Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity

Transcription

1 Student Worksheet Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity LSM In 1977, Frederick Sanger developed a method by which the nucleotide sequence of a DNA fragment could be determined. In this activity, you will simulate the Sanger dideoxy method of sequencing using a given nucleotide sequence. Background The dideoxy method is based on the process of DNA replication. During DNA replication, DNA polymerase builds a complementary strand one nucleotide at a time, by adding the appropriate complementary nucleotides onto the elongating strand. Nucleotides are incorporated into the elongating strand via a condensation reaction between the incoming nucleotide and the hydroxyl group on the 3 carbon present on the previous nucleotide. Therefore, DNA replication proceeds in the 5 to 3 direction. If dideoxynucleotide triphosphates (ddntps) are incorporated into the complementary elongating strand, DNA replication terminates. A dideoxynucleotide triphosphate lacks the hydroxyl group on its 3 carbon; therefore DNA polymerase cannot add the adjacent nucleotide via a condensation reaction. In the laboratory, the nucleotide sequence to be determined is treated so that it is single-stranded and therefore can act as a template. A short, radioactively labelled primer is added to the end of the DNA template. The single-stranded DNA is divided into four aliquots and placed into four reaction tubes. In addition to the DNA template to be sequenced, the reaction tubes each contain the following: DNA polymerase, all four dntps (datp, dttp, dgtp, and dctp), one of which is radioactively labelled (usually datp), and one dideoxynucleotide triphospate per tube. For example, the G tube would contain dttp, dgtp, dctp, radioactively labelled datp, and dideoxy dgtp in addition to DNA polymerase. (Please refer to pages 301 and 302 in the Nelson Biology 12 Student Text for more details). The ratio of the dideoxynucleotide to the deoxynucleotide in each tube is one to one hundred, so that, for every 100 nucleotides based-paired to the nucleotide in question in the template, a dideoxynucleotide is base-paired only once. For example, in tube T, each time an adenine nucleotide is encountered in the sequencing reaction, a deoxythymine is added 99 out of 100 times. One out of 100 times a dideoxythymine is added results in the termination of strand elongation. The final result is that the reaction in the tube will result in a collection of DNA strands of differing lengths, which reflect the position of the adenine nucleotide in the template strand in question. When the reactions are complete in all four tubes (A, G, T, and C), formamide is added to denature the DNA template from the newly synthesized strands. The contents of each tube are loaded into a separate lane of a polyacrylamide gel that is fine enough to resolve DNA fragments that differ by a single nucleotide. After electrophoresis, the gel is exposed to X-ray film and an autoradiogram is made. The bands correspond to the lengths of fragments in each reaction tube. The sequence is read from the bottom of the gel to the top and is complementary to the sequence found on the original template strand. Materials paper and coloured pencils photocopy of polyacrylamide gel template 176 Chapter 6 Biotechnology Copyright 2003 Nelson

2 LSM Procedure 1. Title four pieces of paper as follows: Tube A, Tube C, Tube G, and Tube T. Remember that the title indicates which respective dideoxynucleotide each tube contains. 2. Copy the following sequence onto each of the papers: 5 GACATTGCCATAGACATTAGC 3 This represents the single-stranded DNA fragment that is to be sequenced. 3. Write out the five-nucleotide primer for the template strand on each of the four sheets in coloured pencil. Remember to take into consideration the 5 and 3 end of the template strand. The primer should be complementary to the appropriate end in order for strand elongation to take place. 4. For each tube, synthesize the complementary strand and terminate with a dideoxynucleotide each time a nucleotide is reached that is complementary to that reaction tube ddntp. Use a different coloured pencil than that used for the primer. 5. Count the number of nucleotides in each fragment that was synthesized. 6. On the polyacrylamide gel worksheet (page 178), draw in the fragments according to size in four lanes corresponding to the four reactions. 7. Have a partner read the sequence of nucleotides from the bottom of the gel up for accuracy. The sequence that is read is the complement to the DNA that was sequenced. The complement to that sequence can be written out and compared to the original sequence for accuracy. Analysis and Synthesis (a) Why is it important that a primer be included in each of the reaction tubes? (b) Why is it important that one of the dntps is radioactively labelled? (c) The simulation activity did not completely represent the process of the Sanger-dideoxy method. What parts of the method are missing from this simulation? (d) Predict what may occur and why to the sequencing process if the concentration of ddntps is higher than 1% or lower than 1%. (e) Why is it important to know at least part of the sequence for a given DNA fragment in order for it to be fully synthesized? Copyright 2003 Nelson Chapter 6 Biotechnology 177

3 LSM Ladder (nucleotides) A T C G Chapter 6 Biotechnology Copyright 2003 Nelson

4 Student Worksheet Solutions Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity, Solution LSM Tube T 3 -TAATCG-5 (6) 3 -TGTAATCG-5 (8) 3 -TCTGTAATCG-5 (10) 3 -TATCTGTAATCG-5 (12) 3 -TAACGGTATCTGTAATCG-5 (18) 3 -TGTAACGGTATCTGTAATCG-5 (20) Tube A 3 -ATCTGTAATCG-5 (11) 3 -ACGGTATCTGTAATCG-5 (16) 3 -AACGGTATCTGTAATCG-5 (17) Tube C 3 -CTGTAATCG-5 (9) 3 -CGGTATCTGTAATCG-5 (15) 3 -CTGTAACGGTATCTGTAATCG-5 (21) Copyright 2003 Nelson Chapter 6 Biotechnology 179

5 LSM Ladder (nucleotides) 20 A T C G Tube G 3 -GTAATCG-5 (7) 3 -GTATCTGTAATCG-5 (13) GGTATCTGTAATCG-5 (14) 3 -GTAACGGTATCTGTAATCG-5 (19) 10 Analysis and Synthesis 5 (a) A primer is required in each reaction tube because it provides the initial 3 OH group that DNA polymerase requires in order to elongate a growing DNA chain. If no primer were present, DNA replication would not occur. (b) In order to read the sequence from a gel, an autoradiogram of the gel is made. If one of the dntps is radioactively labelled, it will appear throughout the different fragments that are produced. When the gel is placed against X-ray film, the radioactivity will burn into the film and reveal the position of each of the bands. The researcher can then read the DNA sequence from the autoradiogram. (c) The part of the Sanger-dideoxy method that is not represented in this simulation is the production of the autoradiogram. (d) If the concentration of ddntps is higher than 1%, many of the longer fragments may not be produced. This happens because there is a higher probability of a ddntp being placed in a sequence instead of a regular dntp, with the result that chain termination occurs more often. If the concentration of ddntps is higher than 1%, then the opposite will occur; larger fragments will predominate and smaller ones may not be produced, since the chances of chain termination occurring are lower. (e) It is important to know part of the sequence in order to synthesize a primer. 180 Chapter 6 Biotechnology Copyright 2003 Nelson