.kr an insight into the relationship between human health and the probiotic ability of Bifidobacterium at the whole genome level [2, 13, 24, 25]. Accordingly, there have been several reports on the development of vector systems for Bifidobacterium to improve the beneficial traits of this bacterium through genetic engineering. However, in these approaches, low transformation efficiency has been the main obstacle. Until now, many attempts and studies have been performed to improve the transformation efficiency in Bifidobacterium. However, inconsistent results have been reported depending on the experimental species and conditions [1, 15-18, 20, 23]. The restriction modification (R-M) system is widespread in bacteria, to discriminate between endogenous and exogenous DNA and to protect its own DNA from invading foreign genetic material such as virus DNA or RNA. The intractability of introducing foreign DNA into bacteria was influenced not only by experimental physical conditions but also by R-M systems [4, 6, 14, 27]. In our preliminary transformation experiment using B. longum MG1 as a host, we observed that plasmids with the same primary DNA sequences showed different restriction patterns according to the origin of plasmid DNA; that is, plasmid from B. longum MG1 was not digested, but that from E. coli DH5α was digested by the cell extract of B. longum MG1. We hypothesized that one of the reasons for the low transformation efficiency in B. longum MG1 was due to its R-M system. Consequently, methylation or sitespecific removal of restriction sites was warranted to avoid the R-M system. In this study, pybamy59 [22], a shuttle vector between E. coli and B. longum MG1 expressing the amylase gene from B. adolescentis INT-57, was used as a model plasmid to elucidate the novel restriction enzyme in this strain. Then, we applied site-directed mutagenesis or in vitro methylation to remove or modify novel restriction enzyme sites of pybamy59 and to compare the transformation efficiency between modified and original plasmids.

2 TRANSFORMATION EFFICIENCY OF B. LONGUM MG MATERIALS AND METHODS Bacterial Strains, Plasmids, and Culture Conditions E. coli DH5α was propagated in Luria-Bertani medium (BD, MD, U.S.A.), and 50 µg/ml of ampicillin (Sigma, St. Louis, MO, U.S.A.) was supplemented, if necessary. B. longum MG1 [21] harboring pmg1 was grown anaerobically in MRS medium (BD, MD, U.S.A.) containing 0.05% L-cysteine HCl (Sigma, St. Louis, MO, U.S.A.). B. longum MG1 harboring pybamy59 was cultivated in MRS medium containing 3.6 µg/ml chloramphenicol (BioBasic, Canada) for cell propagation. Characteristics of each bacterial strain and plasmid are described in Table 1. Digestion of pybamy59 from E. coli DH5α and B. longum MG1 Using Cell Extract of B. longum MG1 E. coli DH5α and B. longum MG1 harboring pybamy59 were propagated as described above, and pybamy59 (E) and pybamy59 (B) were prepared using an Axyprep Midi Kit (Axygen Biosciences, CA, U.S.A.) and plasmid mini prep kit (QIAGEN Korea Ltd., Korea). Plasmid DNA was concentrated by using a PCR purification kit (QIAGEN Korea Ltd., Korea), plasmid mini prep kit, or Amicon (Millipore, MA, U.S.A.), if necessary. Cell extract of B. longum MG1 was prepared as follows. The cultured B. longum MG1 cells (8 ml) were harvested, washed once with PBS buffer (ph 7.3), and resuspended with the same buffer, and then sonicated in ice-cold water for 30 min. After centrifuging at 1,200 g for 20 min at 4 o C, the supernatant was collected as cell extract. The fructose-6- phosphate phosphoketolase (F6PPK) test was carried out to confirm if the cell was properly disrupted. The 70-µl cell extract was mixed with 7 µg of prepared plasmid and incubated overnight at 37 o C. The reaction mixture was analyzed in 1% agarose gel. Determination of Sequences of Terminal Ends of Digested Fragments Each fragment of pybamy59 (E) digested by the cell extract of B. longum MG1 was purified using a gel extraction kit (QIAGEN Korea Ltd., Korea) and concentrated with Amicon. The sequences of the terminal ends of the purified fragments were analyzed using the Applied Biosystems 3730 DNA Analyzer in the Genome Research Facility in Seoul National University, with synthesized primers (Table 1, primers 1-6) and also sequenced using the blunt cloning method in Macrogen (Seoul, Korea). Site-Directed Mutagenesis and In Vitro Methylation To remove identified restriction enzyme sites in pybamy59 (E), the mutagenesis experiment was carried out as described in the instruction manual of the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, CA, U.S.A.) with 3 kinds of primer pairs (SacII- 1742, 3975, and 6176; Table 1). In SacII-6176, primer pairs were designed not to change amino acid residue in the flanking amylase gene. The mutated sites in pybamy59 were confirmed by sequencing analysis and restriction patterns of SacII, XbaI-BamHI, and cell extract of B. longum MG1. Amylase activity in E. coli DH5α was tested in LB containing 1% starch. CpG methyltransferase (M.SssI) and GpC methyltransferase (M.CviPI; NEB, MA, U.S.A.) were used to methylate pybamy59 (E) according to the instruction manual with some modification. Briefly, 200 µl of methylation reaction mixture including µg of plasmid DNA was prepared and 2 µl of 32 mm S-adenosylmethionine was added to the reaction mixture twice at every 3-4 h, and then incubated overnight at 37 o C. After methylation, the treated plasmid was purified with a gel extraction kit (Nucleogen, Korea) for further transformation experiment. DNA concentration was measured by Table 1. Bacterial strains, plasmids, and primers used in this study. Strains, plasmids, and primers Relevant characteristics and sequences Bacterial strains B. longum MG1 Lab stock, Transformation host B. longum MG1(pYBamy59) Lab stock, B. longum MG1 harboring pybamy59 E. coli DH5α (pybamy59) Lab stock, E. coli DH5α harboring pybamy59 E. coli DH5α (pybamy59(sacii - )) Lab stock, E. coli DH5α harboring pybamy59 (SacII - ) Plasmids pybamy59 Bifidobacterium-E. coli shuttle vector carrying amylase gene from B. adolescentis INT-57 pybamy59 (B) pybamy59 isolated from B. longum MG1 pybamy59 (E) pybamy59 isolated from E. coli DH5α Primers SacII-1742 sense 5'CACGGCCGCGATCCGTGGAAAACTCATGGAC3' SacII-1742 anti-sense 5'GTCCATGAGTTTTCCACGGATCGCGGCCGTG3' SacII-3975 sense 5'CTCGAAGCCCGCGACCGACTCGGCCATC3' SacII-3975 anti-sense 5'GATGGCCGAGTCGGTCGCGGGCTTCGAG3' SacII-6176 sense 5'CATCACCGCCGCCGCGACCGCCTTC3' SacII-6176 anti-sense 5'GAAGGCGGTCGCGGCGGCGGTGATG3' Primer1 5'CGAACTCGGACGGATATTCGA3' Primer2 5' CCTGCTCGGCGTTCCGCAGCA3' Primer3 5'CATCGCTGGTTCTGACGTTGT3' Primer4 5' ATTCCAATACAAAACCACATA3' Primer5 5'CAGCATACGTTCGCAATAGTG3' Primer6 5'TCCCATGCATGCAGGGTGGCG3'

3 1024 Kim et al. Fig. 1. Restriction patterns of various pybamy59 (B, E, SacII-, and methylated) digested with the cell extract of B. longum MG1, SacII, and XbaI-BamHI. (A) Lane 2, intact pybamy59 (E); lanes 3-5, pybamy59 (E) digested with MG1 cell extract, SacII, and XbaI-BamHI, respectively.; lane 6, intact pybamy59 (SacII-); lanes 7-9, pybamy59 (SacII ) digested with MG1 cell extract, SacII, and XbaI-BamHI, respectively. (B) Lane 2, intact pybamy59 (B); lanes 3-4, pybamy59 (B) digested with XbaI-BamHI and MG1 cell extract, respectively. (C) Lanes 2-4, SacII-digested restriction patterns of pybamy59 (SacII-), pbamy59 (E), and pybamy59 (B), respectively. (D) Lane 2-3, SacII-digested restriction patterns of pybamy59 (E) after methylation with CpG or GpC methyltransferase; lanes 4-5, SacII-digested restriction patterns of pybamy59 (SacII-) after methylation with CpG or GpC methyltransferase. Lane 1 in each gel is 1-kb DNA ladder. - using a Quant-iT dsdna Assay Kit (Invitrogen, Molecular Probes, Inc. U.S.A.). To confirm successful methylation, the DNA was digested with SacII enzyme. Transformation Procedure Transformation of E. coli DH5α was performed using the CaCl2 method. For B. longum MG1, it was inoculated in MRS broth supplemented with 0.2 M sucrose and 0.05% L-cysteine HCl and incubated anaerobically at 37oC for 24 h. After transferring once, 2 ml of the culture broth was inoculated in 50 ml of MRS broth supplemented with 0.2 M sucrose and 0.05% L-cysteine HCl and grown anaerobically at 37oC until OD600 reached The cells were harvested by centrifuging at 9,800 g for 10 min at 4oC and washed twice with 0.5 M sucrose and 1 mm ammonium citrate buffer (ph 5.0) and resuspended in 250 µl of the same buffer. Methylated or mutated DNAs were mixed with prepared competent cells and transformed using a Gene Pulser II Electroporation System (BIO-RAD, U.S.A.) set at 2.5 kv, 25 µf, and 200 Ω. After electroporation, the cells were spread on MRS agar supplemented with 0.05% L-cysteine HCl and 1% (w/v) soluble starch and incubated for 5-6 days in anaerobic condition. To verify correct colonies on MRS agar plates, iodine solution was sprayed and clearzone-forming colonies were counted. apparent that SacII recognition was one of the potential RM systems in B. longum MG1. The restriction digestion patterns of pybamy 59 (E) and pybamy 59 (B) with SacII supported this presumption (Fig. 1C, lanes 3 and 4). The additional two upper fragments (Fig. 1A, fragments 4 and 5) appearing in restriction fragments of pybamy59 (E) by the cell extracts compared with SacII (Fig. 1A, lane 4, 2 fragments) patterns might be due to partial digestion under non-optimal condition or size similarity (2.2 kb) of 2 fragments when pybamy59 (E) was restricted with SacII (Fig. 2). In order to test whether removal of SacII recognition sites from pybamy59 (E) influenced the transformation efficiency, site-directed mutagenesis was performed. Through mutagenesis, all three SacII sites were mutated, as shown in Fig. 3, and named as pybamy59 (SacII-). The pybamy59 RESULTS Digestion of pybamy59 (E) with cell extract of B. longum MG1 produced 5 fragments (Fig. 1A, lane 3), whereas pybamy59 (B) was kept intact during digestion (Fig. 1B, lane 4) although the two plasmids had the same primary sequences. The terminal sequence analysis of all of the bottom three fragments (Fig. 1A, lane 3, 1-3) corresponded to SacII recognition sites (5'-CCGCGG-3'). Thus, it was Fig. 2. Schematic diagram of pybamy59. Fragment 1 ( , 2.2 kb); Fragment 2 ( , 4.4 kb); Fragment 3 ( , 5.6 kb).

4 TRANSFORMATION EFFICIENCY OF B. LONGUM MG pybamy59 (E) (Table 2). However, in vitro methylation of pybamy59 (SacII - ) did not show improved transformation compared with pybamy59 (SacII - ). DISCUSSION Fig. 3. Sequence analysis of pybamy59 (SacII - ) in comparison with original pybamy59. The mutated SacII recognition sequences are indicated in the squares under the original sequences. The start codon of the amylase gene is also indicated. (SacII - ) was confirmed to be free of three SacII sites by sequence analysis (Fig. 3) using synthesized primers (Table 1, primers 1, 3, and 5). After mutagenesis, pybamy59 (SacII - ) was not digested by either cell extracts of B. longum MG1 or SacII enzyme, as expected (Fig. 1A, lanes 7 and 8). In addition to the removal of SacII sites, CpG and GpC methyltransferase were treated to pybamy59 (E) to evaluate the effect of in vitro methylation on the R-M response and transformation efficiency. We treated CpG or GpC methyltransferase to pybamy59 (E) and pybamy59 (SacII - ) because these methyltransferases were known to methylate not only SacII sites but also GC or CG sequences, which might be susceptible to an unknown R- M system in G+C rich B. longum MG1. After in vitro methylation, pybamy59 (E) was confirmed to be protected from SacII digestion (Fig. 1D). The result of the transformation experiment showed that in vitro methylation of pybamy59 (E) or elimination of SacII sites from pybamy59 (E) improved its transformability at least 8- to 15-folds over Table 2. Transformation efficiency of B. longum MG1. DNA samples used in transformation CFU/µg DNA pybamy59 (E) 5 10 pybamy59 (E) treated with CpG methyltransferase pybamy59 (E) treated with GpC methyltransferase pybamy59 (SacII - ) pybamy59 (SacII - ) and treated with CpG methyltransferase pybamy59 (SacII - ) and treated with GpC methyltransferase Recently, Yasui et al. [27] reported that the transformation efficiency of the plasmid was improved by modification enzymes [BAD_1233 (M.Sau3AI homolog) and BAD_1283 (M.Kpn2kI, homolog)] from B. adolescentis ATCC O Connell Motherway et al. [19] also showed that the R-M system was related to the transformation efficiency in B. breve UCC2003. In other bacteria, the transformation efficiency was differently affected by DNA modification depending on the type of methylation, such as DNA cytosine methylase (dcm), DNA adenine methylase (dam), and CpG methylase [3-6, 14]. Ever since restriction endonuclease (Bbel) was described in Bifidobacterium in the 1980s [10], several strain-specific restriction endonucleases have been reported [8, 9, 26] and recent analysis of full genome sequences showed that diverse genes related with an R-M system exist in Bifidobacterium (REBASE Web site). In this study, the terminal sequence of 3 fragments derived from pybamy59 (E) digested with cell extract of B. longum MG1 showed recognition sequence of SacII, whose isoschizomer has not been reported in Bifidobacterium. We could not find its isoschizomer in the REBASE either. In this study, the transformation efficiency of B. longum MG1 was improved through the removal of SacII recognition sequences, suggesting that the SacII recognition site was susceptible to the host R-M system and acted as a limiting factor of foreign DNA introduction into B. longum MG1. The critical effect of SacII recognition was further supported by the lack of improvement in transformation efficiency by in vitro methylation of pybamy59 (SacII - ) compared with pybamy59 (SacII - ). The relatively low transformation efficiency of pybamy59 even after mehylayion and SacII removal suggested that there might be other R-M systems not characterized in this study. Thus, further study using various other modification enzymes needs to be pursued. Our study showed that the methodological approach such as in vitro methylation and removal of restriction sites improves transformation efficiency in Bifidobacterium. If these are applicable to diverse Bifidobacterium, then the basic genetic research in Bifidobacterium and development of Bifidobacterium strains with enhanced beneficial gene products would be facilitated. Acknowledgment This research was supported by a grant (MG ) from the Microbial Genomics and Application Center of

5 1026 Kim et al. the 21st Century Frontier Research Program funded by the Ministry of Education, Science and Technology of the Republic of Korea. REFERENCES 1. Argnani, A., R. J. Leer, N. van Luijk, and P. H. Pouwels A convenient and reproducible method to genetically transform bacteria of the genus Bifidobacterium. Microbiology 142 (Pt 1): Barrangou, R., E. P. Briczinski, L. L. Traeger, J. R. Loquasto, M. Richards, P. Horvath, et al Comparison of the complete genome sequences of Bifidobacterium animalis subsp. lactis DSM and Bl-04. J. Bacteriol. 191: Chen, Q., J. R. Fischer, V. M. Benoit, N. P. Dufour, P. Youderian, and J. M. Leong In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56. J. Bacteriol. 190: Groot, M. N., F. Nieboer, and T. Abee Enhanced transformation efficiency of recalcitrant Bacillus cereus and Bacillus weihenstephanensis isolates upon in vitro methylation of plasmid DNA. Appl. Environ. Microbiol. 74: Hayashi, M., Y. Maeda, Y. Hashimoto, and Y. Murooka Efficient transformation of Mesorhizobium huakuii subsp. rengei and Rhizobium species. J. Biosci. Bioeng. 89: Hobson, N., N. L. Price, J. D. Ward, and T. L. Raivio Generation of a restriction minus enteropathogenic Escherichia coli E2348/69 strain that is efficiently transformed with large, low copy plasmids. BMC Microbiol. 8: Kantha, D. Arunachalam Role of Bifidobacterium in nutrition, medicine and technology. Nutr. Res. 19: Khosaka, T. and M. Kiwaki BinI: A new site-specific endonuclease from Bifidobacterium infantis. Gene 31: Khosaka, T., M. Kiwaki, and B. Rak Two site-specific endonucleases BinSI and BinSII from Bifidobacterium infantis. FEBS Lett. 163: Khosaka, T., T. Sakurai, H. Takahashi, and H. Saito A new site-specific endonuclease BbeI from Bifidobacterium breve. Gene 17: Kim, H., K. Kwack, D. Y. Kim, and G. E. Ji Oral probiotic bacterial administration suppressed allergic responses in an ovalbumin-induced allergy mouse model. FEMS Immunol. Med. Microbiol. 45: Kim, H., S. Y. Lee, and G. E. Ji Timing of bifidobacterium administration influences the development of allergy to ovalbumin in mice. Biotechnol. Lett. 27: Kim, J. F., H. Jeong, D. S. Yu, S. H. Choi, C. G. Hur, M. S. Park, et al Genome sequence of the probiotic bacterium Bifidobacterium animalis subsp. lactis AD011. J. Bacteriol. 191: Kwak, J., H. Jiang, and K. E. Kendrick Transformation using in vivo and in vitro methylation in Streptomyces griseus. FEMS Microbiol. Lett. 209: Lee, J. H. and D. J. O Sullivan Sequence analysis of two cryptic plasmids from Bifidobacterium longum DJO10A and construction of a shuttle cloning vector. Appl. Environ. Microbiol. 72: Matsumura, H., A. Takeuchi, and Y. Kano Construction of Escherichia coli-bifidobacterium longum shuttle vector transforming B. longum 105-A and 108-A. Biosci. Biotechnol. Biochem. 61: Matteuzzi, D., P. Brigidi, M. Rossi, and D. Di Characterization and molecular cloning of Bifidobacterium longum cryptic plasmid pmb1. Lett. Appl. Microbiol. 11: Missich, R., B. Sgorbati, and D. J. LeBlanc Transformation of Bifidobacterium longum with prm2, a constructed Escherichia coli-b. longum shuttle vector. Plasmid 32: O Connell Motherway, M., J. O Driscoll, G. F. Fitzgerald, and D. van Sinderen Overcoming the restriction barrier to plasmid transformation and targeted mutagenesis in Bifidobacterium breve UCC2003. Microbial Biotechnol. 2: Park, M. S., K. H. Lee, and G. E. Ji Isolation and characterization of two plasmids from Bifidobacterium longum. Lett. Appl. Microbiol. 25: Park, M. S., H. W. Moon, and G. E. Ji Molecular characterization of plasmid from Bifidobacterium longum. J. Microbiol. Biotechnol. 13: Rhim, S. L., M. S. Park, and G. E. Ji Expression and secretion of Bifidobacterium adolescentis amylase by Bifidobacterium longum. Biotechnol. Lett. 28: Rossi, M., P. Brigidi, A. Gonzalez Vara y Rodriguez, and D. Matteuzzi Characterization of the plasmid pmb1 from Bifidobacterium longum and its use for shuttle vector construction. Res. Microbiol. 147: Schell, M. A., M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, et al The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc. Natl. Acad. Sci. U.S.A. 99: Sela, D. A., J. Chapman, A. Adeuya, J. H. Kim, F. Chen, T. R. Whitehead, et al The genome sequence of Bifidobacterium longum subsp. infantis reveals adaptations for milk utilization within the infant microbiome. Proc. Natl. Acad. Sci. U.S.A. 105: Skrypina, N. A., V. M. Kramarov, A. M. Liannaia, and V. V. Smolianinov [Restriction endonucleases from bifidobacteria]. Mol. Gen. Mikrobiol. Virusol: Yasui, K., Y. Kano, K. Tanaka, K. Watanabe, M. Shimizu- Kadota, H. Yoshikawa, and T. Suzuki Improvement of bacterial transformation efficiency using plasmid artificial modification. Nucleic Acids Res. 37: e3.