Applications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing

Transcription

1 Applications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing Stephen Turner November 5, 2014 FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences in the United States and/or other countries. Covaris is a trademark of Covaris, Inc.; g-tube is a trademark of Bio Plas, Inc.; Caliper and Sciclone are trademarks of Caliper Life Sciences, Inc.; Agilent is a trademark of Agilent Technologies, Inc.; 454 is a trademark of Roche Diagnostics; and Illumina and Moleculo are trademarks of Illumina, Inc. Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved.

2 Single-Molecule, Real-Time DNA Sequencing Is: DNA Polymerase

3 Let The Polymerases Sequence Without Stopping!

4 The Zero-Mode Waveguide Enables Single-Molecule Detection Observation Volume Confinement ~20 x liters PACIFIC BIOSCIENCES CONFIDENTIAL Science, Vol 299, Jan , pp , J. Appl. Phys. 103, (2008)

5 We Attach The Fluorophore To The Terminal Phosphate Instead 5

6 The System In Operation

7 The PacBio RS II PACIFIC BIOSCIENCES CONFIDENTIAL

8 Under the Covers PACIFIC BIOSCIENCES CONFIDENTIAL

9 Example Sequencing Run

10 >100 bases / minute

11 Sample Preparation FIND MEANING IN COMPLEXITY 11 Copyright 2013 by Pacific Biosciences of California, Inc. All rights reserved.

12 SMRTbell Sample Preparation Genomic Fragment Universal Adapters 12

13 SMRTbell Sample Preparation Ligation 13

14 SMRTbell Sample Preparation Primer 14

15 SMRTbell Sample Preparation Primer Polymerase 15

16 SMRTbell Sample Preparation 16

17 Performance Attributes FIND MEANING IN COMPLEXITY 17 Copyright 2013 by Pacific Biosciences of California, Inc. All rights reserved.

18 Average Read Length (bp) PacBio Reads: NEW! P6-C4 Chemistry Average read length: 10,000-15,000 bp Throughput / SMRT Cell: 500 Mb 1 Gb Consensus accuracy: P6 C P5 C P4 C Early PacBio chemistries LPR FCR ECR2 C2 C Available products

19 P6-C4: Read Length Performance E. coli P6-C4, 4-hr movie, 20-kb BluePippin size-selected E. coli library (1 SMRT Cell) 19

20 QV Consensus Accuracy Performance Comparison Second Gen Accuracy Range Perfect consensus ~QV 50 consensus accuracy coverage: P6-C4 30x ±10 P4-C2 30x ±10 P5-C3 45x ± Coverage Aligned to Reference 20 kb E. coli library Resequencing analysis with SMRT Analysis v2.3 20

21 Achieve High Consensus Accuracy (> %, QV60) PacBio Evaluation Study for Microbial Genomes Koren S., et. al. (2013) Reducing assembly complexity of microbial genomes with single molecule sequencing. Genome Biology, 14:R101

22 Least Sequence Context Bias

23 Normalized coverage Lack of Sequencing Bias E. coli (50% GC) R. pal. (65% GC) B. sub. (43% GC) GC content (%)

24 Epigenome Information

25 Outline De Novo Assembly Complex Eukaryotic Genomes Structural Variation IsoSeq: Full Length RNA Sequencing Technology Roadmap 25

26 PacBio Assembles Microbial Genomes Into Single Contigs 26

27 Comparison of RS closed chromosome sequence- Genome Bareilly CFSAN against MiSeq and 454 RS was capable (and Miseq and 454 were incapable) of reading through a phage Peter Evans (FDA), ASM Meeting, May 2013

28 Selected Plant and Animal Genome Projects: 2013 & 2014 Bacteria 1-10 Mb Finished Genomes Yeast 12 Mb Resolve most chromosomes Arabidopsis 120 Mb Contig N Mb Drosophila 170 Mb Contig N50 15 Mb Spinach 1 Gb Contig N50 > 1Mb Human 3.2 Gb Contig N Mb Max=44 Mb

29 PacBio -Only De Novo Sequencing of Yeast I II III IV V VI VII VIII IX X XI XII XIII XIV XV XVI M 100 kb Reference (S228C): 17 contigs Genome size = 12.3 Mb PacBio DevNet Datasets HGAP de novo assembly : 30 contigs (W303 strain) Assembly size = 12.3 Mb N50 = 770 kb Max contig = 1.5 Mb (chr. IV)

30 PacBio-Only Sequencing of Arabidopsis PacBio data recently used to assembly Ler-0 strain Estimated Genome Size Short-read (Ler 1)* PacBio reads (Ler-0) Improvement 110,357, ,572, % Contigs 4, X N50 Contig Length Max Contig Length 66,600 6,190,353 93X 462,490 12,982,390 28X * Read Blog blog.pacificbiosciences.com Download pacb.com/devnet

31 200,000+ SNPs Were Missed In Short-Read Assemblies Mapping of Illumina PE or PacBio Assemblies to TAIR 10 Ler0 ILMN PE 27,106 Cvi ILMN PE 55, ,836 95%/68% 685,104 92%/72% PacBio Ler0 Assembly 238,637 PacBio Cvi Assembly 271,335 In collaboration with Joe Ecker at Salk Institute for Biological Studies Not only did PacBio discover pretty much everything that Illumina pairedend reads was able to find, in this case 95% and 92%, it identified another 250,000 of these variants Chongyuan Luo, Ph.D The Salk Institute for Biological Studies Resolving the Complexity of Genomic and Epigenetic Variations in Arabidopsis PAG 2014 Workshop blog.pacificsciences.com

32 SNP Discovery with PacBio Assemblies PacBio assembly identifies SNPs in Illumina lowcoverage (unmappable) regions Called SNPs between Cvi and Col Both Illumina only PacBio only Analysis by Jason Chin Watch Arabidopsis Genome blog.pacificbiosciences.com Other PAG XXII Recordings 32

33 Long-Read Shotgun Human Genome Data Release

34 Long-Read Shotgun Human Genome Data Release Total number of reads: 21,856,161 bp Total number of post-filtered bases: 167,851,128,644 bp Average throughput per SMRT Cell: 608 Mb Average DNA insert length: 7,680 bp Half of sequenced bases in reads greater than: 10,739 bp Longest DNA insert sequenced: 42,774 bp

35 Human Genome De Novo Assemblies Comparison Contig N50 (kb) HuRef (Venter) BGI YH KB1 NA12878 RP11_0.7 CHM1 CHM1 Technology ABI 3730 Illumina GA 454 GS FLX Titanium Illumina GA 454 GS, HiSeq, MiSeq HiSeq, BAC clones PacBio RS II Assembly method Celera Assembler SOAP de novo Newbler ALLPATHS-LG Newbler Reference Guided FALCON, Celera Assembler # of library types NA 1 Total assembly size (Gb) Data sources: HuRef (Venter) ( BGI YH ( 20/2/265.abstract Table II); KB1 ( NA12878 ( early/2010/12/20/ abstract Table3); CHM1 (

36 Comparison of Human CHM1 Assemblies 44 MB contig 2014 PacBio de novo 2013 reference-guided short-read with BACs gaps MHC region

37 Comparison MHC from Assembly vs. GRCh37 Reference De novo assembly is co-linear with reference, but has many SNP & structural differences: 50 kb

38 Comparison MHC from Assembly vs. GRCh37 Reference De novo assembly is co-linear with reference, but has many SNP & structural differences: 50 kb

39 MHC Region PacBio Reads Mapped against GRCh37 Discontinuities indicate structural differences of CHM1 MHC vs. human reference genome MHC: Reads are shaded by length, black: >10 kb

40 MHC Region PacBio Reads Mapped against GRCh37 Discontinuities indicate structural differences of CHM1 MHC vs. human reference genome MHC: Reads are shaded by length, black: >10 kb

41 Structural Variation Detection by 2 nd Gen Technologies We observed that current high-throughput sequencing approaches only detected a fraction of the full size-spectrum of insertions, deletions, and copy number variants compared with a previously published, Sangersequenced human genome. Generating longer reads can mitigate these shortcomings. Pang et al. (2014) G3. doi: /g

42 Architecture of a Scrambled Genome

43 Public Datasets Comparison Aligned against GRCh37 Chromosome PacBio coverage PacBio reads HiSeq coverage HiSeq reads Genes HiSeq data have several regions that are missed or have poor coverage

44 HLA-C Immune System Response HiSeq data have several regions that are missed or have poor coverage

45 HLA-B Immune System Response

46 HLA-DRB1 Immune System Response

47 SHANK3 Involved in Autism HiSeq data miss 1 st exon and upstream region entirely

48 SHANK3 Involved in Autism CCCCGTCACAGCCCCCCAGACCCCCGCCCCGTGGCTCGGCCCCCGCCCTCCGCACACACCT CCCGCCCCCACCCGGGACCCCGCAAGTAACCCCCCAGCACTGGCCCTGAGCCCTCCCGGCC CCCGCCTCCGGCGCAGCCCCCTCGCCACCCCCGCTTCCCTCCCGTCTCAGGCCCCCTCCCCC CGCCGCCCCCGCCCCCGGGGAAGGCAGGCGCCGAGCTGAGCCGGGGCCGATGCAGCTG AGCCGCGCCGCCGCCGCCGCCGCCGCCGCCCCTGCGGAGCCCCCGGAGCCGCTGTCCCCC GCGCCGGCCCCGGCCCCGGCCCCCCCCGGCCCCCTCCCGCGCAGCGCGGCCGACGGGGC TCCGGCGGGGGGGAAGGGGGGGCCGGGGCGCCGCGCGCGGAGTCCCCGGGCGCTCCG TTCCCCGGCGCGAGCGGCCCCGGCCCGGGCCCCGGCGCGGGGATGGACGGCCCCGGGG CCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGGTGAGCCCCG 85% GC-rich

49 FLT3 Important in Acute Myeloid Leukemia HiSeq data misses region downstream of the gene

50 FLT3 Important in Acute Myeloid Leukemia TATATATAAATATATGTTATATATACATAAATATATGTTATATATATTTATATATATTTATATACATA TAAATATATATATTTATATACATATATAAAAATATATATATATTTATATATAAATATATGTTATATAT ATTTATATACATATAAATATATATTTATATACATATAAATATATATTTATATACATATAAATATATGT ATATACATATAAATATATATTTATATACATATAAATATATATTTATATACATATAAATATATGTATAT ACATATATATATGTATATACATATAAATATATATGTATATACATATAAATATATATGTATATACATAT AAATATATATAATATTTATATACATATATATATTTATATTTATATGTATATACATATATATTTATATTT ATATGTATATACATATATATATTTATATTTATATGTATATACATATATATATGTATATAAATATATAT ATTTATATGTATATAATATACATACATATATATATATTTTTT 94% AT-rich

51 FMR1 Causes Fragile X Syndrome HiSeq data has gap in causative CGG repeat

52 Sequencing the Unsequenceable 52

53 FMR1 - Fragile X Syndrome Human Reference (GRCh37) Illumina X10 Data (Short Reads) PACIFIC BIOSCIENCES CONFIDENTIAL Misses CGG repeat region which causes fragile X syndrome Data from:

54 TBX1 Implicated in Heart Defects HiSeq data miss portion of 2 nd intron and 3 rd exon

55 BEAN1 Implicated in Spinocerebellar Ataxia Type 31 HiSeq data miss 1 st exon entirely (GC-rich)

56 Genomic Variation Detection by 2 nd Gen Technologies Depending on the sequencing platform, 10% to 19% of inherited disease genes were not covered to accepted standards for single nucleotide variant discovery. Dewey et al. (2014) JAMA. 311:

57 Resolving Tandem Repeats with PacBio Long Reads PACIFIC BIOSCIENCES CONFIDENTIAL Bashir et al. (2014) Bioinformatics doi: /bioinformatics/btu437

58 Evan Eichler Key Opinion Leader in Human Genetics At the October 21 st meeting of the American Society of Human Genetics Pacbio accesses 99.6% of the human genome, compared to 85% for Illumina Evan Eichler, University of Washington PACIFIC BIOSCIENCES CONFIDENTIAL 58

59 Medical Grade Human Genome!! To get to a medical grade genome, or a genome that can be used for clinical diagnostic purposes, we need to have the most accurate and complete genome for each individual. We believe that the PacBio SMRT machines will help us reach this goal. For the Asian Genome Project, Macrogen and GMI investigators are seeking a more complete Asian reference genome to pursue detailed analyses of the populations in Asia. "Our goal is to make a complete Asian reference genome for future medical practice," Macrogen's Seo said, noting that the team is pursuing a "medical grade" genome sequence that is highly accurate and can serve as a reference in both research and clinical settings. 59

60 Targeted Sequencing FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures.. Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved.

61 Now Covers Entire Genes (With Introns)! Only possible with long-read sequencing technology Full-length targeted gene Long insert converted into SMRTbell template ,000 bases Continuous Long Reads (CLRs)

62 Advantages to Using SMRT Sequencing for HLA Typing 2 nd Generation Full-Length 2 nd Generation Gene Sanger PacBio Short-Read Sequencing Reads Sequencing by Short-Read Assembly SNP1 SNP2 PacBio technology can avoid all of these problems Ambiguity: 62

63 Targeted Sequencing: HLA Full-Length Gene Sequencing HLA Class I Genes: HLA-A, -B, -C HLA Class II Genes: HLA-DQA1, -DQB1, -DPA1, -DPB1, -DRB 5 UTR UTR HLA-A (5.5 kb) 5 UTR UTR HLA-B (4.6kb) 5 UTR UTR HLA-C (4.8 kb) 5 UTR UTR HLA-DQA1 (7.5 kb) 5 UTR UTR HLA-DQB1 (9.1 kb) 5 UTR UTR HLA-DPA1 (9.7 kb) 5 UTR UTR HLA-DPB1 (5.9 kb) (7.2Kb) 5 UTR UTR HLA-DRB1 (6 to11 kb) (5 to 6 kb) Exon Intron Primer **Gene structure not to scale 63

64 See the Whole Gene Fully phased, allele-specific HLA sequencing: Full-length, continuous long reads covering the heterozygous HLA-A gene Example shown from collaboration with Stanford Genome Technology Center, allele pair from cell line

65 FLT3 Compound Mutations and Haplotype Phasing FLT3 mutations impact acute myeloid leukemia treatment Activating internal tandem duplication (ITD) mutations in FLT3 detected in ~ 20% of AML patients and associated with a poor prognosis Case Study: A New Hope in Acute Myeloid Leukemia Treatment Potential resistance mutations located > 800 bp away from ITD region E608 F691 D835 Y842 ITD ( bp repeat) > 800 bp One PacBio Read Spans Region Smith et al. (2012) Validation of ITD mutations in FLT3 as a therapeutic target in human acute myeloid leukemia. Nature 485,

66 Smith et al. Used PacBio to Prove it is Driver Mutation 66

67 The Immune Repertoire 67

68 Identify Novel Pathogen-specific Antigen Binding Capture full-length IgG variable regions Differentiate between transcripts in mixed cdna samples with high accuracy Characterize diversity of antigen binding residues of complementarity determining regions (CDRs) Identify unusually long CDR3 sequences (21-25, up to 62 amino acids, compared to the usual 5-6) Identify novel pathogen-specific antigen binding in controlled experiments Larsen P.A. and Smith TP (2012) Application of circular consensus sequencing and network analysis to characterize the bovine IgG repertoire. BMC Immunol. doi: / /

69 IsoSeq RNA Isoform Discovery and Characterization FIND MEANING IN COMPLEXITY PACIFIC BIOSCIENCES CONFIDENTIAL Copyright 2013 by Pacific Biosciences of California, Inc. All rights reserved.

70 High-Quality Genomes & Transcriptomes Genome Assembly Genome Annotation and Understanding Isoform Sequencing

71 Current State of Transcript Assembly The way we do RNA-seq now is you take the transcriptome, you blow it up into pieces and then you try to figure out how they all go back together again If you think about it, it s kind of a crazy way to do things. Michael Snyder Stanford University Tal Nawy (2013) End-to-end RNA sequencing, Nature Methods 10: Ian Korf (2013) Genomics: the state of the art in RNA-seq analysis. Nature Methods 10:

72 Transcript Diversity

73 One Gene, Two Isoforms with Opposite Effects Bcl-x Bcl-x L Inhibits apoptosis Bcl-x S Activates apoptosis

74 Difficulties for Resolving Transcripts with Short Reads the complexity of higher eukaryotic genomes imposes severe limitations on transcript recall and splice product discrimination that are likely to remain limiting factors for the analysis of current-generation RNA-seq data. assembly of complete isoform structures poses a major challenge even when all constituent elements are identified. Ultimately, the evolution of RNA-seq will move toward single-pass determination of intact transcripts. Third-generation instruments will realize that potential and inspire new computing approaches to meet the next wave of innovation in transcriptome analysis. Steijger et al. (2013) Nature Methods 10,

75 PacBio Long Reads Cover Nearly All Transcripts Average PacBio Read: 8500 bases IL2 CD4 CYP2D6 CFTR BRCA1

76 ABRF NGS RNA-Seq Study: PacBio Isoform Sequencing Provides the Best 5 to 3 Coverage

77 Observing Transcript Diversity Multiple isoforms observed at a single loci Rat heart Rat lung Tseng, PAG 2014, Isoform Sequencing: Unveiling the Complex Landscape of the Eukaryotic Transcriptome on the PacBio RS II (poster)

78 Gene Identification, Even in Well-Characterized Human Cell Lines and Tissues, is Likely Far From Complete Identified over 13,000 fulllength isoforms Over 1/3 of these were novel, including 273 new genes Au et al. (2013) Characterization of the human ESC transcriptome by hybrid sequencing. PNAS doi: /pnas

79 Allele-Resolved Transcriptomes

80 RefSeq Ensembl PacBio Trinity EST Full-length Transcript Coverage # RefSeq Ensembl PacBio Trinity EST RefSeq Transcripts PacBio with Coverage of Ref- Seq Annotation 90% coverage of Ref-Seq Annotation PacBio reads overlap 81% RefSeq annotated transcripts >50% of PacBio transcripts missed by existing resources Thomas S, et al. (2014) Long-Read Sequencing of Chicken Transcripts and Identification of New Transcript Isoforms. PLoS One doi: /journal.pone

81 Detect Tissue-specific Differential Gene Expression Differential gene expression of newly identified genes and isoforms detected with PacBio transcriptome sequencing.

82 Validation of Gene Fusion Events Embryonal tumors with multilayered rosettes (ETMRs) Genomic Location Characterized by high-level amplification of microrna cluster C19MC Fusion of C19MC with TTYH1 driving the expression of microrna Various isoforms can be differentiated by single reads Kleinman et al. (2014) Fusion of TTYH1 with the C19MC microrna cluster drives expression of a brain-specific DNMT3B isoform in the embryonal brain tumor ETMR. Nat Genet. 46(1):39-44.

83 PacBio Data Release: MCF-7 Human Transcriptome Deep dataset of full-length cdna sequencing of RNA from human breast cancer cell line MCF-7 Length distribution of polished, nonredundant transcript sequences Compare PacBio-predicted fulllength transcripts against the known annotations View data analysis webinars Sequencing statistics: Total number of post-filtered bases: 14,062,161,755 Non-redundant transcript-length consensus sequences: 44,531 Total number of gene loci: 14,385 Transcript lengths: 400 bp 4,900 bp; average length of 1,929 bp Number of SMRT Cells: 119 (3 size selections, P4-C2 chemistry, 2 hour movies) For more details visit

84 Note: some pins represent multiple placements

85 Note: some pins represent multiple placements

86 Read Length (bp) PacBio Advances in Read Length P5 C P4 C C2 C2 Early PacBio chemistries FCR LPR ECR

87 DNA Sequencing: The Vision 87

88 88